ID: 1163105543

View in Genome Browser
Species Human (GRCh38)
Location 19:15121015-15121037
Sequence GAGGGACTGACTGGGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 280}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163105529_1163105543 22 Left 1163105529 19:15120970-15120992 CCTTGTGAGAGGCAGCCCAAGAG 0: 1
1: 1
2: 1
3: 14
4: 232
Right 1163105543 19:15121015-15121037 GAGGGACTGACTGGGAAGCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1163105534_1163105543 7 Left 1163105534 19:15120985-15121007 CCCAAGAGAGAGGGGCAAGGAGA No data
Right 1163105543 19:15121015-15121037 GAGGGACTGACTGGGAAGCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280
1163105535_1163105543 6 Left 1163105535 19:15120986-15121008 CCAAGAGAGAGGGGCAAGGAGAA 0: 1
1: 1
2: 4
3: 75
4: 511
Right 1163105543 19:15121015-15121037 GAGGGACTGACTGGGAAGCCAGG 0: 1
1: 0
2: 4
3: 31
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163105543 Original CRISPR GAGGGACTGACTGGGAAGCC AGG Intronic
900195418 1:1373328-1373350 GAGGGCCTCATTGGGAAGGCAGG - Intergenic
900497537 1:2982829-2982851 GAGGGGCGGCCTGGGATGCCGGG + Intergenic
900643077 1:3696563-3696585 GAGGGGCAGCCTGGGAGGCCAGG + Intronic
900719107 1:4163696-4163718 GGGGCACTGCCTGGGGAGCCTGG - Intergenic
901021980 1:6260475-6260497 GAGCGACAGGCTGGGAAACCTGG + Intronic
901430288 1:9209908-9209930 CAGGGACTGGCTGGGAAGCGGGG - Intergenic
901790989 1:11653742-11653764 GAGAGGATGACTGGGCAGCCTGG + Intronic
901923586 1:12552541-12552563 GAGGGGCTGACAGGGCAGCCTGG - Intergenic
902052790 1:13577363-13577385 CAGGGACAGTCTGGGAAGGCAGG - Intergenic
902293788 1:15452252-15452274 GTGGGTCAGACTGGGCAGCCTGG + Intergenic
903059278 1:20658295-20658317 GGGGCACAGACAGGGAAGCCAGG + Intronic
906118014 1:43368167-43368189 GAGGGAAGGGGTGGGAAGCCCGG - Intergenic
906208148 1:43997825-43997847 CAGGGACAGGCTGGGTAGCCAGG - Intronic
906528775 1:46511468-46511490 GAGGGACGGGCTGGGTAGCAGGG + Intronic
910244345 1:85122707-85122729 GAGTGACTGACAGGGGAGCAGGG + Intronic
912436065 1:109661764-109661786 GAGGGACTGGCTGGTGACCCTGG + Intronic
912451903 1:109772573-109772595 ATGGGACTGCCTGGGAAGCCTGG + Intronic
914675493 1:149904658-149904680 GAGGGAATGATGGGGAAGGCAGG + Exonic
914984739 1:152446764-152446786 GTGGAATTGACTGGGAGGCCTGG - Intergenic
916618809 1:166473220-166473242 GATGGAGTGGCTGGGAAGCAGGG + Intergenic
916669881 1:167006043-167006065 GAGAGACTGCCTGGGAATACTGG + Intronic
916673808 1:167049177-167049199 GAGTGACTGACTGTGATGCTTGG + Intergenic
916866337 1:168863459-168863481 GAGGAACTGAGTGGAAATCCAGG - Intergenic
917797520 1:178542714-178542736 GGGGTACTGACTGGGCAGCGCGG - Intronic
918730199 1:187983887-187983909 AAGGGATTGACTGGCAAGTCAGG + Intergenic
918794662 1:188877593-188877615 AAGAGACTCACTGAGAAGCCAGG + Intergenic
920747011 1:208638390-208638412 GAGGGACTGGGTTGGAATCCAGG - Intergenic
921739895 1:218671643-218671665 GACGGTCTTGCTGGGAAGCCAGG + Intergenic
922701460 1:227763588-227763610 GTTGGGCTGACTGGGGAGCCTGG + Intronic
922745342 1:228039981-228040003 GAGGGACAGCCTGGGACTCCTGG - Intronic
922873905 1:228925044-228925066 GAGAGGATGACTTGGAAGCCAGG - Intergenic
923063987 1:230501346-230501368 CAGGGACTTCCTGGGGAGCCTGG - Intergenic
923318049 1:232800904-232800926 GAGAGACAGACTGGGAAGTTGGG - Intergenic
923670175 1:236033537-236033559 GAGGGCATGACTGTGTAGCCTGG - Intronic
924113184 1:240720330-240720352 GAGGGTCACACTGGAAAGCCTGG - Intergenic
1063159306 10:3408226-3408248 GGGGGCCTGGCTGGGGAGCCTGG + Intergenic
1065742319 10:28808173-28808195 GATGGGCTTACAGGGAAGCCAGG - Intergenic
1066283137 10:33937797-33937819 GAGAGACTGACAGGGAAGAAAGG - Intergenic
1066283190 10:33938395-33938417 CCGGGATTGACTGGGAACCCGGG - Intergenic
1067435498 10:46273588-46273610 GAGGCACTGGCTCAGAAGCCAGG + Intergenic
1069044087 10:63724086-63724108 CAGGGATTGACAGGGAATCCAGG + Intergenic
1070857590 10:79619674-79619696 GTGGGAATGGCTGGAAAGCCTGG + Intergenic
1070888817 10:79927165-79927187 CAGGGACTGACTGTGACCCCTGG - Intergenic
1070935767 10:80293707-80293729 GAGGTAATGGCTGAGAAGCCAGG + Intergenic
1073025760 10:100486325-100486347 AAGGGACTGGGTGTGAAGCCAGG - Intergenic
1074982002 10:118627222-118627244 GTGGGAGTGGCTGGGCAGCCTGG + Intergenic
1075940498 10:126387452-126387474 TAGGGAGTGACCTGGAAGCCAGG + Intronic
1077496372 11:2888526-2888548 GAAGGACTGCCTGGGCAGCTCGG - Exonic
1077643756 11:3905076-3905098 AAAGTACTGTCTGGGAAGCCAGG + Intronic
1077791164 11:5441633-5441655 GAGTGTCTTACTGGGAAGGCAGG - Intronic
1080589217 11:33706948-33706970 GAGGAGCTGAGTGGGAAGCATGG + Intronic
1082767600 11:57181521-57181543 CTGGGACTGATTAGGAAGCCGGG - Intergenic
1083742626 11:64718912-64718934 GAGGCACTGGCTCTGAAGCCTGG + Intronic
1084285442 11:68128103-68128125 GAGTGACTGACAGGGAGGCAGGG + Intergenic
1084365708 11:68696288-68696310 TGGAGACTGAGTGGGAAGCCTGG + Intergenic
1084406864 11:68979305-68979327 GAGTGACTGCCAGTGAAGCCAGG + Intergenic
1084758917 11:71256111-71256133 CATGGCCTGGCTGGGAAGCCTGG - Intergenic
1085408211 11:76276698-76276720 AAGGGAGTGACTGGGAGGCCTGG + Intergenic
1086042818 11:82499348-82499370 GAGGGAGTGACTGGGATTTCAGG + Intergenic
1087177743 11:95110668-95110690 GAATGACTGACTGGGAAGAATGG - Intronic
1089055403 11:115581004-115581026 GAGGTACTGAATGTGGAGCCAGG - Intergenic
1089668006 11:120032541-120032563 GAGGGGCTGTCTGGGGTGCCAGG - Intergenic
1090027709 11:123181896-123181918 GAGGGAATGACAGGCAGGCCTGG - Intronic
1090629624 11:128634789-128634811 GAGGTCAAGACTGGGAAGCCAGG + Intergenic
1090803869 11:130190510-130190532 TAGGGGCTGTCAGGGAAGCCGGG - Exonic
1094818110 12:34205783-34205805 GGGAGACTGACTGGGAATACCGG + Intergenic
1096612732 12:52813742-52813764 GCGGGGCAGACGGGGAAGCCAGG + Exonic
1097141057 12:56902833-56902855 GAGGGACTGTCTGGACAGCAGGG + Intergenic
1101810278 12:108101977-108101999 CAGGGACTTACTGGGCAGTCTGG + Intergenic
1101834542 12:108286320-108286342 GAGGGGCAGAGTGGGAAGCCCGG - Intergenic
1101960980 12:109249890-109249912 AAGGGACTGACTGGGCAGCAAGG - Intronic
1102339296 12:112109015-112109037 GAGTCACTGACTGGGAAGTTAGG + Exonic
1103584570 12:121942470-121942492 CTGGGACTCTCTGGGAAGCCAGG + Intronic
1106408315 13:29493370-29493392 GAAGAGCTGCCTGGGAAGCCAGG + Intronic
1106453304 13:29904211-29904233 GATGGACAGACTGGGGAGCCAGG + Intergenic
1107576198 13:41725318-41725340 GAGGGAGTAACTGGAAAGACTGG + Intronic
1107809717 13:44188690-44188712 GATGGACTGTCTGGGTAGACTGG - Intergenic
1109133998 13:58624941-58624963 GTGGGACTGGCTGAGGAGCCAGG + Intergenic
1109481468 13:62961085-62961107 GAGGGACTGGCTGGAAAGCCTGG - Intergenic
1110170954 13:72499428-72499450 GAGGGACTAGCTGGGAGTCCTGG - Intergenic
1113080785 13:106517618-106517640 GAGGGCCTGCCTGGGAACCATGG + Intronic
1114367154 14:22041349-22041371 AAGGGACTGTCTAGGATGCCTGG - Intergenic
1117942628 14:60984754-60984776 GATGGACTGAGTAAGAAGCCAGG - Exonic
1118741443 14:68742278-68742300 GTGGGCCTGGCTGGGCAGCCAGG - Intergenic
1120568265 14:86085906-86085928 GAGGGTCTGACAAGGATGCCAGG + Intergenic
1121423296 14:93830979-93831001 GTGAGACTGACTGGCAACCCTGG - Intergenic
1122091766 14:99345664-99345686 AAGGGACAGGCTGGAAAGCCCGG + Intergenic
1122341099 14:101029045-101029067 GAGGGAGGGTCGGGGAAGCCAGG - Intergenic
1122468315 14:101949103-101949125 GAGACCCTGACTGAGAAGCCAGG - Intergenic
1125653072 15:41333121-41333143 AAGGGACCGAGAGGGAAGCCCGG + Intronic
1125724779 15:41862655-41862677 TAGGGACTGCGGGGGAAGCCGGG + Exonic
1131109965 15:89758827-89758849 GAGGGACTGGCTGGGAAATGAGG - Intergenic
1131209313 15:90479963-90479985 GAGGAAATAACTGAGAAGCCCGG - Intronic
1132200482 15:99951011-99951033 GAGGGAATGAATGTGAAGACAGG - Intergenic
1132293917 15:100720961-100720983 GAGGGAATGAATGGGGAGTCAGG + Intergenic
1132478191 16:153028-153050 GAGGGACTGGGTGGGAGGCCAGG + Intronic
1132480142 16:163240-163262 GAGGGACTGGGTGGGAGGCCAGG + Intronic
1132533629 16:466566-466588 GATGCTCTGTCTGGGAAGCCTGG + Intronic
1133290656 16:4718577-4718599 GAGGGACAGGCTGGGAAACCGGG + Intronic
1133500053 16:6357299-6357321 GAGGGAGAGACTGGGGAGCCAGG + Intronic
1134109590 16:11506844-11506866 GAGGGCCTGCCTGGGTTGCCAGG - Intronic
1134247122 16:12548266-12548288 GTGGACCTGACTGGGAAGGCTGG + Intronic
1135521881 16:23183731-23183753 AAAGGACTGAGTGGGATGCCTGG + Intronic
1135990122 16:27213640-27213662 GAGGGACGGACGGTGCAGCCGGG - Exonic
1136448331 16:30337533-30337555 AAGGCACTGACCGTGAAGCCAGG - Intergenic
1136779227 16:32886374-32886396 GAGGGGCAGGCCGGGAAGCCTGG - Intergenic
1136891390 16:33975144-33975166 GAGGGGCAGGCCGGGAAGCCTGG + Intergenic
1137671841 16:50283803-50283825 GAGGGAGTGACAGGGAGGCAGGG + Intronic
1139115221 16:63943368-63943390 TAGAGGCTGACTGGGAAACCTGG - Intergenic
1139320314 16:66109228-66109250 GAGGGCCTGGCTGGGGACCCTGG - Intergenic
1139372743 16:66478985-66479007 GTGGGTATGACTGGAAAGCCAGG - Intronic
1139485867 16:67256269-67256291 GAGACACTGAATGGGAAGCCTGG + Intronic
1140782333 16:78308080-78308102 GAAGGCCTGACTGGGAAAGCTGG - Intronic
1141649010 16:85382616-85382638 GAGGGACAGAATGGGGAGCAGGG + Intergenic
1141696012 16:85619773-85619795 GAGGGACTGACTTGCTAGGCAGG + Intronic
1142011026 16:87714261-87714283 GATGGACTGACTGAGAAGCACGG - Intronic
1142189229 16:88710033-88710055 GGGGGTCTGACTGAGCAGCCTGG + Intronic
1142414920 16:89936149-89936171 GAGGGGCTGACAGGGAGGCCCGG + Intergenic
1203081643 16_KI270728v1_random:1148462-1148484 GAGGGGCAGGCCGGGAAGCCTGG - Intergenic
1142638648 17:1272283-1272305 GAGGGGCCGACTTGGAACCCAGG + Intergenic
1143030001 17:3962659-3962681 GAGGAACTGACTGGGAGGGAGGG - Intronic
1143165939 17:4897340-4897362 GAGGGGCGGCCCGGGAAGCCTGG - Exonic
1143639226 17:8186140-8186162 GAGGGACAGACCGCTAAGCCTGG + Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144582110 17:16464938-16464960 CAGGGACTGGCTGGCAAACCAGG - Intronic
1144942622 17:18952150-18952172 GAGGGACTGAGGGGCAAACCAGG - Exonic
1145357342 17:22171669-22171691 GAGGGACTGGCTGGAAAGCCTGG + Intergenic
1145732331 17:27200243-27200265 GAGGGGCCCACTGGTAAGCCAGG + Intergenic
1145792638 17:27637583-27637605 GAGGGAAGGAATGGGGAGCCCGG + Intronic
1145807511 17:27745451-27745473 GAGGGAAGGAATGGGGAGCCCGG + Intergenic
1145886405 17:28385106-28385128 GGCGGACTGGCTGGGCAGCCTGG + Exonic
1147218785 17:38916045-38916067 GAGGGACTGGCTGGGCTGCCTGG - Intronic
1147313062 17:39606422-39606444 GAGGGACTGGCTTGGCCGCCCGG + Exonic
1148839341 17:50484630-50484652 GAAAGACTGACTGGTAAGGCGGG + Intronic
1149867071 17:60157020-60157042 GAAGGACAGACAGTGAAGCCAGG + Intronic
1151226873 17:72654545-72654567 GAGGGTCTATCTGGGAAGGCGGG - Intronic
1151358784 17:73576109-73576131 AAGGGGCTGCCTGGGATGCCTGG + Intronic
1152078218 17:78171372-78171394 GAGGGGAGGACTTGGAAGCCGGG - Intronic
1152109481 17:78349774-78349796 GAGGGGCTGGCTGGGAAGAAGGG + Intergenic
1157531739 18:48426975-48426997 GGAGGACTGACTGGGATGACCGG - Intergenic
1159856343 18:73594084-73594106 GAGGGAAGGACAGGGAACCCTGG + Intergenic
1159889228 18:73938872-73938894 GAGGGAGTGCCTGGGAAGGAGGG + Intergenic
1160255289 18:77243411-77243433 CAGGGACTGGCTGGGAAGCCAGG + Intergenic
1160696938 19:489396-489418 GAGGGTCTGGCTGGGAGGGCGGG - Intronic
1160841322 19:1148098-1148120 GAGGGAGAGCCTGGGGAGCCTGG - Intronic
1161049405 19:2154781-2154803 AATAGACTGACTGGGGAGCCAGG - Intronic
1161408565 19:4103545-4103567 GAGAGGCTGGCTGGGGAGCCTGG + Intronic
1163105543 19:15121015-15121037 GAGGGACTGACTGGGAAGCCAGG + Intronic
1163333290 19:16655333-16655355 GAGTGATTGACTGGAAACCCTGG - Intronic
1163446782 19:17351666-17351688 GAGGAAGTGGCTGGGAGGCCAGG + Exonic
1163519719 19:17784733-17784755 GAGGCACAGACTGGGGACCCGGG - Exonic
1163823695 19:19511044-19511066 GTGGGACTGGGTGGGAAGACGGG + Intergenic
1164061466 19:21679186-21679208 GGGAGGCTGGCTGGGAAGCCTGG + Intergenic
1164064798 19:21706585-21706607 GGGAGGCTGGCTGGGAAGCCTGG - Intergenic
1164411470 19:28009373-28009395 AAGGGAAGGAATGGGAAGCCGGG + Intergenic
1164713716 19:30376752-30376774 GAGTGACTGAATGGGAATACTGG - Intronic
1164849826 19:31472233-31472255 GATGGGCTGCCGGGGAAGCCAGG - Intergenic
1164889588 19:31812049-31812071 GTGGGAATGTGTGGGAAGCCAGG + Intergenic
1164977192 19:32581779-32581801 GAGGGGCCGCCTGGGAAGCTTGG + Intronic
1165451763 19:35888002-35888024 GAGGGAGTGACCGGGAATGCTGG + Intronic
1165934908 19:39383404-39383426 GAGGGCCTGACTGGGATGACAGG + Intronic
1166329075 19:42068484-42068506 GAGGGAGGGACTGAGGAGCCGGG + Intronic
1166361463 19:42254482-42254504 GAGGGCGTGAGTGGGGAGCCCGG - Intronic
1167115444 19:47486893-47486915 GAGGGGCTGCCTAGGAAACCAGG - Intergenic
1167136770 19:47621050-47621072 GAGGGAATGAATGGGAACCTGGG + Intronic
1167464561 19:49643569-49643591 GAGGGTGTGTCTGCGAAGCCTGG + Intronic
925067755 2:941892-941914 GAGGGAAGCACTGGGATGCCCGG + Intergenic
926008924 2:9393421-9393443 GGAGGCCTGAGTGGGAAGCCTGG + Intronic
926319761 2:11741193-11741215 GAGGGACTGACCAGGAGCCCGGG + Intronic
926763654 2:16303280-16303302 GAGGTGCTGATGGGGAAGCCAGG - Intergenic
927079493 2:19613499-19613521 CAAAGACTGAGTGGGAAGCCTGG + Intergenic
927650790 2:24912474-24912496 GATGGAATGGCTGGGATGCCAGG - Intronic
927852513 2:26509113-26509135 CTGGGACAGACTGGGAAGCTGGG + Intronic
928026088 2:27740060-27740082 GAGGGAGAGACTGGGCAGACGGG + Intergenic
928416142 2:31093522-31093544 GAGGCAGTGTCTGGGGAGCCTGG + Intronic
929928304 2:46232973-46232995 GAGGGTCTGCCAGGGCAGCCTGG + Intergenic
931841811 2:66159104-66159126 GAGGGACTAAGTGTGAGGCCAGG + Intergenic
934736873 2:96694084-96694106 GAGGGCCTGGCTGGGAAGTGTGG + Intergenic
937248681 2:120510221-120510243 GAGTGGCTGATTGGGATGCCTGG - Intergenic
937295397 2:120807047-120807069 GTGGGACTGACTGAGCAGCCAGG - Intronic
938713216 2:133993265-133993287 GAGGGGCTGACAGAGGAGCCTGG + Intergenic
942426725 2:175868033-175868055 GAGTCCCTGACTGGGAAGACTGG + Intergenic
942618913 2:177826476-177826498 AAGGGACTGACTGGGAACATTGG - Intronic
943626180 2:190202633-190202655 GAAGGACTGTCTGAGAAGGCAGG + Exonic
945316408 2:208375812-208375834 GAGGAACTGACAGGGAAGCTGGG + Intronic
946361415 2:219221176-219221198 GAGGGATAGACTGGGGGGCCCGG + Exonic
948657370 2:239485043-239485065 GGGGGAATGACTGAGAAGGCAGG + Intergenic
1171347076 20:24473613-24473635 GAGGGACGCACTGGGGAGACAGG + Intronic
1171953151 20:31439485-31439507 AAGGGACTCAGTGGAAAGCCTGG - Intergenic
1172024936 20:31942106-31942128 GAGTGAGTGTCTGGGAAGCAGGG + Intronic
1172432982 20:34907941-34907963 CAGGGACTGGCAGGGAAGCCAGG - Intronic
1172945539 20:38685425-38685447 GAGGCACTGAGTGGGAAGAGAGG + Intergenic
1174368978 20:50073571-50073593 GATGGACTGGCTCAGAAGCCTGG - Intergenic
1174740868 20:53012801-53012823 GAGGGACAGAGAGAGAAGCCGGG - Intronic
1175110805 20:56646595-56646617 GAGGGACTCACTGAGAGACCTGG - Intergenic
1175413790 20:58788223-58788245 GAGGGATTGAGGAGGAAGCCAGG + Intergenic
1175716098 20:61254557-61254579 GACGGACTGTTGGGGAAGCCAGG - Intronic
1175858743 20:62137729-62137751 GAGGGACTAGCTGGAAGGCCAGG - Intronic
1176120757 20:63453557-63453579 GGGCTCCTGACTGGGAAGCCAGG - Intronic
1180214854 21:46317568-46317590 CATGCACTGGCTGGGAAGCCTGG - Intronic
1181632993 22:24161194-24161216 GGGGGATTGACTGAGATGCCTGG + Intronic
1181933307 22:26420493-26420515 GAGGGAAGAACTGGGAAACCTGG + Intergenic
1182284187 22:29234302-29234324 CAGGGACTGCGTGGGGAGCCTGG + Exonic
1183186384 22:36293822-36293844 GTCGGACTGGCTGAGAAGCCCGG + Exonic
1184186321 22:42867605-42867627 GAAGGCCCGACTGGGCAGCCTGG - Intronic
1184449615 22:44575248-44575270 GAGGCTCTGGCTGAGAAGCCAGG + Intergenic
1184767659 22:46579967-46579989 CAGGGACTGGCTGGGTGGCCTGG + Intronic
1185015689 22:48341268-48341290 GAGCGGATGGCTGGGAAGCCTGG + Intergenic
950113052 3:10432802-10432824 GAGGGAACGACAGGGAAGCCTGG + Intronic
950152305 3:10697216-10697238 GAGTGACTGAAAGGGAAGCCTGG - Intronic
950462937 3:13135944-13135966 GAGGGTCTAACTGGGAGTCCTGG - Intergenic
950880799 3:16321343-16321365 GAGGAACTTAGTGGGAAACCAGG + Intronic
953573836 3:44096877-44096899 AGAGGACAGACTGGGAAGCCAGG - Intergenic
954433592 3:50484346-50484368 GGGGAACAGACTGGGAAGGCAGG - Intronic
954992248 3:54851556-54851578 GTGGGAGTGACTGGGATACCTGG + Intronic
955213361 3:56962574-56962596 GAGGGATTCACAGGAAAGCCAGG + Intronic
955233946 3:57123364-57123386 GAGGGAGTGACTGGGAAGGTAGG - Intronic
955412874 3:58667233-58667255 GAGGGGCTGACTGGAAAGAGGGG + Intergenic
955513935 3:59708117-59708139 GAGGGCCTGACTTGTAAGACAGG + Intergenic
958925234 3:100150028-100150050 GAGGGACTGTGTGGGCAGGCAGG - Intronic
962678162 3:137771195-137771217 GAGGGAGGGAGTGGGCAGCCTGG + Intergenic
962747069 3:138404799-138404821 CAGGGTCAGACTGGGAAACCTGG + Exonic
963945623 3:151143117-151143139 CAGGGAATGAGAGGGAAGCCGGG + Intronic
965557707 3:170035122-170035144 GAGGCATTGACAGGGCAGCCTGG + Intergenic
968235716 3:197029237-197029259 GAGGGACTGACCGGCAGGCGCGG - Intronic
968530769 4:1090234-1090256 GAGTGACTGGCTGGCAAGCAGGG + Intronic
968660764 4:1797876-1797898 GAGGGCCTGGCCGGGCAGCCAGG + Intronic
969285024 4:6197744-6197766 CAGGGCCTGAATGGGAACCCTGG + Intronic
970773933 4:19649789-19649811 ATGGGACTGACTGAGAATCCAGG - Intergenic
973830820 4:54757021-54757043 TAGGGACTGAGTGGGAAGGGTGG + Intergenic
978390505 4:108220236-108220258 GAGTCACTGACTGTGAAGCTGGG + Intergenic
982229308 4:153193980-153194002 GAGAGACTGACTGAGAAGCCTGG + Intronic
983267781 4:165525329-165525351 GAATGACTGACTAGGAGGCCTGG - Intergenic
983337527 4:166415963-166415985 GCTGGAGTGACTGGGAAGCAGGG + Intergenic
984043189 4:174763197-174763219 CAGGAACTGTCTGGCAAGCCAGG + Intronic
985371118 4:189285620-189285642 CAGGGACTGACTGGGGAGGCAGG + Intergenic
985928831 5:3039467-3039489 TGGGGAGTGACTGTGAAGCCTGG - Intergenic
986212122 5:5683815-5683837 GAGGCACTGACTGGTAATTCAGG - Intergenic
986619746 5:9659912-9659934 GAGGGACTCACTGGTGAGCTCGG - Intronic
988064881 5:26220233-26220255 GAGGGTCTGCCTGGTAATCCAGG + Intergenic
988983642 5:36596272-36596294 GAGGCACTTACTGGTAATCCTGG - Intergenic
990217685 5:53552304-53552326 GAGGGAGTCACTGGGCACCCAGG + Intergenic
990248513 5:53888791-53888813 GAGGGACTGGTAGGGAATCCTGG + Intronic
990263403 5:54049347-54049369 GAGGGACTTACTGGGAGGCTAGG - Intronic
990636369 5:57732216-57732238 GAGGGGCTGACGGGGCAGGCAGG + Intergenic
992227729 5:74635255-74635277 GAGAGACTGAGGGGGAGGCCGGG + Exonic
995498304 5:112773113-112773135 GATGGACTGATTGGGAAGAAAGG - Intronic
997778051 5:136629262-136629284 GAGGGAGGGGCTGGGGAGCCAGG - Intergenic
1001398456 5:171433032-171433054 GAGGTCTTGCCTGGGAAGCCCGG + Intronic
1002093212 5:176816854-176816876 GACGGAGCGACTGGGGAGCCAGG + Intronic
1002299020 5:178247275-178247297 GAGGGACAGACTGGGGTCCCGGG + Intronic
1003873688 6:10419737-10419759 CAGGGACTGACCGGGAAAGCGGG - Intergenic
1005994157 6:30921646-30921668 GCGGAACTGACAGGGAGGCCAGG + Exonic
1006175876 6:32121215-32121237 GAGGAACTCACTGGAAAACCTGG + Intronic
1006460709 6:34156041-34156063 GAGGGACAGAGTGGAGAGCCAGG + Intergenic
1006834278 6:36987290-36987312 AAAGGACAGACTGGGAAACCCGG - Intergenic
1007695223 6:43727939-43727961 GAAAGAATGACTGGGAAACCAGG - Intergenic
1007724641 6:43907862-43907884 GAGGGCCTGACTGGGCAGTGGGG + Intergenic
1007927801 6:45663771-45663793 GAGGGACAGGCAGGGATGCCTGG - Intronic
1009025217 6:57991403-57991425 GATGCACTGACTGGGTAGCTGGG - Intergenic
1009200790 6:60742855-60742877 GATGCACTGACTGGGTAGCTGGG - Intergenic
1011180864 6:84618925-84618947 CAGGGAGTCACTGGGAGGCCTGG - Intergenic
1012193804 6:96314864-96314886 GAGGGAGTAAGTGGGAGGCCAGG - Intergenic
1018376811 6:163220376-163220398 GAAGGACTGACTGCTAAGCGGGG + Intronic
1018785171 6:167102636-167102658 GATGGACTGAGTGGGGAACCAGG - Intergenic
1018919335 6:168160681-168160703 CAGGGACAGTCTGGGAAGCTGGG + Intergenic
1019353245 7:564940-564962 GAGCCACTGTCTGGGAACCCAGG + Intronic
1021527455 7:21604786-21604808 GAGGCCATGGCTGGGAAGCCAGG - Intronic
1024570890 7:50722141-50722163 GGGGGACAGCCTGGGAAGCTGGG - Intronic
1026914496 7:74111854-74111876 GAGGGAGTTCCTGGGGAGCCAGG + Intronic
1026966558 7:74443893-74443915 GAGGGGCTGAGTGGGAAGGGAGG - Intergenic
1029419671 7:100466232-100466254 AGGGGACACACTGGGAAGCCAGG + Intronic
1030184789 7:106750888-106750910 GAGGGCTTCTCTGGGAAGCCTGG + Intergenic
1033210041 7:139453757-139453779 GAGGGTCTGGCTGGGAAGCAAGG - Intronic
1033274321 7:139959804-139959826 GAGGGACTGACTGAGAGGTCTGG + Intronic
1033451022 7:141462526-141462548 TAAGGACTGAGGGGGAAGCCTGG + Intronic
1033876878 7:145831968-145831990 GAGCGGCTGACTGGGGATCCAGG + Intergenic
1034438528 7:151075167-151075189 GAGGGACTGGCTGGGCATTCTGG + Intronic
1034445338 7:151111180-151111202 GAGGCAGTGGCTGGGAAGGCTGG - Intronic
1035735463 8:1883991-1884013 GTGGGACAGTCTGAGAAGCCCGG + Intronic
1035901917 8:3465841-3465863 GAGGGACTGACTGTGACTCCAGG + Intronic
1036711889 8:11085122-11085144 GAGGTAGTGCCTGGGAGGCCAGG - Intronic
1038778202 8:30549627-30549649 GAGGGGCGGACGGGGAGGCCAGG + Intronic
1039484608 8:37900637-37900659 AAGGGACTGCCTGGGAGCCCAGG - Intergenic
1040864322 8:52032864-52032886 GAGGGACTCACTGGCTAGGCTGG + Intergenic
1040884414 8:52244159-52244181 GTGAGACTGAATGGGAAACCTGG + Intronic
1042867425 8:73368096-73368118 GTGGGTCTGGCTGGGATGCCGGG + Intergenic
1045823335 8:106367909-106367931 GGGGAACTGTCTAGGAAGCCAGG + Intronic
1047988391 8:130260645-130260667 GAGGGACTTACTTGCTAGCCTGG - Intronic
1048705263 8:137146600-137146622 GTGGGACAGCCTGGGAAGTCCGG + Intergenic
1048866024 8:138762429-138762451 GATGGATTCCCTGGGAAGCCTGG - Exonic
1049252127 8:141594924-141594946 GAGGCCCAGACTGGGAAGTCTGG - Intergenic
1049277265 8:141726106-141726128 GAGGGACAGGCAGGGAAGCTGGG + Intergenic
1049542011 8:143212961-143212983 GAGGCACTGAGCGGCAAGCCAGG + Intergenic
1049649196 8:143756333-143756355 GAGGGACTGTCTGAGAACCAGGG + Intergenic
1057565703 9:96164333-96164355 GAGGGAAAGGCTGGGAAGACGGG - Intergenic
1060225274 9:121786518-121786540 GATGGACAGCCTGAGAAGCCAGG - Intergenic
1060548205 9:124473012-124473034 GAGGGACTGACTGAGAGAACAGG - Intronic
1060873066 9:127058216-127058238 GAGGCAGTGACTGGGCAGCGGGG + Intronic
1060897861 9:127230022-127230044 GAGAGACTAGCTGGGAAACCTGG + Intronic
1060909849 9:127340834-127340856 GAAGGAGTGACTGGGGAGACAGG - Intronic
1061015108 9:127976953-127976975 GAGGGGCAGACTGTGAAGCGGGG + Intronic
1061191561 9:129085451-129085473 CAGGGACTGTTTGGGAGGCCTGG + Intronic
1061224433 9:129272582-129272604 GGGAGACTGACTGGGAAGCATGG - Intergenic
1061510834 9:131059994-131060016 CAGGGACTGAGTGAGAAGCCTGG - Intronic
1061760271 9:132846563-132846585 GAAACACTGACTGGGGAGCCGGG + Intronic
1062051825 9:134451381-134451403 GAGGGGAAGACTGGGAAGACTGG - Intergenic
1189282303 X:39827509-39827531 GAGAGACTGACTGTAAAGACTGG + Intergenic
1190378829 X:49818183-49818205 GAGGCACTGACAGGGAAGGTTGG + Intergenic
1192365661 X:70470825-70470847 GAGAGACGGACTTGGAAGCCTGG + Intronic
1194672345 X:96749901-96749923 TTGGGACTGACTTGGAAGCTGGG + Intronic
1194963685 X:100264214-100264236 GAGGGACAGACCTGGAAGCAGGG - Intergenic
1195756360 X:108202917-108202939 GAGAGACTTACCGGGAAGCCTGG + Exonic
1197776914 X:130124430-130124452 GAGAACCTGCCTGGGAAGCCAGG + Intergenic
1197833298 X:130668375-130668397 GTGGGACTGAGTGGAAGGCCTGG - Intronic
1200100530 X:153687626-153687648 GAGGGGCCGGCCGGGAAGCCTGG + Intronic