ID: 1163106553

View in Genome Browser
Species Human (GRCh38)
Location 19:15125974-15125996
Sequence CACCTTCCGCAGCTTTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 142}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163106543_1163106553 13 Left 1163106543 19:15125938-15125960 CCTCAGCGGCTTCAGGAGCCCAG 0: 1
1: 0
2: 5
3: 65
4: 1399
Right 1163106553 19:15125974-15125996 CACCTTCCGCAGCTTTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 142
1163106549_1163106553 -6 Left 1163106549 19:15125957-15125979 CCAGACCTTTGGGGGCCCACCTT 0: 1
1: 0
2: 0
3: 10
4: 253
Right 1163106553 19:15125974-15125996 CACCTTCCGCAGCTTTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 142
1163106541_1163106553 15 Left 1163106541 19:15125936-15125958 CCCCTCAGCGGCTTCAGGAGCCC 0: 1
1: 0
2: 1
3: 14
4: 160
Right 1163106553 19:15125974-15125996 CACCTTCCGCAGCTTTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 142
1163106548_1163106553 -5 Left 1163106548 19:15125956-15125978 CCCAGACCTTTGGGGGCCCACCT 0: 1
1: 0
2: 0
3: 16
4: 216
Right 1163106553 19:15125974-15125996 CACCTTCCGCAGCTTTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 142
1163106539_1163106553 20 Left 1163106539 19:15125931-15125953 CCACGCCCCTCAGCGGCTTCAGG 0: 1
1: 0
2: 3
3: 8
4: 201
Right 1163106553 19:15125974-15125996 CACCTTCCGCAGCTTTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 142
1163106537_1163106553 28 Left 1163106537 19:15125923-15125945 CCAGGAGGCCACGCCCCTCAGCG 0: 1
1: 0
2: 2
3: 19
4: 232
Right 1163106553 19:15125974-15125996 CACCTTCCGCAGCTTTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 142
1163106542_1163106553 14 Left 1163106542 19:15125937-15125959 CCCTCAGCGGCTTCAGGAGCCCA 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1163106553 19:15125974-15125996 CACCTTCCGCAGCTTTCCATTGG 0: 1
1: 0
2: 0
3: 6
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163106553 Original CRISPR CACCTTCCGCAGCTTTCCAT TGG Intergenic
902108131 1:14055080-14055102 CTCCTTCCTCACCCTTCCATGGG - Intergenic
902713394 1:18255967-18255989 CCCCTGCAGCAGCTTGCCATTGG + Intronic
902788756 1:18750655-18750677 TACATTCCTCAGCTTTCCTTGGG - Intergenic
910579699 1:88809729-88809751 CTCCTGCCTCAGCTTCCCATTGG + Intronic
914787721 1:150849818-150849840 CACCTGCCTCAGCTTCCCAAAGG - Intronic
916158939 1:161889308-161889330 GACCTTTCCCAGTTTTCCATGGG + Intronic
919074816 1:192799808-192799830 CATCTTCCACAGCAATCCATGGG - Intergenic
919827127 1:201511217-201511239 CACCTGCCTCAGCCTTCCAAAGG - Intergenic
922759744 1:228120221-228120243 CACCTTCCCCATCCTGCCATGGG - Intergenic
1063743062 10:8846389-8846411 CACCTGCCTCAGCCTTCCAAAGG - Intergenic
1066196531 10:33105868-33105890 CACCTGCCTCAGCCTTCCAAAGG - Intergenic
1067995931 10:51273264-51273286 CTCCTTCCTCAGCTTTCCAAAGG - Intronic
1069450851 10:68516379-68516401 TACCTTCCCCAGCATTCCACAGG - Intronic
1070354516 10:75626689-75626711 CACTGTCCACAGCTTTCCCTGGG + Intronic
1072103092 10:92247755-92247777 CACCTGCCTCAGCTTCCCAAAGG + Intronic
1076227834 10:128794450-128794472 GCCCTTCCTCTGCTTTCCATGGG - Intergenic
1076263957 10:129094418-129094440 CACATTCCCCAGCTTTGCCTAGG + Intergenic
1082795050 11:57372710-57372732 CACCTCCAGCCACTTTCCATTGG + Intergenic
1082919109 11:58473117-58473139 CACCCTCCTCAGCTTCCCAAAGG + Intergenic
1084401723 11:68947858-68947880 CACCTGCCTCAGCCTTCCAAAGG + Intergenic
1084617541 11:70246469-70246491 CTCCTTCCCCAGCTTTCCCACGG - Intergenic
1087901349 11:103645226-103645248 CACCTTCCCCAGCTAGCCTTAGG + Intergenic
1091369770 11:135048194-135048216 CACCTGCCTCAGCTTCCCAAAGG + Intergenic
1095947553 12:47762202-47762224 CACCCTCCTGAGCTATCCATGGG - Intronic
1100586542 12:95985907-95985929 CACCTTGCGCTGCTGTCCACAGG - Exonic
1102040828 12:109799672-109799694 CACCTTCCCCAGCTGTGCAGTGG - Intronic
1106070847 13:26409484-26409506 CACCTGCCACAGCCTTCCAAAGG + Intergenic
1110310568 13:74044556-74044578 CACCATGCCCAGCTTGCCATTGG - Intronic
1112917022 13:104564276-104564298 CACCTTCAGCAGCTTTCATGGGG - Intergenic
1116770629 14:49123256-49123278 CACTTCCCTCAGCTTTCCTTAGG + Intergenic
1119840549 14:77789605-77789627 CACCTCCTGCAGTTTTCCAGTGG - Intergenic
1127941574 15:63703149-63703171 CACCTTGCTCAGCTTTTCAGAGG - Intronic
1131220155 15:90576984-90577006 CTCCTTCCCCAGCTTTACGTGGG + Intronic
1131629095 15:94157283-94157305 CACCTTCCGCAGCTAGGCTTAGG - Intergenic
1132929843 16:2453499-2453521 CGCCTTCCTCAGCTCTCCCTCGG + Exonic
1132945174 16:2528375-2528397 CACCTGCCGCAGCTTACCCTGGG - Exonic
1133778570 16:8918563-8918585 CACCTGCCTCAGCTTCCCAAGGG - Intronic
1136008558 16:27347670-27347692 CACCTTCCTCACATTCCCATTGG + Intronic
1136391338 16:29966568-29966590 CACCTGCCTCAGCCTTCCAAAGG - Intronic
1141402704 16:83764535-83764557 CCCCTTCCCCAGCTTTATATTGG + Intronic
1141610967 16:85181105-85181127 CAGCTTCCGCAGCTGCCCACAGG + Intronic
1141940353 16:87271900-87271922 AACATTTCTCAGCTTTCCATGGG - Intronic
1143578221 17:7807567-7807589 CACCTCCCGCAGCTTCTCCTGGG - Exonic
1144401628 17:14908782-14908804 GAGCTTCAGCAGCTTTCCAGGGG - Intergenic
1148451842 17:47783642-47783664 CTCCTGCCCCAGCTTTCCAGGGG + Intergenic
1148990463 17:51661710-51661732 CACCTTCCTCAAGTTTCCTTGGG - Intronic
1149224508 17:54453770-54453792 CACCTTCCCCATCCTGCCATAGG + Intergenic
1151084101 17:71361187-71361209 CACCTGCCGCAGAGCTCCATAGG - Intergenic
1155849909 18:30761182-30761204 CTTCTTCCTCAGCTTTCCAAAGG - Intergenic
1155850740 18:30770488-30770510 CACCTTCCCCATCATTCCACAGG + Intergenic
1156479935 18:37430030-37430052 CTCCTTCAGCATCTTTCCCTAGG + Intronic
1160272611 18:77401420-77401442 CACCTGCCTCAGCTTCCCAAAGG - Intergenic
1163106553 19:15125974-15125996 CACCTTCCGCAGCTTTCCATTGG + Intergenic
1164458828 19:28430554-28430576 CTCCCTCCTCAGCTTTCCAAAGG - Intergenic
1166158839 19:40936404-40936426 CACCTTCCAGCGGTTTCCATTGG - Intergenic
1166167781 19:41004309-41004331 CACCTTCCAGCGGTTTCCATTGG - Exonic
1166435998 19:42766874-42766896 CACCTGCCCCAGCTGTCCCTTGG - Intronic
1167936611 19:52913879-52913901 CACCTGCCTCAGCTTCCCAAAGG - Intergenic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
930028521 2:47044396-47044418 CTCCTTCCGCAGGTTTGCAAAGG - Intronic
931492561 2:62764641-62764663 CACACTCCTCAGCTTTCCACAGG - Intronic
931940164 2:67243267-67243289 CACCTTCCTCAGCAATCCTTTGG + Intergenic
934137125 2:89006822-89006844 CACCTTTCCCAGCTTTCCCAGGG - Intergenic
934140002 2:89037053-89037075 CATCTTTCCCAGCTTTCCCTGGG - Intergenic
934229238 2:90163498-90163520 CATCTTTCCCAGCTTTCCCTGGG + Intergenic
935272048 2:101443239-101443261 CACCTTTCGGAGTTTTCCTTTGG + Intronic
938869746 2:135462835-135462857 CACCTGCCTCAGCTTCCCAAAGG + Intronic
947617718 2:231569075-231569097 CACCTTAGCCAGCTTTCCTTGGG - Intergenic
948489311 2:238302283-238302305 CCCCTTCTGGGGCTTTCCATTGG - Intergenic
948844358 2:240676140-240676162 CACCATCCTCAGCATCCCATCGG + Intergenic
1170548578 20:17455993-17456015 CACCTGCCTCAGCCTTCCAAAGG - Intronic
1173291703 20:41720579-41720601 CACCTCCCTCAGCTTCCCAAAGG - Intergenic
1173550135 20:43927243-43927265 CACTTTCCTCAGGTTTCCAGGGG + Intronic
1174684595 20:52441566-52441588 CACCTTCTGGAACTGTCCATGGG + Intergenic
1176043576 20:63081003-63081025 CCCCTTCAGCAGCTTTGCATGGG - Intergenic
1176678589 21:9804549-9804571 CACCTTCCGCAATTTTAAATTGG - Intergenic
1178742513 21:35215502-35215524 CATCTGCCGCATCTTTCCAGAGG - Intronic
1179895882 21:44363014-44363036 CACCTGCCTCAGCTTCCCAAAGG + Intronic
1180134509 21:45853544-45853566 TACCCTCTGCAGGTTTCCATTGG + Intronic
949740853 3:7231933-7231955 CTCCCTCAGCAGCTTCCCATGGG - Intronic
949962974 3:9329630-9329652 CACCTTCCGCACCCTGCCATAGG - Intronic
952418928 3:33114170-33114192 CAGCTTCCGCAGCTTCCCACGGG + Exonic
952887972 3:38023109-38023131 CACCTCCCTCAGCTTCCCACTGG - Intronic
953837946 3:46363492-46363514 CACCTGCCTCAGCTTCCCAAAGG + Intergenic
955158519 3:56441833-56441855 CACCATCCCCAGCCTTCCCTGGG + Intronic
957158464 3:76577379-76577401 GACCTTACACAGCTTTCCCTTGG + Intronic
961171697 3:124801879-124801901 CACCATCAGCTGCTTTCCACTGG + Intronic
965072625 3:163934942-163934964 CACCTTCCACTGCTTACCCTAGG - Intergenic
965125386 3:164621138-164621160 CACCTTAGGGTGCTTTCCATTGG + Intergenic
967425671 3:189324571-189324593 CAGCTTCCGCAGCTTTGTTTGGG - Exonic
967489963 3:190079094-190079116 CACCTGCCTCAGCTTCCCAAAGG - Intronic
970430787 4:15987134-15987156 CCCCTTCACCAGCGTTCCATTGG - Intronic
971368342 4:25995273-25995295 CTCCTTCCCCTCCTTTCCATAGG + Intergenic
972358702 4:38306136-38306158 CACCTGCCTCAGCCTTCCAAAGG - Intergenic
973717169 4:53688426-53688448 CACATTCTGCAGCTCTCCCTTGG + Intronic
973814260 4:54604288-54604310 CACCTTCCCCACCTTGCCACAGG - Intergenic
974648543 4:64725319-64725341 CACCTTCCCCAGCTTGGCTTAGG + Intergenic
977466402 4:97387338-97387360 CTCCTTCAGTAGCTCTCCATTGG + Intronic
981200944 4:141978912-141978934 CACCTTCCGCATCCTGCCACAGG + Intergenic
984585101 4:181554254-181554276 CACCGCCCGCAGCTTTTCAGTGG - Intergenic
985396971 4:189554421-189554443 CACCTTCCGCAATTTTAAATTGG + Intergenic
985679420 5:1248192-1248214 CACCTTCCCCAACTCACCATAGG + Intergenic
985745671 5:1645426-1645448 CCCCTTCGCCAGCTTTCCACAGG - Intergenic
988881426 5:35507791-35507813 CACCTTCCCCAGCTAGCCTTAGG - Intergenic
989167883 5:38448398-38448420 CACCTTCCTCAGCTTTCTGGGGG + Intronic
993939419 5:94040685-94040707 CACCTTCCTCAGCATGCCACAGG + Intronic
994099017 5:95874454-95874476 CACCATGTGCAGCTTTCCACAGG - Intergenic
998610329 5:143681755-143681777 CACCTGCCCCAGCTTCCCAAAGG + Intergenic
998990584 5:147811284-147811306 GACCTTCTTCAGCTTTACATAGG - Intergenic
1002666692 5:180830761-180830783 CTCCTTCAGCAGCTTGCCACAGG + Intergenic
1003310857 6:4968791-4968813 CACCTGCCTCAGCCTCCCATAGG - Intergenic
1005236955 6:23775318-23775340 TACCTCCTGCAGCTTTCCAATGG - Intergenic
1008069544 6:47085595-47085617 CACCTACCTCAGCCTTCCAAAGG - Intergenic
1011285144 6:85715145-85715167 CACCTGCCGCAGCTTTGAACTGG + Intergenic
1011795927 6:90951275-90951297 CACCTGTCCCAGCTTTACATGGG - Intergenic
1013725594 6:113091661-113091683 CCCCATCCCCATCTTTCCATAGG - Intergenic
1014786158 6:125621877-125621899 AACCTTCCACAGCTTCCCATCGG + Intergenic
1017404883 6:154108388-154108410 CACCTTCCCCACCCTTCCACTGG - Intronic
1020617849 7:10482093-10482115 CATTTTCCACATCTTTCCATGGG + Intergenic
1026394571 7:69938260-69938282 CTCCTTCTGCAGCTTCCCGTAGG + Intronic
1029811178 7:103050638-103050660 CACCTTCCCCACCTTGCCACAGG - Intronic
1032707125 7:134431023-134431045 AAGCTTCCGCAGCTTGCCAAGGG - Intergenic
1037552152 8:19985095-19985117 CACCTGCCTCAGCTTCCCAAAGG - Intergenic
1037681022 8:21097569-21097591 CACCTAACTCAGCTCTCCATTGG - Intergenic
1040623334 8:49115120-49115142 CACCTTGAGCAGCTTTCCTGAGG + Intergenic
1045437970 8:102183607-102183629 CAGCTTCTGCAGCTTCCCCTGGG + Intergenic
1047358952 8:124150143-124150165 TACCTTCCTGAGCTTCCCATTGG + Intergenic
1049633293 8:143671415-143671437 CACCTGCCTCAGCCTCCCATGGG + Intergenic
1050306887 9:4313753-4313775 CTCCTCCCGCAGCCTTCCCTGGG + Intronic
1050351382 9:4743305-4743327 TCCCTTCCTCTGCTTTCCATGGG - Intergenic
1052843904 9:33317729-33317751 CACCTGCCTCAGCTTCCCAAAGG - Intronic
1052901626 9:33798732-33798754 CACCTTCCTCATTTCTCCATGGG - Intronic
1058494456 9:105540878-105540900 AACCTTCTGCATCTTTTCATAGG + Intronic
1058875822 9:109244006-109244028 CACCTTCCGCCTCTTCCCTTGGG - Intronic
1059269231 9:113061585-113061607 CATCTTCCCCTGCTTTCCACAGG + Intergenic
1059270367 9:113067034-113067056 CATCTTCCCCTGCTTTCCACAGG + Intergenic
1059271503 9:113072484-113072506 CATCTTCCCCTGCTTTCCACAGG + Intergenic
1059272634 9:113077928-113077950 CATCTTCCCCTGCTTTCCACAGG + Intergenic
1059273769 9:113083370-113083392 CATCTTCCCCTGCTTTCCACAGG + Intergenic
1059274903 9:113088816-113088838 CATCTTCCCCTGCTTTCCACAGG + Intergenic
1060731198 9:126038142-126038164 TAGCTTCCCCTGCTTTCCATGGG - Intergenic
1061694879 9:132365324-132365346 CACCTGCCTCAGCCTTCCAAAGG + Intergenic
1203663756 Un_KI270754v1:7084-7106 CACCTTCCGCAATTTTAAATTGG - Intergenic
1186034592 X:5408038-5408060 CACCTTCTGCAAATTTCCAGGGG + Intergenic
1187807394 X:23136096-23136118 CTCCTTCCTCATTTTTCCATGGG + Intergenic
1195551822 X:106180226-106180248 CATATTCCCCAGCTTTCCCTGGG + Intronic
1198498191 X:137215043-137215065 CACCTTCCCCACCCTGCCATGGG + Intergenic
1198655513 X:138909394-138909416 CACATCCAGGAGCTTTCCATTGG - Intronic
1201142604 Y:11041177-11041199 CACCTTCCTCAGCCTCCCAAAGG + Intergenic