ID: 1163100424

View in Genome Browser
Species Human (GRCh38)
Location 19:15092529-15092551
Sequence GACTGAACTCTGCTGCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163100421_1163100424 -2 Left 1163100421 19:15092508-15092530 CCTTACCATCTCCGTTGCAATGA No data
Right 1163100424 19:15092529-15092551 GACTGAACTCTGCTGCTGTCTGG No data
1163100418_1163100424 28 Left 1163100418 19:15092478-15092500 CCAGGTCGTCAATATTGTCAGCT No data
Right 1163100424 19:15092529-15092551 GACTGAACTCTGCTGCTGTCTGG No data
1163100422_1163100424 -7 Left 1163100422 19:15092513-15092535 CCATCTCCGTTGCAATGACTGAA No data
Right 1163100424 19:15092529-15092551 GACTGAACTCTGCTGCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163100424 Original CRISPR GACTGAACTCTGCTGCTGTC TGG Intergenic
No off target data available for this crispr