ID: 1163112588

View in Genome Browser
Species Human (GRCh38)
Location 19:15170464-15170486
Sequence GCTGCTGGTCATTCTCGTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163112588_1163112599 30 Left 1163112588 19:15170464-15170486 CCAGGACGAGAATGACCAGCAGC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1163112599 19:15170517-15170539 AGCGGGACGCTGGGTTCTGGAGG 0: 1
1: 0
2: 0
3: 10
4: 122
1163112588_1163112593 12 Left 1163112588 19:15170464-15170486 CCAGGACGAGAATGACCAGCAGC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1163112593 19:15170499-15170521 GCCACTAGCAGTGGCAGCAGCGG 0: 1
1: 1
2: 6
3: 40
4: 339
1163112588_1163112597 21 Left 1163112588 19:15170464-15170486 CCAGGACGAGAATGACCAGCAGC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1163112597 19:15170508-15170530 AGTGGCAGCAGCGGGACGCTGGG 0: 1
1: 0
2: 1
3: 25
4: 177
1163112588_1163112595 13 Left 1163112588 19:15170464-15170486 CCAGGACGAGAATGACCAGCAGC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1163112595 19:15170500-15170522 CCACTAGCAGTGGCAGCAGCGGG 0: 1
1: 0
2: 7
3: 40
4: 380
1163112588_1163112596 20 Left 1163112588 19:15170464-15170486 CCAGGACGAGAATGACCAGCAGC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG 0: 1
1: 0
2: 1
3: 47
4: 260
1163112588_1163112598 27 Left 1163112588 19:15170464-15170486 CCAGGACGAGAATGACCAGCAGC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1163112598 19:15170514-15170536 AGCAGCGGGACGCTGGGTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 111
1163112588_1163112590 3 Left 1163112588 19:15170464-15170486 CCAGGACGAGAATGACCAGCAGC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1163112590 19:15170490-15170512 ACAGCGCCCGCCACTAGCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163112588 Original CRISPR GCTGCTGGTCATTCTCGTCC TGG (reversed) Exonic
900191570 1:1354375-1354397 GCTACTGGTCACTGTCCTCCTGG - Exonic
901760355 1:11467074-11467096 CCTGCTGGACTTTCTGGTCCAGG + Intergenic
901915770 1:12498740-12498762 GCTGCTGGGGGTTCTCTTCCTGG + Intronic
907391819 1:54163148-54163170 GCTGCTGGTCATTCCGGTCAGGG + Intronic
907647287 1:56257045-56257067 GCTGCTCCTCTTTCACGTCCAGG - Intergenic
908847489 1:68339561-68339583 GCTGCTGGTCCATCTCCTCCTGG + Intergenic
915894830 1:159803700-159803722 GCTGTCTGTCATCCTCGTCCTGG - Intronic
918675573 1:187280880-187280902 GTTGCTGTTCCTTCTCCTCCTGG - Intergenic
919085964 1:192920187-192920209 GCTGCTGGTGCTGCTAGTCCGGG + Intergenic
922780298 1:228247056-228247078 GCTGCTGTTCCTTCTCTACCAGG + Intronic
1063297548 10:4822438-4822460 GCTGATTGTAATTGTCGTCCTGG - Intronic
1063755748 10:9005676-9005698 GCTGCTGGTCAGGCTTGTTCAGG - Intergenic
1064552946 10:16521035-16521057 GCTGCTGGTGATCCTCATCCCGG - Exonic
1065806359 10:29396893-29396915 GCTGCTGGGCAGGCTGGTCCTGG + Intergenic
1067095455 10:43296481-43296503 GCTGGTGGTCTCTCTCCTCCAGG - Intergenic
1068078979 10:52294713-52294735 GCTGCTAGTCATTTACTTCCAGG - Exonic
1077062651 11:624652-624674 GCTGGTGGACATCCACGTCCCGG - Exonic
1077197683 11:1289399-1289421 GCTGCTGCTCAGTGTGGTCCTGG - Intronic
1081227020 11:40536666-40536688 TTTGCTAGTCATTCTCTTCCTGG + Intronic
1081726324 11:45332017-45332039 GCTGCTGGTCCTTGTCTGCCAGG + Intergenic
1083606711 11:63983149-63983171 GCTGCTGGTCCTTCCTGTCAAGG - Intronic
1083954651 11:65976739-65976761 GCTGCTGCTTCTCCTCGTCCAGG - Exonic
1093795069 12:23301475-23301497 TTTGCTGTTCATTCTCCTCCAGG + Intergenic
1094444751 12:30517591-30517613 GCTCCTGGTAATTTTCCTCCTGG - Intergenic
1097218822 12:57434901-57434923 GCTTCTGGCCTTTCTCCTCCTGG + Exonic
1097992086 12:65846284-65846306 GCTGCTGGTCAAGCTTGTTCTGG + Intronic
1099710149 12:86213308-86213330 GCTGCTGCTCTTTCTATTCCAGG + Intronic
1101642117 12:106594547-106594569 GCTGCGGGGCATTCTCGCCTCGG + Intronic
1104768311 12:131344996-131345018 GCTGCTGGTCACTCAGCTCCTGG + Intergenic
1104811737 12:131623593-131623615 GCTGCTGGTCAGTCAGCTCCTGG - Intergenic
1105070915 12:133234131-133234153 GCTGCTGCTCCTGCTGGTCCAGG + Exonic
1105303241 13:19153191-19153213 GCTGCTTTTCATTCTCATCCTGG + Intergenic
1113200789 13:107866374-107866396 GCTGCTGGTGCTCCTTGTCCCGG + Exonic
1113749725 13:112768880-112768902 GTTGCTGCTCATTCTCATGCTGG + Intronic
1115556153 14:34546517-34546539 GCTGCCGGTCACGCTCGGCCTGG + Intergenic
1115557755 14:34556564-34556586 GCTGCCGGTCACGCTCGGCCTGG - Intergenic
1119740671 14:77012011-77012033 CCTGCTACTCATTCTCCTCCCGG + Intergenic
1120789167 14:88563294-88563316 GCTGCGGCTCCTCCTCGTCCAGG + Intronic
1121773975 14:96578122-96578144 GCTGCTCCTCATTCTGTTCCTGG + Intergenic
1123695050 15:22873104-22873126 GCTGCCCGGCATTCTCTTCCTGG - Intronic
1125746810 15:42002638-42002660 GCTGGTGGTAATTATCTTCCTGG - Exonic
1127599787 15:60523973-60523995 GCTGTGGGTCATTCTCTTCTAGG - Intronic
1133985737 16:10666642-10666664 GCTGCTGTTCATTCCTGTGCAGG - Intronic
1134310770 16:13073461-13073483 GCTGCTGATGATGCTAGTCCAGG - Intronic
1135196300 16:20397834-20397856 GGTGCTGGTCAGGCACGTCCTGG + Intronic
1137701668 16:50502221-50502243 GTTGCTGGCCCTTCTCCTCCAGG - Intergenic
1139500920 16:67364415-67364437 GCTGCTTTTCTTTCTCCTCCTGG - Intronic
1142621137 17:1166371-1166393 GCTGTTGGTCTTTCTCAGCCAGG - Intronic
1143951958 17:10640010-10640032 GCTGCAGGTCATTCTTCTCTTGG + Exonic
1144560254 17:16315435-16315457 GCTACTTCTCATTCTCTTCCCGG + Intronic
1147695151 17:42346640-42346662 ACTGCTGGTCAATCTCTCCCAGG + Exonic
1149789795 17:59467009-59467031 GCTTCTGGCCAATCTAGTCCTGG + Intergenic
1153340850 18:3973371-3973393 GCTACTAGTCATTTCCGTCCTGG + Intronic
1155247841 18:23927100-23927122 CCTGCTGAGCATTCACGTCCAGG + Intronic
1157936671 18:51881344-51881366 GCTACTTGTCCTTCTCTTCCAGG + Intergenic
1158972098 18:62678045-62678067 GATGCTGGTGATTCTGGTCTGGG + Intergenic
1160507875 18:79437356-79437378 GCTGCTGGTCACTCCCTGCCTGG - Intronic
1161241216 19:3224904-3224926 GCTTGAGGTCCTTCTCGTCCAGG - Exonic
1163112588 19:15170464-15170486 GCTGCTGGTCATTCTCGTCCTGG - Exonic
1163294683 19:16404650-16404672 TCTGCTGGTCCATCTCGTCCAGG + Exonic
1163342029 19:16714872-16714894 GCTTCTGGTCATTCGCGTGATGG + Intergenic
1164845636 19:31430328-31430350 GCTGCTGGTCACTCTGGCTCAGG - Intergenic
1165221177 19:34317876-34317898 GCTGCTGCTTATTCTACTCCTGG + Intronic
1167287723 19:48608000-48608022 GCTGCTGCTGTTTCTGGTCCAGG - Intronic
1167998337 19:53425045-53425067 TCTGTTGCTCATTCTCTTCCTGG + Intronic
927506571 2:23618997-23619019 GATGCTGGTCCTTCCCCTCCAGG + Intronic
928014127 2:27638632-27638654 GCTGGTGTCCATTCTGGTCCTGG + Intronic
929911202 2:46090816-46090838 GCTTCTGGCCATTCTGATCCAGG + Intronic
941180955 2:162258773-162258795 GCTGCTGGAGATTTTCATCCAGG - Intergenic
945430537 2:209758537-209758559 GCTGTGAGTCATTCTGGTCCAGG - Intergenic
1170570017 20:17627355-17627377 GCTGCTGGTCAGCCTCCGCCTGG + Exonic
1176625907 21:9091777-9091799 GCGGCTGGTCAATCTGCTCCTGG + Intergenic
1178005683 21:28217504-28217526 GGAGCTGGACATTCTGGTCCAGG + Intergenic
1179909570 21:44440866-44440888 GCTCCACGTCATTCTGGTCCTGG - Exonic
1181005240 22:20010319-20010341 GCTCCTGGTCCTTCTCACCCTGG - Intronic
1181181966 22:21074783-21074805 GCTGCAGGTCGTTCTCTTCTGGG - Intergenic
1182081655 22:27533511-27533533 GCTGCTGGTAATACTCTTCTGGG - Intergenic
1182444766 22:30383587-30383609 TCTGCTGGGCAGTCACGTCCCGG - Intronic
1183176494 22:36228189-36228211 GCTGCTGGTCTTTATCGTGGCGG + Exonic
1183309801 22:37103249-37103271 GCTGCTGGCCCTGCTCGTGCTGG - Exonic
1185422017 22:50740008-50740030 GCTGCTGGCCATTCTCCTGGTGG + Intronic
950405513 3:12801870-12801892 GCTGCTGGTGATTCTGATGCTGG + Intronic
952931474 3:38364308-38364330 TCTGCTTGTCATTCTTCTCCAGG + Intronic
953398520 3:42591527-42591549 TCAGCTGGTCATTCTCCTCAAGG - Exonic
954698992 3:52441944-52441966 GCTGCTGGTGCTTCTCTCCCAGG - Intronic
955343555 3:58144001-58144023 GCTGCTGGTCCTCTTCTTCCAGG - Intronic
969157550 4:5224559-5224581 GCTGCTGGTCTTTTCCTTCCTGG + Intronic
970005090 4:11402849-11402871 TCTGCTGGTAATTCTCCTTCAGG - Intronic
971845095 4:31908196-31908218 GCTCCTGGTGAATCTCTTCCCGG - Intergenic
974626330 4:64432074-64432096 GGTCCTTGTCATTCTCCTCCAGG - Intergenic
975118217 4:70703041-70703063 TTTGCAGGTCATTCTCGTGCAGG + Intergenic
985105560 4:186496199-186496221 GCAGCTGATCATTCTGTTCCTGG - Intronic
985679431 5:1248236-1248258 GCTGCCTGTTTTTCTCGTCCGGG - Intergenic
988042779 5:25910434-25910456 GCTTCTGGTGCTTCTCCTCCCGG - Intergenic
990026746 5:51201086-51201108 GCTGGTGTTCATACTCCTCCTGG - Intergenic
990347110 5:54882019-54882041 GATGCTGGTGATTCTCTTCCTGG + Intergenic
997226314 5:132211915-132211937 GCTACTGGTCATTAGCATCCTGG - Intronic
998041165 5:138951814-138951836 GCTGCTGGTCATCCTGGCCACGG - Exonic
999226792 5:150032373-150032395 GCAGCTGCTCATTCTGGTTCTGG + Intronic
999436654 5:151568496-151568518 GCTTCAGGTCATTCTGGTCCAGG + Exonic
1001481568 5:172092504-172092526 GCTGCTGTGCATGCTTGTCCCGG + Intronic
1001730886 5:173956042-173956064 GCTGCTATCCATTCTCGTGCTGG + Exonic
1003477069 6:6492927-6492949 GCTGCTGGGCGTTCCCATCCTGG + Intergenic
1005754869 6:28917203-28917225 GCAGATGGTCAGTCTCATCCAGG - Intronic
1011165764 6:84444162-84444184 GATGCTGGCCATTCCCTTCCTGG + Intergenic
1014241309 6:119021047-119021069 GATGCTGGTGATGCTGGTCCTGG - Intronic
1019157360 6:170048374-170048396 GCTTCTGGTCTTTCTCTTACAGG + Intergenic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1019483145 7:1275374-1275396 GCCCCTGGACATTCTCCTCCTGG + Intergenic
1025993658 7:66514309-66514331 GCTGCTGGACTTTCCCATCCTGG - Intergenic
1035182835 7:157102461-157102483 GCTGCAAATCATTCTGGTCCTGG + Intergenic
1037673103 8:21032205-21032227 GCTGCTGTTCATTCTCCTTGGGG - Intergenic
1044613119 8:94113971-94113993 GCTACTGGAGATTCTCGTCCTGG + Intergenic
1056558115 9:87706626-87706648 GCTGCTGGTCAACCACGGCCAGG + Exonic
1059399762 9:114061539-114061561 CCTGCTGGTCATTCCCATGCAGG + Exonic
1061888010 9:133602504-133602526 GCTGCTGGCCCTTCTCTTCCTGG - Intergenic
1191869674 X:65735398-65735420 GCTTCTGGTGCTTCTCCTCCCGG - Exonic
1193731610 X:85109320-85109342 GCTGGTGGTTATACTCCTCCAGG - Intergenic
1194440006 X:93920646-93920668 GCTCTTGGTCATCCTGGTCCAGG + Intergenic
1196117579 X:112014135-112014157 GCTGCTGGTGCTGCTGGTCCAGG + Intronic
1197315721 X:124963597-124963619 GCTCCTGGTTATACTCGTGCAGG + Exonic
1198466045 X:136905760-136905782 GCAACTGGTCAATCTCTTCCAGG + Intergenic