ID: 1163105857

View in Genome Browser
Species Human (GRCh38)
Location 19:15122754-15122776
Sequence CGTGCTGTACCCCTACTTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 50}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163105857_1163105867 22 Left 1163105857 19:15122754-15122776 CCATGAAGTAGGGGTACAGCACG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1163105867 19:15122799-15122821 CCGGACCTGCAGGGACAGGGAGG 0: 1
1: 0
2: 2
3: 36
4: 305
1163105857_1163105864 18 Left 1163105857 19:15122754-15122776 CCATGAAGTAGGGGTACAGCACG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1163105864 19:15122795-15122817 AACACCGGACCTGCAGGGACAGG 0: 1
1: 0
2: 0
3: 6
4: 101
1163105857_1163105865 19 Left 1163105857 19:15122754-15122776 CCATGAAGTAGGGGTACAGCACG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1163105865 19:15122796-15122818 ACACCGGACCTGCAGGGACAGGG 0: 1
1: 0
2: 2
3: 13
4: 145
1163105857_1163105863 13 Left 1163105857 19:15122754-15122776 CCATGAAGTAGGGGTACAGCACG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1163105863 19:15122790-15122812 CCACAAACACCGGACCTGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 102
1163105857_1163105861 12 Left 1163105857 19:15122754-15122776 CCATGAAGTAGGGGTACAGCACG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1163105861 19:15122789-15122811 TCCACAAACACCGGACCTGCAGG 0: 1
1: 0
2: 1
3: 17
4: 139
1163105857_1163105860 3 Left 1163105857 19:15122754-15122776 CCATGAAGTAGGGGTACAGCACG 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1163105860 19:15122780-15122802 ACGGGCAGCTCCACAAACACCGG 0: 1
1: 0
2: 4
3: 16
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163105857 Original CRISPR CGTGCTGTACCCCTACTTCA TGG (reversed) Exonic
924909545 1:248496329-248496351 GGTGCTCTACCCCTTCTTCTAGG + Intergenic
924914557 1:248551731-248551753 GGTGCTCTACCCCTTCTTCTAGG - Intergenic
1065729711 10:28699804-28699826 CCTGCTGTTTCCCTACTCCAGGG - Intergenic
1067702413 10:48583350-48583372 CAGGCTGTACCCCTACCCCAGGG - Intronic
1076163139 10:128261571-128261593 CCTGCTGTACCCCTCCTCCTGGG + Intergenic
1078017909 11:7631044-7631066 CCTGCTGAAACCCTACGTCATGG - Intronic
1080425040 11:32147250-32147272 CTGGCTGTCCCCCTACTTCTAGG - Intergenic
1082760393 11:57121698-57121720 GGTGGTGTACCCCAACTACATGG + Intergenic
1087237331 11:95734520-95734542 CTTGCTGTTCCCCTGCTTGAAGG - Intergenic
1102026353 12:109715950-109715972 CCTGCTGCACCCCTAGTCCAGGG + Intronic
1110217273 13:73036892-73036914 AGTGGTGCACCCCAACTTCATGG + Intergenic
1110438651 13:75503552-75503574 GATGCTGTACCTCCACTTCAAGG + Intergenic
1118316424 14:64728893-64728915 CCTGCTGTAACACCACTTCACGG - Intronic
1121315769 14:92960262-92960284 CGTGCTGACCCCATACTTGAGGG + Intronic
1122652104 14:103231693-103231715 CCTGCTGTCCCCCTACTTCCTGG - Intergenic
1127267227 15:57372095-57372117 CATGCCTTACCCCTACTTCTAGG - Intergenic
1132519457 16:380818-380840 GGTGCTGTTCCCCGACTTCCCGG - Intronic
1132908655 16:2297422-2297444 CGTGCTGACCACCCACTTCATGG - Exonic
1136590821 16:31216653-31216675 CTTCCTGTTCCCCTCCTTCAGGG - Intronic
1138431050 16:56969490-56969512 AGTGGTGTAGCCATACTTCAGGG - Exonic
1141841800 16:86578562-86578584 CGTGCTCTGTCCCTTCTTCATGG - Exonic
1143231283 17:5357761-5357783 TGTGCTGTACCTCTGCTTCCAGG - Intronic
1146215469 17:30975778-30975800 CATCCTGTACCCCAACATCAAGG + Intronic
1147185396 17:38710677-38710699 CCAGCTGTACCCCTTGTTCATGG - Intronic
1157273326 18:46293253-46293275 CATGCTGTCCCCACACTTCATGG + Intergenic
1161348228 19:3778378-3778400 CATGCGGTACCCCTTCTCCACGG + Exonic
1163105857 19:15122754-15122776 CGTGCTGTACCCCTACTTCATGG - Exonic
1168024880 19:53636805-53636827 CATCCTGTACCCCAACCTCAAGG + Exonic
926389741 2:12376839-12376861 CCTGCTGTATCCCTTATTCATGG + Intergenic
927563187 2:24088248-24088270 TGTGGTGTACCCCAACTCCATGG + Intronic
930914787 2:56673128-56673150 CCTGCTGTACCACTATCTCAGGG + Intergenic
943049971 2:182902392-182902414 TGTGGTGCACCCCAACTTCATGG - Intergenic
945482984 2:210364227-210364249 CCTGCTGTACCATGACTTCAGGG + Intergenic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1181088635 22:20457079-20457101 CTTGCTGGCCCCCTACTTCCTGG - Intronic
1183831996 22:40423138-40423160 AGTGGTGTTCCCCTCCTTCAAGG - Intronic
951528605 3:23678125-23678147 GGTGCTGCACCCCAACTCCACGG - Intergenic
975641173 4:76501786-76501808 GGTGGTATACCCCAACTTCATGG + Intronic
977366747 4:96079255-96079277 CAGGCTGTTCCCCTGCTTCAGGG - Intergenic
987962177 5:24824338-24824360 CCTGCTGTACCTTGACTTCAGGG + Intergenic
989323989 5:40168709-40168731 AGTGCTGAACACCTACATCAAGG + Intergenic
995755349 5:115497560-115497582 CATGCAGAACCCCCACTTCAAGG + Intergenic
1007092292 6:39191708-39191730 CGCCCTGTACCGCTACTTCGTGG - Exonic
1023583219 7:41703909-41703931 CCAGCTTTACCCCTATTTCAAGG - Intergenic
1034337077 7:150330629-150330651 CTTGCTGGACCCTTGCTTCAAGG + Exonic
1035701390 8:1641606-1641628 CCAAATGTACCCCTACTTCAGGG - Intronic
1049180150 8:141218040-141218062 CGTGTTCTACACCGACTTCATGG - Exonic
1057185906 9:93057662-93057684 CCTGCTGGAACCCTGCTTCATGG + Intergenic
1060555523 9:124505531-124505553 CGTGCTTTGCCCCTACTGCTTGG - Intronic
1197787281 X:130211591-130211613 TTTGCTTTTCCCCTACTTCAAGG - Intronic
1199619684 X:149687950-149687972 AGTGCTGCACCCCAACTGCATGG - Intergenic
1201605622 Y:15781284-15781306 CCAGCTGTACCACTCCTTCATGG + Intergenic