ID: 1163099849

View in Genome Browser
Species Human (GRCh38)
Location 19:15088277-15088299
Sequence AAAAGGCTGATCCTCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163099849 Original CRISPR AAAAGGCTGATCCTCCAGGA GGG (reversed) Intergenic
900862460 1:5243280-5243302 AAAAGGCACAACCTCCAGGAAGG + Intergenic
900868929 1:5288138-5288160 AATTGGCTGAGCCTCCAGCATGG - Intergenic
901594814 1:10376442-10376464 AATAGGAAGATGCTCCAGGAGGG + Intronic
904282834 1:29433384-29433406 ATAAGGCTGATGCTGGAGGACGG + Intergenic
910258723 1:85276190-85276212 ACAAGGAGGATCCTCCAGGTCGG - Intronic
911889778 1:103353542-103353564 CCAAGACTGATCCTCCAGAATGG - Intergenic
912958441 1:114173369-114173391 ATAAGGATGATCCAACAGGAAGG + Intergenic
914376419 1:147077419-147077441 AGAGGCCTGATGCTCCAGGAGGG + Intergenic
915982494 1:160429398-160429420 AACTGGGTCATCCTCCAGGATGG - Intergenic
917534450 1:175864272-175864294 ATAAGGCTTCCCCTCCAGGAGGG + Intergenic
917964994 1:180172813-180172835 AAAAGGCAGCCTCTCCAGGACGG - Intronic
918605558 1:186421189-186421211 AAAAGGATGATCTTCAAGAAGGG + Exonic
919587943 1:199462865-199462887 AAGAGTCTGAGCCTCCATGATGG + Intergenic
920500418 1:206481748-206481770 AAAAGCCTCATCCTTCAGGAAGG - Intronic
920972760 1:210756779-210756801 AAAAGGCTAATCCTGAAGGTTGG + Intronic
922338689 1:224638341-224638363 AAAAGGCTGATGCTGGAGGCAGG - Intronic
922456414 1:225777242-225777264 AAAAATCTGATCCTCCAAGCAGG - Intergenic
923046937 1:230362455-230362477 CAAGGCCTGATCCTCCTGGAAGG + Intronic
924945056 1:248840414-248840436 GAATGTCTGATCCTCCTGGATGG - Intronic
1063198762 10:3767599-3767621 AAAGGACTCATCCTCCAGGGAGG + Intergenic
1064870335 10:19929971-19929993 AAATGACACATCCTCCAGGACGG - Intronic
1065980730 10:30893856-30893878 AAAAGTCTTATCCTCTGGGAAGG + Intronic
1066236242 10:33487753-33487775 AAAAGGATGATGCTCCGGCAGGG + Intergenic
1067259883 10:44680195-44680217 TAAAGGATGTTCCTCAAGGAGGG + Intergenic
1068110643 10:52676239-52676261 AAAAAGCTGAACCTGCTGGATGG + Intergenic
1068941518 10:62685359-62685381 ATAAGGCTGACCTTTCAGGAGGG - Intergenic
1070301169 10:75204651-75204673 AAAAGACTAATGCTCCAGGCTGG + Intergenic
1070858335 10:79628083-79628105 AATAGGCAGATCTCCCAGGAAGG - Intergenic
1075327514 10:121546227-121546249 AAATGGCTGATGCTACACGATGG + Intronic
1075932152 10:126308112-126308134 GTAAGGCTCATCCTCAAGGATGG + Intronic
1075996059 10:126877160-126877182 AAAAGGCACATCCTACATGACGG - Intergenic
1076418268 10:130307978-130308000 AAAAGCCTGAAATTCCAGGAGGG - Intergenic
1076762752 10:132613423-132613445 TAAAGGCTGAGTCTCCAGAAAGG - Intronic
1076930115 10:133526917-133526939 AAGAGGCTGTTGCACCAGGAGGG + Intronic
1081023552 11:37979094-37979116 AACAGGCTTTTCCTCCAGCATGG - Intergenic
1082752081 11:57030318-57030340 ATTATGCTGATCCTCCAGAAAGG + Intergenic
1083319538 11:61837471-61837493 GAAATGGTGACCCTCCAGGAAGG - Intronic
1087021032 11:93603570-93603592 AAAAGGCTGATACTGCAGGTAGG - Intergenic
1088685225 11:112279494-112279516 GCAAGGCTGAAGCTCCAGGACGG - Intergenic
1088801111 11:113308149-113308171 ACAGTGCTTATCCTCCAGGATGG + Intergenic
1089209036 11:116788416-116788438 AAGAGGCTGAGCCACCCGGAGGG - Intergenic
1089225649 11:116918731-116918753 AAAACGTTGATGTTCCAGGAAGG - Intronic
1089321045 11:117626903-117626925 AGCACCCTGATCCTCCAGGAAGG + Intronic
1090916335 11:131166761-131166783 AGAAGGATGGTGCTCCAGGACGG - Intergenic
1092114985 12:5994064-5994086 AAGACACTGCTCCTCCAGGATGG + Exonic
1095436832 12:42198239-42198261 AAAAAGCAGATCCTCTATGAGGG - Intronic
1101762505 12:107670376-107670398 ACAAGGCTGAGCATCCAGGTTGG - Intergenic
1102873063 12:116428903-116428925 AACAGGCTGATCTTCCAGGGTGG - Intergenic
1105581545 13:21701611-21701633 TAAAGGCTTCTCCTCCTGGAGGG + Exonic
1106120875 13:26859394-26859416 AAAAGGCACATCCTACATGATGG + Intergenic
1108830922 13:54477307-54477329 ACAAGTATGATCCTCCAGAAAGG + Intergenic
1110004242 13:70246318-70246340 AAAAGGCTGCTCTTAAAGGATGG - Intergenic
1111529177 13:89514713-89514735 AAAAGGATGGTCTTCCAGGAGGG + Intergenic
1113702716 13:112399259-112399281 CAAGGGTTTATCCTCCAGGAAGG - Intronic
1115966283 14:38892245-38892267 AAAAGGTCAATCCACCAGGAAGG + Intergenic
1118866739 14:69710347-69710369 AAATGGCTGATACTCCATGCAGG - Intronic
1123420206 15:20125081-20125103 AAACAGCAGCTCCTCCAGGAAGG - Intergenic
1123445655 15:20328451-20328473 AAACAGCAGCTCCTCCAGGAAGG + Intergenic
1123529430 15:21131617-21131639 AAACAGCAGCTCCTCCAGGAAGG - Intergenic
1125657767 15:41372213-41372235 AAAATGGTGACCCTCCAGGAAGG + Intronic
1125928791 15:43584857-43584879 GAAAGGCAGGTCCTCGAGGAAGG + Exonic
1125941957 15:43684692-43684714 GAAAGGCAGGTCCTCGAGGAAGG + Intergenic
1127322952 15:57865375-57865397 AAAAGGCTGATCGACATGGAAGG + Intergenic
1127899599 15:63331117-63331139 AAGAAGCTGAGCCTCCATGATGG - Intronic
1128113285 15:65089724-65089746 ACAAGGCTGGGCCTCCAGGCAGG - Intergenic
1128134301 15:65251319-65251341 AAAATAATGATGCTCCAGGATGG + Intronic
1129941536 15:79501331-79501353 AAAAGGCTGATCCTCCCATGAGG + Intergenic
1133137968 16:3725383-3725405 AAAAGGCTGCACAACCAGGAGGG + Exonic
1135265641 16:21023459-21023481 AAAAATCTCCTCCTCCAGGAAGG - Intronic
1135469755 16:22719668-22719690 AAAAGGCTGATCCCCGAAAAGGG + Intergenic
1135864675 16:26090445-26090467 GAATGGATGATCCTCTAGGAAGG - Intronic
1137927573 16:52555235-52555257 GAAAGTATGATCCTCCCGGAGGG + Intergenic
1138262593 16:55636058-55636080 TCAAAGCTGATCCTGCAGGATGG + Intergenic
1138558211 16:57785274-57785296 CAAAAGCGCATCCTCCAGGATGG + Intronic
1139335033 16:66225768-66225790 CAAGGACTGATCCTCCTGGATGG - Intergenic
1139711414 16:68779315-68779337 AAGAGGCACATCCTCCAGGGAGG + Intronic
1140343253 16:74186452-74186474 AGATGGCTGAGCATCCAGGAGGG + Intergenic
1142565567 17:837842-837864 AAATGGCAGAGCCACCAGGAGGG - Intronic
1142975584 17:3641954-3641976 CAAAGTCTGATCCTACAGGGTGG - Intronic
1143556973 17:7668050-7668072 GCAAGGCTGAGCCTCCAGGGTGG - Intronic
1148752456 17:49953122-49953144 AACAGGCTTCTCCTCCAGGCAGG + Intergenic
1148894890 17:50833928-50833950 AAAAGACAGATCCTGCAGAATGG + Intergenic
1152462229 17:80447440-80447462 AAAAGGCTTTCCCTCCATGAAGG + Intergenic
1155587910 18:27388986-27389008 AAAAGGCTGAGGCTGGAGGATGG + Intergenic
1156088997 18:33442314-33442336 AAAAGGGAGATTATCCAGGATGG + Intergenic
1160855189 19:1214109-1214131 AACAGGAAGAGCCTCCAGGAGGG - Intronic
1161024384 19:2028868-2028890 AAGGGGCTGATCCAGCAGGAGGG + Intronic
1161037879 19:2095651-2095673 AGGAGGCCGATCCCCCAGGAGGG - Intronic
1163099849 19:15088277-15088299 AAAAGGCTGATCCTCCAGGAGGG - Intergenic
1166219880 19:41357541-41357563 CAAGGGCTGTTTCTCCAGGAAGG - Intronic
1168490376 19:56803880-56803902 AAAATCCTGACCATCCAGGATGG + Intronic
924988954 2:294921-294943 AACAGTCTGCACCTCCAGGAAGG + Intergenic
925753163 2:7108248-7108270 AAAAGGCTGATATCCCAGAAGGG - Intergenic
926587771 2:14707529-14707551 ATAATGCTCATCCTCCAGGGTGG + Intergenic
926790550 2:16567062-16567084 AAGGGGCTGATCCTGCAAGAGGG + Intronic
927362971 2:22258605-22258627 AAAAGGCTGATTCTCTGAGAAGG - Intergenic
927729011 2:25453808-25453830 AATAGGCTTACCCTCTAGGAGGG - Intronic
929331425 2:40685874-40685896 AAAAGGCTGAATCTCAAGGTAGG - Intergenic
929400207 2:41571309-41571331 AAAATGCTAATCTTTCAGGATGG + Intergenic
929889715 2:45908806-45908828 AGAAGGATTATCCTCCAGGGTGG + Intronic
931260823 2:60617276-60617298 AAAAGGCAGATCCTCCAGGCAGG + Intergenic
931750320 2:65324508-65324530 AAAAGGCTCATACAGCAGGAGGG - Intronic
933856390 2:86418413-86418435 AAGAGGCTGATCCTCCTGTCGGG - Intergenic
933969039 2:87455309-87455331 GGAAGGCTGCTCTTCCAGGAAGG + Intergenic
936148409 2:109997031-109997053 AAACAGCAGCTCCTCCAGGAAGG - Intergenic
936324752 2:111495198-111495220 GGAAGGCTGCTCTTCCAGGAAGG - Intergenic
937004222 2:118496631-118496653 AAAAGGCTGGGCTTCCAGGGCGG - Intergenic
938081039 2:128370312-128370334 TATAGGCTCCTCCTCCAGGAGGG + Intergenic
938821194 2:134961973-134961995 AAAAGGGTGATGCTCATGGAAGG + Intergenic
942090744 2:172488394-172488416 AAAAATTTTATCCTCCAGGATGG + Intronic
943213873 2:185005439-185005461 AAAAGGCTTATCCTCTGGGTTGG + Intergenic
946446213 2:219741750-219741772 AAAATTCTGATCCTCCACGCTGG - Intergenic
946780342 2:223188280-223188302 AACAGCCTGATCATCCAGGATGG + Intronic
947309139 2:228781194-228781216 AAAAGGCAGATTTTCCTGGATGG - Intergenic
947701362 2:232237334-232237356 AAAAGACAGCTCCACCAGGAAGG + Intronic
1169237275 20:3941004-3941026 ATAAGGCTGTTCCTCCGTGAAGG + Intronic
1169858486 20:10128398-10128420 GAAATGCTGATGCTCCTGGAGGG - Intergenic
1174426412 20:50434530-50434552 AAAGGCCTCCTCCTCCAGGAAGG - Intergenic
1178438389 21:32579267-32579289 AACAGGGTGATCCTTCAGGTGGG + Intronic
1178703608 21:34854735-34854757 AACAGCCTGGTCCTCAAGGACGG + Intronic
1180551683 22:16546153-16546175 AAACAGCAGCTCCTCCAGGAAGG + Intergenic
1180833410 22:18918012-18918034 AACAGGCTGAGCCTGCAGGGTGG + Intronic
1180992033 22:19942447-19942469 GAGAGGCTGCTCCACCAGGAAGG + Intronic
1181066415 22:20308243-20308265 AACAGGCTGAGCCTGCAGGGTGG - Intergenic
1181352324 22:22267770-22267792 AAACGGCAGCTCCTCCAGGAAGG - Intergenic
1183260687 22:36793592-36793614 AAAAGGCTGACCCTCCTCCAAGG + Intergenic
1183265692 22:36823903-36823925 AAACCGCTGACTCTCCAGGAAGG + Intergenic
1203283494 22_KI270734v1_random:143310-143332 AACAGGCTGAGCCTGCAGGGTGG + Intergenic
949329151 3:2901914-2901936 AGGAGGCTGATCCTCAAGCAAGG - Intronic
949403630 3:3692027-3692049 AAAAGGCTGAGCTTACAAGAAGG - Intergenic
949698020 3:6721468-6721490 AAAAGTTTGTTCTTCCAGGAGGG + Intergenic
949810213 3:7999533-7999555 AAAAGGCAGACCATCCAGTAAGG + Intergenic
950874403 3:16256936-16256958 ATAAGGCTGACTCTCCAGTATGG + Intergenic
951653080 3:24974408-24974430 AAAACTCTTATCCTCCAGGTGGG - Intergenic
953475230 3:43200353-43200375 AAAATGCTGCTCCTCCGGGCAGG + Intergenic
953737224 3:45506181-45506203 AAAAGGCTGACCTTTGAGGAAGG + Intronic
954425568 3:50441119-50441141 GACAGGGGGATCCTCCAGGAAGG + Intronic
956797197 3:72727899-72727921 ACAACCCTGATCCTTCAGGAGGG + Intergenic
957035259 3:75288500-75288522 AAATGCATGACCCTCCAGGAAGG - Intergenic
957585273 3:82124610-82124632 AAAAGACTGGTTCCCCAGGAGGG + Intergenic
958991071 3:100845827-100845849 AAAAGGCTGCTTTTGCAGGAAGG - Intronic
959238761 3:103760721-103760743 AAATGGCTGATACACCAGGGTGG + Intergenic
961079142 3:124010097-124010119 AAATGCATGACCCTCCAGGAAGG - Intergenic
961304332 3:125946372-125946394 AAATGCATGACCCTCCAGGAAGG + Intergenic
961833239 3:129635629-129635651 AAAGAGCTAATCCTTCAGGACGG - Intergenic
967910280 3:194537098-194537120 AAAATGCTGTTCTACCAGGAGGG - Intergenic
969158286 4:5232609-5232631 AGAAGGCAGACCCTTCAGGATGG + Intronic
971877616 4:32325624-32325646 AAACGGATGAACCTCAAGGAGGG + Intergenic
975169363 4:71215468-71215490 AAGGGTCTGATCCTCCAGGAAGG + Intronic
976034553 4:80798467-80798489 AAAAGAATGATCCTCCAACATGG - Intronic
977247372 4:94648904-94648926 AAAAGACAGATCATCCTGGATGG - Intronic
977761041 4:100737343-100737365 AAAAGGCAAATGCTCCAGGATGG - Intronic
983964968 4:173798820-173798842 AAAAAGCTGATCCTCCATCCTGG - Intergenic
984303642 4:177957170-177957192 AAAAGGCTGACATTTCAGGAGGG + Intronic
986349111 5:6860315-6860337 AAAAGAGTCATCTTCCAGGAAGG - Intergenic
986740239 5:10699624-10699646 ACAAGACTGATCCTCCATCAGGG + Intronic
987398770 5:17452864-17452886 ATAAAGCTGATCCTCCAACAGGG - Intergenic
987643076 5:20636100-20636122 ACAAGACTGATCCTACAAGAAGG + Intergenic
990287000 5:54310351-54310373 AAAAGGCTGCTCCTCAAGGCAGG + Intronic
990347326 5:54883716-54883738 AAAACTCCGATCCTCCGGGAAGG + Intergenic
990450964 5:55931264-55931286 AAGATGCTTTTCCTCCAGGAAGG + Intergenic
992385252 5:76278612-76278634 AAAAGGCTTAGCCCCCAGGATGG + Intronic
992792958 5:80230098-80230120 AGCAGGCTGAGCCTCCAAGAGGG - Intronic
997594863 5:135100401-135100423 AAGAAGCTGATGCTCCAAGATGG + Intronic
998128631 5:139640083-139640105 AAAAGGCTGGTCATCCATGCTGG - Intergenic
998174544 5:139893824-139893846 AAAAAGATTTTCCTCCAGGACGG + Intronic
998188250 5:139999679-139999701 TAAAGACTGTTCTTCCAGGAGGG - Intronic
998741515 5:145208181-145208203 AAAAGGCTGATTCTAGAGGTAGG - Intergenic
998848837 5:146335929-146335951 AAAAGACTGGTCCTTAAGGATGG + Intronic
998879770 5:146634198-146634220 AAAACGCTGACCCTCCTGCAAGG + Intronic
999459854 5:151748536-151748558 TAAAGGCAGATCTTCCAGCAAGG + Intronic
1000137400 5:158365980-158366002 AAAAGGCTGATCCTACAATCCGG - Intergenic
1001110738 5:168894078-168894100 AAATGGCAGATCCTCCACCAAGG + Intronic
1002921243 6:1574949-1574971 AGAAAGCTGAGACTCCAGGAGGG - Intergenic
1003133986 6:3418825-3418847 AAACGGCGGTGCCTCCAGGATGG - Intronic
1003879767 6:10469351-10469373 AAAAGGGAGATCATCCAGGTGGG - Intergenic
1008343532 6:50397385-50397407 AAGAGGCTAATCTCCCAGGAAGG + Intergenic
1008815398 6:55558692-55558714 AAAAAGCTCAGTCTCCAGGATGG - Intronic
1009344074 6:62591736-62591758 ATAAAGCTGATCCTTCAGCACGG + Intergenic
1010572987 6:77500356-77500378 ATAAGGCTGATTCTCAAAGATGG + Intergenic
1011006287 6:82649125-82649147 AAAAAGCTTATCCACCATGATGG + Intergenic
1012411062 6:98957620-98957642 AAGAGGATGATAATCCAGGAAGG + Intergenic
1013346384 6:109264434-109264456 AGAAAGATGATCCTCAAGGAGGG + Intergenic
1015762327 6:136677607-136677629 AGAAGGCTGCTCCTTCAGGCTGG - Intronic
1015798905 6:137041298-137041320 AAATGGGTGATACTCCAGCAAGG + Intronic
1019414901 7:922666-922688 AAGAGGCAAAGCCTCCAGGAAGG - Intronic
1020977401 7:15024034-15024056 AAGATTCTGATTCTCCAGGAAGG + Intergenic
1022326325 7:29335318-29335340 AAGAGACTGAGCCTCCAGCAAGG - Intronic
1022374714 7:29802751-29802773 AACAGGCTCAACCTCAAGGAGGG + Intergenic
1027219783 7:76206571-76206593 ACAGGGCTGAGCCTCCAGGATGG - Intronic
1031636350 7:124105883-124105905 AAATGGCACAGCCTCCAGGAGGG + Intergenic
1033238727 7:139659379-139659401 AAAAGGCTGCTCCTACTTGAAGG - Intronic
1036671189 8:10789256-10789278 AAAAGGATGCTCGTCCAGCATGG - Intronic
1037689932 8:21172999-21173021 AGAGGGCTGAGCCCCCAGGACGG + Intergenic
1042102170 8:65285149-65285171 ACCAGTCTGATGCTCCAGGAGGG + Intergenic
1048159564 8:132002263-132002285 AAAAGAATCATCCTTCAGGAAGG + Intronic
1052998146 9:34562496-34562518 AAAACGCTGACCCACCAGTAGGG - Intronic
1054732983 9:68720256-68720278 ACAAGGCTGCTCCTCGGGGAAGG - Intronic
1055773650 9:79744483-79744505 AAAAGCCTGATTATCCAAGAGGG + Intergenic
1055816048 9:80208387-80208409 AAAAGGTTGATGCTCAAAGAAGG - Intergenic
1056037432 9:82621740-82621762 AAAGGGCTGCTCCTCCATGCTGG + Intergenic
1056479041 9:86982362-86982384 AATAGGGAGATCATCCAGGAGGG + Intergenic
1059595905 9:115720525-115720547 AAAAGGCACATCCTCCTGGTAGG - Intergenic
1060782803 9:126425492-126425514 AAAATGGTGATCCTGCAGGCCGG - Intronic
1061201641 9:129141642-129141664 AAGAGTCTGACCCTCCAGGACGG - Intronic
1061495235 9:130970045-130970067 AAAAGGCTCTTCCTCCTGGTGGG + Intergenic
1062342335 9:136099398-136099420 AGAAGGCTGATCCTACTCGACGG + Intergenic
1187493926 X:19777947-19777969 AAAAGGTTGAGGCTACAGGAGGG + Intronic
1188380376 X:29484347-29484369 AAAAGGGTGAGCCCCCATGATGG - Intronic
1189321640 X:40090707-40090729 AAAAGTCTAATGCTCCGGGAAGG + Intronic
1190550516 X:51575260-51575282 AATAGGCTGATTGTACAGGATGG - Intergenic
1195345706 X:103949077-103949099 CAATGTCTGTTCCTCCAGGAAGG - Intronic
1195361893 X:104090361-104090383 CAATGTCTGTTCCTCCAGGAAGG + Intergenic
1198085417 X:133277802-133277824 AAAATGTAGATCCTCCAGGAGGG + Intergenic
1201471544 Y:14340754-14340776 AATAAGCTAATCCTACAGGACGG - Intergenic