ID: 1163100409

View in Genome Browser
Species Human (GRCh38)
Location 19:15092382-15092404
Sequence GTTTAAGGAGGATAGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163100399_1163100409 2 Left 1163100399 19:15092357-15092379 CCACGGGGAGTGGGACCATGACA No data
Right 1163100409 19:15092382-15092404 GTTTAAGGAGGATAGGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163100409 Original CRISPR GTTTAAGGAGGATAGGGGGT GGG Intergenic
No off target data available for this crispr