ID: 1163105789

View in Genome Browser
Species Human (GRCh38)
Location 19:15122484-15122506
Sequence AAGCAAGGCGGCCCTCGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163105789_1163105797 9 Left 1163105789 19:15122484-15122506 CCTCCACGAGGGCCGCCTTGCTT 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1163105797 19:15122516-15122538 ACCCAGTTCATTCCTGCCTCAGG 0: 1
1: 1
2: 9
3: 83
4: 392

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163105789 Original CRISPR AAGCAAGGCGGCCCTCGTGG AGG (reversed) Intronic
900439018 1:2644173-2644195 AAGAAAGGCTGCCCCAGTGGTGG + Intronic
900566204 1:3333224-3333246 ACACAGGGAGGCCCTCGTGGGGG + Intronic
901053820 1:6439530-6439552 AATCAGGGTGGCCCTCATGGAGG + Intronic
902480476 1:16708799-16708821 AATCAGGGTGGCCCTCATGGAGG - Intergenic
904608964 1:31714855-31714877 AGGGAAGGGGGGCCTCGTGGGGG + Intergenic
907242050 1:53086320-53086342 AAGGAAGGATGCTCTCGTGGAGG + Intergenic
907331124 1:53672310-53672332 AAGGAAGGCGGGGCTTGTGGAGG - Intronic
916393245 1:164356665-164356687 AATTGAGGCGGCTCTCGTGGAGG + Intergenic
922237590 1:223733610-223733632 AAGAAAGGCAGCCCTGCTGGGGG + Intronic
1067749281 10:48959505-48959527 AAGCAAGGAGGGCCTCCTGGAGG + Intronic
1079133299 11:17762015-17762037 CAACAAGGAGGCCCTGGTGGGGG - Intronic
1081831429 11:46119693-46119715 CAGCAAGGTGGCCCTGGTAGGGG - Intronic
1083028218 11:59568773-59568795 AAGCAAGCCGGGCGTGGTGGTGG - Intergenic
1083609544 11:63998505-63998527 AAGGAAGGCGGCCCAGGTGTTGG - Intronic
1084673369 11:70620529-70620551 AAGGAAGGCGCCCATGGTGGGGG - Intronic
1088826658 11:113500980-113501002 AAGCAAGACGTCCCTGCTGGTGG + Intergenic
1101654578 12:106708627-106708649 AACCAAGGAGGACTTCGTGGAGG + Intronic
1105695226 13:22881858-22881880 AAGCAAGGCCCCCCTACTGGGGG - Intergenic
1107028231 13:35824999-35825021 GAGGAAGGCAGGCCTCGTGGAGG - Intronic
1113379370 13:109787571-109787593 AAGGAAGGCGGCGCTCCTGCGGG - Intergenic
1118765760 14:68908363-68908385 AAGCAAGACGCCCTTCCTGGAGG + Intronic
1122319562 14:100845606-100845628 CCGCCAGGCGGACCTCGTGGAGG + Intergenic
1122985757 14:105210887-105210909 TGGCTGGGCGGCCCTCGTGGTGG + Intronic
1123630612 15:22257810-22257832 ACGCAAGGCGGCAGTCGCGGAGG - Intergenic
1126024353 15:44431865-44431887 AAGTTAGCCGGCCGTCGTGGTGG - Intronic
1128759934 15:70209658-70209680 AAGCGAGGAGGCCCGCATGGTGG - Intergenic
1132722693 16:1324550-1324572 AAGCAGGGAGGCCTGCGTGGTGG - Intronic
1133014071 16:2930792-2930814 GAGCAAGCCGGCCCTGGAGGAGG + Exonic
1136294829 16:29295569-29295591 AAGCAGGGCAGCCCAGGTGGAGG - Intergenic
1136996016 16:35188459-35188481 AATCAAGGTGGGCCTGGTGGGGG + Intergenic
1138850913 16:60628256-60628278 AAGCAAAGCTGCCTTTGTGGAGG - Intergenic
1139974458 16:70797846-70797868 GAGCAAGGCGTCCCACATGGCGG - Intronic
1141360948 16:83394699-83394721 AAGCAAGGCAGCCATTGAGGAGG + Intronic
1146262985 17:31433750-31433772 AAGGAAGGAGGCCTTCCTGGGGG - Intronic
1149418783 17:56488258-56488280 AACCAAGGCAGCCTTGGTGGGGG + Intronic
1152688559 17:81707192-81707214 GATCAAGGCGGCCCTGGAGGCGG + Exonic
1157475627 18:48021718-48021740 AAGCAGGGGGGCCTTTGTGGGGG - Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1161629358 19:5344507-5344529 CAGCAAGGAGGCCCGAGTGGCGG - Intergenic
1163105789 19:15122484-15122506 AAGCAAGGCGGCCCTCGTGGAGG - Intronic
1163442363 19:17328473-17328495 AAGCCCGGAGGCCCTCCTGGAGG - Exonic
1163801029 19:19365587-19365609 AAATTAGCCGGCCCTCGTGGCGG + Intergenic
1164701721 19:30289492-30289514 AAGCACGGGGGCCCCCGGGGTGG - Intronic
1165907951 19:39204992-39205014 AAGGATAGAGGCCCTCGTGGTGG + Intergenic
1202714518 1_KI270714v1_random:34707-34729 AATCAGGGTGGCCCTCATGGAGG - Intergenic
944273192 2:197805279-197805301 CAGCGAGGCGGGCCTCCTGGAGG + Exonic
948925366 2:241092970-241092992 AAGGAAGGAGGCCCTCTTTGTGG - Exonic
1168769640 20:407421-407443 AAGCAAGGAGGCCCAGGAGGAGG + Intergenic
1172355334 20:34276009-34276031 AGGCAAGCTGGCCTTCGTGGGGG + Intergenic
1173030788 20:39357655-39357677 CAGCAAGGTGGCACTGGTGGTGG + Intergenic
1180258967 21:46653547-46653569 AAGCCAGGCGGCCTTGGTTGTGG - Intronic
1184730073 22:46366996-46367018 CAGCAGGGTGGCCCTGGTGGTGG + Exonic
1185295841 22:50054362-50054384 AAGCAAGGCCTCCCTTGGGGAGG - Intronic
952526526 3:34216324-34216346 AAGAAAGGCAGCCCTCCTGAAGG + Intergenic
955704550 3:61714704-61714726 CAGAAAGGCAGCCCTCCTGGTGG - Intronic
961672865 3:128547650-128547672 GAGCAAGGCGGCCCCCATGCCGG + Intergenic
965691861 3:171365786-171365808 AAGTAGGGAGGCCGTCGTGGTGG - Intronic
968986831 4:3880221-3880243 AAGCAAGGCGACCCCTGTGCAGG + Intergenic
976765154 4:88591865-88591887 AAGAAAGGCGGGCCTGGGGGAGG - Intronic
992460434 5:76954569-76954591 AACCAAGACGGCCCGCTTGGTGG - Intronic
999365520 5:151021030-151021052 TAGCAAGGCGACCCTCGAGGTGG - Intronic
1016039816 6:139421314-139421336 AAGCAAGCAGGCCTTCTTGGAGG - Intergenic
1018169959 6:161136830-161136852 AAGCAAGGCTGCTCTGGTGGGGG + Intronic
1019272358 7:157332-157354 AAGCAAGGCTGTCCCCGTGGAGG - Intergenic
1019329288 7:454739-454761 GAGCAAGGAGGCCTTCCTGGTGG + Intergenic
1022089460 7:27098050-27098072 AGGCAAGGCAGTCCTCCTGGAGG + Intergenic
1022818665 7:33937576-33937598 AAGGAAGGGGGCTCTCCTGGAGG + Intronic
1028604443 7:92640258-92640280 ATGGAAGGGGGCCCTCATGGAGG + Intronic
1035704382 8:1664075-1664097 TAGAAAGGCAGCCCTGGTGGAGG - Intronic
1036946945 8:13103159-13103181 AAACAAGCCGGGCCTGGTGGTGG + Intronic
1036987706 8:13555301-13555323 AAGAAAGGCTGTCCTCATGGAGG - Intergenic
1038327583 8:26583946-26583968 AACCAAGGCGGCCCTGGCTGGGG + Exonic
1045674123 8:104589133-104589155 ACGCGGGGCGGCCCTCCTGGGGG + Intergenic
1048497577 8:134947889-134947911 AAGGAAGGTGGGCCTGGTGGTGG - Intergenic
1049107890 8:140624998-140625020 AAGCAGGGAGGCCTTCCTGGAGG - Intronic
1049469150 8:142767648-142767670 AACCAAGGAGGCCTTCCTGGAGG - Intronic
1050683173 9:8137812-8137834 AAGCAGGGTGGTCCTTGTGGTGG + Intergenic
1060929915 9:127482852-127482874 AATCAAGGAGGCCTTCCTGGAGG + Intronic
1189332856 X:40153874-40153896 AGGCAGGGCTGGCCTCGTGGCGG + Intronic
1198675159 X:139123392-139123414 CAGCAAGGAGGCCATCATGGCGG - Intronic