ID: 1163112596

View in Genome Browser
Species Human (GRCh38)
Location 19:15170507-15170529
Sequence CAGTGGCAGCAGCGGGACGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163112587_1163112596 21 Left 1163112587 19:15170463-15170485 CCCAGGACGAGAATGACCAGCAG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG 0: 1
1: 0
2: 1
3: 47
4: 260
1163112586_1163112596 29 Left 1163112586 19:15170455-15170477 CCATGACACCCAGGACGAGAATG 0: 1
1: 0
2: 1
3: 6
4: 117
Right 1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG 0: 1
1: 0
2: 1
3: 47
4: 260
1163112588_1163112596 20 Left 1163112588 19:15170464-15170486 CCAGGACGAGAATGACCAGCAGC 0: 1
1: 0
2: 0
3: 9
4: 112
Right 1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG 0: 1
1: 0
2: 1
3: 47
4: 260
1163112589_1163112596 5 Left 1163112589 19:15170479-15170501 CCAGCAGCAAGACAGCGCCCGCC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG 0: 1
1: 0
2: 1
3: 47
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163112596 Original CRISPR CAGTGGCAGCAGCGGGACGC TGG Exonic
900159537 1:1216985-1217007 CAGCGGCAGCTGCGGGACCTGGG + Exonic
900336360 1:2165936-2165958 CAGTGGCCGCAGGGGGATGCTGG - Intronic
900366886 1:2315114-2315136 CAGAGGCCGCTGCGGGAAGCAGG + Intergenic
900626536 1:3611158-3611180 CAGGGGCCGCGGCGGAACGCTGG + Exonic
903586784 1:24421957-24421979 CGGTGGCAGCAGCAGGAGTCAGG - Intronic
907671056 1:56475286-56475308 CATTGGCAGCAGGGAGACGGGGG + Intergenic
908007964 1:59746171-59746193 CAGTGACAGCAGTGAGATGCAGG + Intronic
908070573 1:60455351-60455373 CAGTGGCAGCAGCCAAAGGCAGG - Intergenic
909463247 1:75943435-75943457 CAGTGGCATCAGCTGTACACAGG - Intergenic
909622472 1:77683404-77683426 AAGTGGCAGGAGCGGGAGGCGGG - Intronic
910351437 1:86303401-86303423 CAGCTGCAGCAGCAGGAAGCTGG - Intergenic
910788072 1:91021905-91021927 CTGTGGCAGCGGCGGGACTGAGG - Intronic
910935984 1:92484914-92484936 CAGTGGAAACAGCGCGAAGCCGG - Intronic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
915530844 1:156501157-156501179 CGGTGGCAGCAGCGCCAGGCGGG - Intergenic
915598676 1:156909150-156909172 GAGGGGCAGCAGCTGGACACAGG + Intronic
916029576 1:160864044-160864066 CAGAGGCAGCAGCGGGGCTCTGG + Intergenic
916666999 1:166975602-166975624 CAGTCGCGGCAGCGGGCGGCGGG - Intronic
916890014 1:169105813-169105835 CAGGTGCAGGAGCGGGAGGCGGG + Exonic
917202599 1:172533159-172533181 CAGTGGCGGCTGCAGGAGGCGGG + Exonic
917285250 1:173416206-173416228 CAGTGGCAGCAGCTGGGCTGTGG + Intergenic
917762249 1:178174696-178174718 CAGAGGCAGAAGCAGGAAGCAGG - Intronic
917964863 1:180172081-180172103 CATTGGCAGCATGGGGACACGGG + Intronic
919478429 1:198056577-198056599 CAGTGGCAGCAGTTGTAGGCAGG + Intergenic
921360841 1:214329840-214329862 CAGAGGCAGCTGAGGGAGGCAGG + Intronic
922234421 1:223712538-223712560 CAGTGGCCGCAGCAGCGCGCCGG + Exonic
923141059 1:231162087-231162109 CAGCGGCAGCGGCGGGAGGGAGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
1067060908 10:43077477-43077499 CAGTGGCTGCGGCGGGCGGCGGG + Intronic
1067079029 10:43203308-43203330 CAGAAGCAGCAGCTGGAAGCCGG - Exonic
1067430555 10:46240791-46240813 CAGTGGCAGCAGTGGGCCAGGGG - Intergenic
1070920722 10:80183902-80183924 CAGTGGCAGGAGCTGGCCCCAGG + Intronic
1070948394 10:80411556-80411578 CAGTGGCTGCACTGGGACTCAGG - Intronic
1075041858 10:119114422-119114444 CAGTGGCAGCAGAAGCCCGCAGG + Intronic
1075646079 10:124097440-124097462 CAGTGGCAGGAGCAGGACCTGGG - Intergenic
1075840046 10:125493885-125493907 CAGTGGCAGCAGCTCCACGTTGG - Intergenic
1075939755 10:126380566-126380588 CAGTGCCAGGAGCGGTGCGCAGG - Intronic
1076086566 10:127637311-127637333 CAGTGGCAGCAGCCATAGGCAGG + Intergenic
1076209323 10:128627773-128627795 CAGGGTCAGCAGGGGCACGCTGG + Intergenic
1076537185 10:131187190-131187212 CAGTGCCAGCAGAGGCACGTCGG + Intronic
1076719307 10:132386311-132386333 CAGAGGCAGCAGCTGGAAGGCGG + Intergenic
1076761017 10:132605645-132605667 CAGACGCAGCAGCGCCACGCGGG + Intronic
1077082275 11:729372-729394 CAGTGGCAGCCCCGTGAGGCAGG + Intergenic
1077101352 11:823949-823971 CAGTGGAGGCAGCGGGGCCCAGG - Intronic
1077251922 11:1564529-1564551 CGGAGGCAGCAGCTGGAAGCTGG + Intronic
1077433249 11:2526409-2526431 CAGTCCCAGCAGCGGGACTATGG + Intronic
1077673574 11:4179200-4179222 CAGTGGCAGCAGCAGTAGGCAGG + Intergenic
1079099284 11:17530893-17530915 CAGCGGCAGCAGCTGGAAGGAGG + Intronic
1079107018 11:17578291-17578313 CAGGGGCAGCAGCTGGAGGATGG - Intronic
1080774811 11:35375706-35375728 CAGTGGCATCAGCAGGTCACTGG + Intronic
1082983252 11:59143353-59143375 CATTGGCCGCAGCAGGATGCTGG + Intronic
1083184087 11:61007594-61007616 CAGCAGCTGCAGCGGGACGGTGG + Exonic
1083324743 11:61867494-61867516 CAGAGGCAGCAGGGAGAGGCGGG - Intergenic
1083457099 11:62786677-62786699 CCCTGGCGGCAGCGGGAGGCCGG - Exonic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1084573757 11:69975660-69975682 CACTGGCAGCTGTGGGACTCTGG + Intergenic
1085074654 11:73580219-73580241 CAGTGACGGCAGCGGGACGTAGG - Intronic
1085616618 11:78004909-78004931 CTGTGGCAGCAGCCAGAAGCTGG - Intergenic
1089060043 11:115618920-115618942 CAGAGGCAGCAGCAGCACCCAGG - Intergenic
1089579329 11:119471521-119471543 CAGAGGCAGCAGGGGGCCGGGGG + Intergenic
1089770961 11:120802606-120802628 AGGTGGCAGCAGGGGGAGGCTGG + Intronic
1089816759 11:121182984-121183006 CAGTGGCAGCAGCTGCAGGCAGG + Intronic
1090264099 11:125343178-125343200 CACTGGCAAAAGCGGGACCCAGG + Intronic
1090673863 11:128970980-128971002 CAGGTGCAGCAGCGGGACCCGGG + Exonic
1091597788 12:1890569-1890591 CAGTGGCAGCAGCCAGATGCAGG - Intronic
1091699702 12:2651532-2651554 CAGTGGCAGTGGCGGAAGGCAGG - Intronic
1092275510 12:7058095-7058117 AAGTGGCAGCAGCGGCAGCCAGG - Intronic
1095800536 12:46267428-46267450 CACTGGGAGCGGCGTGACGCGGG + Exonic
1096386427 12:51197853-51197875 CGGTGGCAGCAGTGGGCTGCGGG + Exonic
1096647602 12:53047231-53047253 CAGTGGCGGGAGCGGGCGGCCGG - Intronic
1098288472 12:68933087-68933109 CTGTGGCAGCTGCCGGACGGCGG - Intronic
1099113184 12:78587480-78587502 CAGTGGCAGCAGCCCCAGGCAGG + Intergenic
1100776393 12:97979470-97979492 CAGTGGCAGCAGCTGTAGGCAGG - Intergenic
1102060297 12:109926412-109926434 CAGTGGCTGCAGCTGTACCCAGG - Intronic
1102566979 12:113803307-113803329 GAGTGGCAGCGGCGGGCGGCGGG - Intergenic
1104800838 12:131554449-131554471 CAGTGGCAGCACCGGGGCCCAGG + Intergenic
1104837502 12:131800878-131800900 CAGTGGCTGCTCCGGGTCGCAGG + Intergenic
1104857338 12:131908329-131908351 GAGGGGCAGGAGCGGGACCCGGG + Intronic
1104926381 12:132316125-132316147 CAGAGGCAGGAGCTGGCCGCGGG + Intronic
1107606583 13:42063574-42063596 CAGTGGCTGGAGAGGGATGCTGG + Intronic
1112061287 13:95742069-95742091 CAGTGGCAGCAGCTGTAGGCAGG + Intronic
1112441241 13:99426436-99426458 CAGTGGCAGGAGAGGGGTGCAGG - Intergenic
1113838358 13:113344342-113344364 CAGTTGCTGCAGCCGGACCCTGG + Intronic
1116649018 14:47565978-47566000 CAATGGCAGCATCGTGATGCAGG + Intronic
1118213739 14:63788667-63788689 CCGTGGAGGCAGCGGGACGCCGG - Intergenic
1118627629 14:67674208-67674230 CAGTGGCAGCAGGGAGACCTGGG + Intronic
1119400403 14:74358669-74358691 TGGTGGCAGCAGCGGGTGGCAGG + Exonic
1120740726 14:88106138-88106160 CAGTGGGAGCAGCTGCAGGCAGG + Intergenic
1121784791 14:96649348-96649370 CATTGGCAGCAGCTGCAGGCAGG + Intergenic
1122199000 14:100110705-100110727 CAATGGCAGCAGCAGGATGCAGG - Intronic
1122278890 14:100609882-100609904 CTGGGGCAGCAGCAGGCCGCAGG + Intergenic
1122786150 14:104164149-104164171 CAGTGGGGGCAGCGAGAGGCCGG + Intronic
1122919676 14:104874829-104874851 CAGTGGCACTAGCGTGAGGCTGG + Intronic
1123992891 15:25696489-25696511 CAGTGGGAGCAACGGGATGAAGG - Intronic
1128389820 15:67175303-67175325 CAGTGGCAGGAGTGAGAGGCAGG + Intronic
1129524219 15:76203913-76203935 GAGTGACAGCAGCCAGACGCTGG + Exonic
1130053601 15:80504101-80504123 CATTTGGAGCAGTGGGACGCAGG + Intronic
1131032606 15:89198959-89198981 CTGTGGCAGCTGCTGGCCGCTGG + Exonic
1131510098 15:93045016-93045038 CAGGGCCAGGAGCGGGACGAGGG + Exonic
1132146280 15:99431828-99431850 CTGAGGCAGCAGCGGAAGGCAGG + Intergenic
1132178417 15:99733397-99733419 CGGTGGCAGCTGCGGGTCGCGGG - Exonic
1132328966 15:100997661-100997683 CAGTGCCAGCAGCAAGACCCTGG - Intronic
1132585303 16:703586-703608 CCGTGGCAGCCCCGTGACGCAGG + Intronic
1133275582 16:4636420-4636442 CACGGGCAGCACTGGGACGCTGG - Intronic
1135597407 16:23754946-23754968 CAGTGGCCCCAGGGGGACGAAGG - Exonic
1136153727 16:28368380-28368402 CGGTGGGAGCAGCGGGAAGCCGG - Intergenic
1136209365 16:28746890-28746912 CGGTGGGAGCAGCGGGAAGCCGG + Intergenic
1136519441 16:30786666-30786688 CTGTATCAGCAGCGGGACGGGGG - Intronic
1138275956 16:55734907-55734929 CAGTGGTAGCAGCCGGACCTGGG - Intergenic
1138441718 16:57039369-57039391 AAGTGGCTGCAGCTGGAGGCAGG + Intronic
1138675027 16:58645020-58645042 CAGTGACAGCAGGGGGCCACTGG + Intergenic
1140377050 16:74452953-74452975 CAGCAGCAGCAGCTGGTCGCTGG - Intronic
1141863046 16:86731013-86731035 CACTGGCTGCAGCGGGAGGATGG + Intergenic
1142135363 16:88449511-88449533 CAGGGGCAGAAGCTGGAGGCCGG - Intergenic
1142788312 17:2243038-2243060 CAGTGGCAGTGGCAGGACGGGGG + Intronic
1143296449 17:5875170-5875192 CAGGGGCACCAGCTGGAGGCAGG + Intronic
1143371626 17:6444201-6444223 CAGTGGCGCGAGCGGGACGCAGG + Intergenic
1143548594 17:7614831-7614853 CAGCGGCAGCAGCGGGTCCCGGG - Exonic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1144669973 17:17127339-17127361 CAGTGGCAGCAGAGTGGCTCGGG - Intronic
1146200539 17:30853746-30853768 CAGTGGCAGGAGTGGGACAGAGG - Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147258469 17:39195751-39195773 CAGTGGCAGCTGGGGGCCACAGG - Intronic
1147632343 17:41940210-41940232 CAGGGGAAGCAGCAGGACTCAGG - Intronic
1150010021 17:61494785-61494807 CAGCGGCAGGAGAGTGACGCTGG + Intergenic
1150533728 17:66013806-66013828 CAGTGGCAGCAGTGGCACCATGG + Intronic
1151961959 17:77410232-77410254 CAGTAGCAGCAGTGGGATGGGGG - Intronic
1152527954 17:80900273-80900295 CAGTGGAAGCAGGGAGACCCGGG - Intronic
1152570052 17:81117743-81117765 CCGTGGCCACAGCGGGACCCAGG + Exonic
1153137199 18:1930098-1930120 CAGTGGCAGCAGCCCTAAGCAGG - Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153805295 18:8705274-8705296 CACGGGCAGCAGCGGGCCGGCGG + Intergenic
1155088145 18:22477421-22477443 CAGTGGCAGCAGCCACAGGCAGG - Intergenic
1155565883 18:27133551-27133573 CAGGGGCAGCTGTGGGACACTGG + Intronic
1156099618 18:33578343-33578365 CGGCGGCAGCAGCGGGGCCCGGG - Intergenic
1156450306 18:37262883-37262905 CAGCTGCAGCAGCGTGAGGCAGG + Intronic
1160775219 19:852410-852432 CAGAGGGAGCAGCGGGAGGTTGG - Intronic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1161065653 19:2236107-2236129 CAGTGCCAGGGGCGGGAGGCCGG - Intronic
1161983300 19:7641628-7641650 AGGTGGCGGCAGCGGGAAGCGGG + Intronic
1162003020 19:7760093-7760115 CAGTGGTGGCAGCGGCAGGCTGG + Intergenic
1162289536 19:9768560-9768582 CCGGAGCAGCAGCGGGAGGCCGG + Exonic
1162444429 19:10713474-10713496 CTGTGGCAGCAGCGGATAGCTGG + Intergenic
1162564004 19:11435212-11435234 CAGTGTCAGCCACGGAACGCGGG - Intronic
1162903476 19:13809160-13809182 CTGTGGCGGCAGCAGGGCGCGGG + Exonic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1163577332 19:18118358-18118380 CTGTGGCAGCAGTGGGAAGGGGG + Intronic
1163933968 19:20424712-20424734 AAGTGGCAGTGGCGGGACTCAGG - Intergenic
1164072134 19:21778009-21778031 CAGTGGCAGCAGCAGGCTCCAGG + Intergenic
1165120760 19:33556963-33556985 CAGTGGCAGCAGAGGGAAGGAGG - Intergenic
1165349978 19:35269949-35269971 CAGAGGCAGCGGCGGGGCCCGGG - Exonic
1165453577 19:35898729-35898751 CAGCAGCAGCAGCCCGACGCTGG - Exonic
1165551001 19:36585740-36585762 CAGTGGCAACATTGGGAGGCTGG + Intronic
1166117142 19:40663074-40663096 CAGTGGAAGCAGCGGGCCCCAGG + Intergenic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166736400 19:45087848-45087870 CTGTGGCTGCAGCAGGATGCTGG + Intronic
1166748377 19:45152737-45152759 CCGTGGCTGCCGGGGGACGCCGG - Exonic
1166851721 19:45764562-45764584 GTGGGGCAGCAGGGGGACGCAGG - Intergenic
1167468395 19:49662334-49662356 CAGCGGCAGCAGCGGCATGAAGG + Intronic
1168407928 19:56120591-56120613 CCGGGGCAGCAACGGGACCCGGG + Intronic
925125250 2:1450061-1450083 GCGGGGCAGCAGCGGGACACGGG - Intronic
925532914 2:4884138-4884160 CAGTGGCAGCGGCGGGCTGAAGG - Intergenic
929266063 2:39920357-39920379 CAGTGGCAGCAGCTGTAGGCAGG + Intergenic
929346505 2:40890526-40890548 CAGTGGCAGCAGCTATAAGCAGG - Intergenic
929604595 2:43226330-43226352 CAGTGGCCGGAGCGGCAGGCCGG + Exonic
929788977 2:45010219-45010241 CAGTGGCCGCAGGCGGACGCCGG + Intergenic
932573036 2:72947861-72947883 CAGTGGCAGCGTGGGGACGAGGG - Intronic
934996564 2:98967135-98967157 CAGTGGCAGCAGCAGCACACTGG + Intergenic
935492344 2:103735772-103735794 CAGTGGAAGCTGCTGGAGGCAGG + Intergenic
936517803 2:113193178-113193200 CAGTGGCACCAGCCTGAGGCTGG + Intronic
936794071 2:116186335-116186357 CAGTGGCAGCCGCTGCATGCAGG + Intergenic
938693669 2:133815651-133815673 CAGTGGCAGCAGCCATATGCAGG - Intergenic
938822735 2:134975661-134975683 CAGTGGCAGCAGCTTCAGGCAGG + Intronic
939900636 2:147845326-147845348 CGGTGGCAGCCGAGGGGCGCAGG - Intronic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
940382643 2:153033303-153033325 TGGTGGCAGCAGCGGAAGGCTGG - Intergenic
941580934 2:167294153-167294175 CAGTGGCCCCACCTGGACGCCGG - Intergenic
942446343 2:176081059-176081081 GAGCAGCAGCAGCCGGACGCGGG - Intronic
942550972 2:177118862-177118884 CAGTGGCAGCAGCGTCACGTGGG - Intergenic
946023822 2:216659927-216659949 CAGTGACAGCAGGGGGATGCTGG + Intronic
948732724 2:239977321-239977343 CAGGGACAGTGGCGGGACGCTGG - Intronic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1170064780 20:12299327-12299349 CAGTGGCAGCAGCTGGGGGCTGG + Intergenic
1170138480 20:13101817-13101839 CAGTAGCAGCAGCGGCACCCAGG - Intronic
1170705830 20:18744201-18744223 CAGTGCCAGCAGCGGGGCTGAGG + Exonic
1171185872 20:23123675-23123697 CTGTGGCAGCTGTGGGACACTGG - Intergenic
1171424692 20:25042250-25042272 CAGTGGCAGCAGCCGCAGCCTGG + Intronic
1172223574 20:33289771-33289793 CCTAGGCAGCAGCGGGACCCTGG - Intronic
1173869493 20:46332568-46332590 CAGAGGCAGCAGCGGGACTCAGG + Intergenic
1174358527 20:50014142-50014164 CAGTGGCAGTAGCTGGACGGTGG - Intergenic
1175598691 20:60255582-60255604 CAGTGGCAGCAGCTGGAATTAGG + Intergenic
1175949074 20:62572933-62572955 CATTGGCAGCAGGGGGTCCCCGG + Intergenic
1176042375 20:63072334-63072356 CGGGGGCAGCAGCGGGGCGCGGG + Intergenic
1180559059 22:16601410-16601432 GAGTGGCAGCGGCGGCGCGCGGG + Intergenic
1182155904 22:28072769-28072791 CAGAGGTAGCAGGGGGAAGCCGG + Intronic
1183149898 22:36028919-36028941 CTGTGGCAGCACCGGGAAGGCGG + Intergenic
1183352613 22:37342567-37342589 CAGGGGCAGCAGTGGGACCCAGG - Intergenic
1183478939 22:38052419-38052441 CAGTGGCAGGTGCGGAAAGCTGG + Intergenic
1183584656 22:38745936-38745958 CAGAGGCATCAGAGGGATGCAGG + Intronic
1183740374 22:39665495-39665517 CAGTGTCATCAGCCGGGCGCCGG + Exonic
1184650941 22:45919228-45919250 CGGCGGCAGCAGCGGCACGCCGG - Intergenic
1185182941 22:49373437-49373459 CTGTGGCAGCAGCATGAGGCTGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
950029091 3:9840188-9840210 CAGTGGCTGCAGCTGGACCAGGG + Exonic
950178525 3:10894164-10894186 CAGTGGGAGCAGCAGGACCCAGG - Intronic
950404525 3:12796563-12796585 CCGTGGCGGCCGCGGGAGGCGGG - Intronic
955331134 3:58048383-58048405 CACTGGCATCACCGGGATGCTGG - Intronic
955416962 3:58701398-58701420 CAGTGGCCGCAGTGGCACACTGG - Intergenic
955672363 3:61415272-61415294 CACTGGCAGCAGAGGGAGGGAGG + Intergenic
957735513 3:84197060-84197082 CAGTGGCTGCAGCTGTAAGCAGG + Intergenic
959530622 3:107431138-107431160 CAGTGGCAGCAGCAGAACCGGGG + Intergenic
960844534 3:121993933-121993955 CATTGGCATCTGCGGGAGGCTGG + Exonic
961569217 3:127786107-127786129 CAGGGGCAGCAGTGGGGCACTGG + Intronic
968010396 3:195270684-195270706 CAGTGAGCGCAGCGCGACGCGGG + Exonic
968603787 4:1522043-1522065 CAGGGGCAGCAGACGGACACAGG + Intergenic
968669731 4:1842654-1842676 CACAGGCAGCAGTGGGAGGCTGG + Intronic
968907912 4:3463153-3463175 CAGTGGCCGCCGCGGGACGGTGG + Intergenic
969672719 4:8598564-8598586 CAGTGGGAGCAGCAGGAACCCGG - Intronic
972774180 4:42226334-42226356 CAGAGGCAGCAGCCGGAGTCAGG - Intergenic
976015093 4:80542891-80542913 CAGGGGCAGCAGGGGCATGCAGG - Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
984565111 4:181319836-181319858 CAGTGGCAGCAGCAGTACCCGGG - Intergenic
991275667 5:64843903-64843925 GAGGGGCAGCAGTGGGAGGCAGG - Intronic
991734413 5:69618658-69618680 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991780565 5:70128067-70128089 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
991810847 5:70473793-70473815 TAGGGGCAGCAGAGGGAAGCTGG - Intergenic
991859853 5:71003490-71003512 TAGGGGCAGCAGAGGGAAGCTGG + Intronic
991873013 5:71128386-71128408 TAGGGGCAGCAGAGGGAAGCTGG + Intergenic
992124378 5:73626055-73626077 CAGTGGCAGCGGGGAGGCGCGGG + Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994353834 5:98773857-98773879 CGGCGGCAGCAGCGGGGCGCAGG - Intronic
995221594 5:109654623-109654645 CAGTGTCAGCAGCAGGCCCCGGG - Intergenic
996090482 5:119346243-119346265 CAGTGGAAGCTGCTGGAGGCTGG + Intronic
996342151 5:122451021-122451043 CCTTGGCATCAGGGGGACGCAGG + Exonic
997402425 5:133612738-133612760 CAGAGGCAGGAGCGCTACGCTGG - Intergenic
999093671 5:148958980-148959002 GAGTGGCAGCAGCGGGGTGGGGG - Intronic
999727024 5:154446035-154446057 CAGGGGCTGCCGCGGGACTCGGG + Exonic
1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG + Intergenic
1001424509 5:171614672-171614694 CAGAGGCAGCAGTGGGAGGCTGG + Intergenic
1002000689 5:176194878-176194900 CAGGGGCAGGAGCGGGGAGCGGG + Intergenic
1002212341 5:177606478-177606500 CAGTGGCAACAGCGAGAAGCGGG - Intronic
1002253653 5:177944109-177944131 CAGGGGCAGGAGCGGGGAGCGGG - Intergenic
1002498809 5:179634110-179634132 CAGTGGCACCTGCGCGAAGCTGG - Intronic
1002502867 5:179658414-179658436 CAGTGGCACCTGCGCGAAGCTGG + Intergenic
1004522970 6:16379747-16379769 CAGAGGCATCAGCAAGACGCTGG + Intronic
1007366592 6:41398408-41398430 CAGTGGCTGCAGGGGGACATTGG - Intergenic
1009684355 6:66936947-66936969 CAGTGCCAGCAGAGGGTGGCAGG - Intergenic
1012594295 6:101022706-101022728 CAGTGGCAGCAGCCCCAGGCAGG - Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1012976981 6:105791419-105791441 CACAGGCAGCAGAGGGAGGCTGG + Intergenic
1014632527 6:123803891-123803913 CAGGGGCAGCAGCGGCAGCCTGG - Intergenic
1015201443 6:130585987-130586009 CAGAGGCAGCAGCATGAAGCAGG + Intergenic
1017115039 6:150968136-150968158 CAATGACAGCAGAGGGACGGGGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018349660 6:162943471-162943493 CAGTGGCAGCAGCCATACGCAGG - Intronic
1018794274 6:167173897-167173919 CAGCGGCAGCAGTGGGAAGCCGG + Exonic
1018822045 6:167381170-167381192 CAGCGGCAGCAGTGGGAAGCCGG - Exonic
1018923451 6:168191183-168191205 CAGTGGCACCTGCGTGACTCCGG + Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019017602 6:168891179-168891201 CACTTGCAGCTGCAGGACGCTGG - Intergenic
1019448291 7:1082708-1082730 CAGTGGCAGGAGCTGGACACAGG - Intronic
1020007846 7:4791864-4791886 CTGTAGCAGCAGTGGCACGCCGG - Intronic
1022610538 7:31867302-31867324 CAGTGGCAGCAGCTGTATACGGG - Intronic
1023232802 7:38051657-38051679 CAGTGGCAGCAGCTATATGCAGG + Intergenic
1026208533 7:68280505-68280527 CAGTGGCAGCAGCCATAGGCAGG - Intergenic
1026536654 7:71244123-71244145 CAGTAGCAGCAGGCGGATGCTGG - Intronic
1032864738 7:135914313-135914335 CAGGGGCTGCAGCAGGACTCTGG - Intergenic
1033643829 7:143286299-143286321 CATTGGCATCAGCGGGAGGAGGG + Intronic
1033852731 7:145516833-145516855 CAGTGGCTTCAGTGGGACACAGG + Intergenic
1034393275 7:150801691-150801713 CAGGGGCAGCAGCCGGCTGCTGG + Exonic
1034618259 7:152436597-152436619 GAGTGGCAGCGGCGGCGCGCGGG - Intergenic
1034875638 7:154722615-154722637 CAGGGGCGGCAGCAGGAGGCAGG + Intronic
1035375905 7:158406619-158406641 GAGTGGCTGCAGCAGGACTCAGG - Intronic
1035465181 7:159070294-159070316 CAGTGGCAGCACCGGGCCCTGGG - Intronic
1035829029 8:2674802-2674824 CAGTGACAGCAGAGAGACCCAGG - Intergenic
1036616083 8:10388855-10388877 CAGTGGCAGGGGTGGGTCGCAGG - Intronic
1037654343 8:20870279-20870301 CAGTGCCAGCATGAGGACGCAGG + Intergenic
1037928801 8:22865377-22865399 CGGTGGCGGCGGCGGGACCCCGG + Intronic
1038346609 8:26737836-26737858 CAGCTGCAGCAGCAGGACACGGG + Intergenic
1038452951 8:27651513-27651535 CAGCGGCTGCAGCGGGGCCCTGG - Exonic
1038463167 8:27733858-27733880 CAGATGCAGCAGCGGGAGGAAGG + Exonic
1045519026 8:102887098-102887120 CTGTGGCAGCAGCTGGAGGAAGG - Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1049287236 8:141782425-141782447 CAGTGGCTGCGGCAGGACGCAGG + Intergenic
1049508989 8:143018458-143018480 CGGGGGCAGGGGCGGGACGCGGG - Intronic
1049572618 8:143376351-143376373 CAGGGGCAGCAGTGGGATCCGGG - Intronic
1049818866 8:144622131-144622153 TCGTGCCAGCAGCGGGACACAGG + Intergenic
1050424933 9:5502747-5502769 CAGTGGCAGCAGCGGTGCAGTGG - Intergenic
1051365962 9:16321660-16321682 CAGTGGATGCAGCTGGAGGCTGG - Intergenic
1052996064 9:34552180-34552202 CAGTGGCGGCAGCGGCAGCCAGG + Exonic
1057154541 9:92829614-92829636 CAGTGGCAGCAACTGTAAGCAGG - Intergenic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057747130 9:97761341-97761363 GATTGGCAGCAGAGGGAGGCAGG + Intergenic
1060531585 9:124350099-124350121 CAGCAGCAGCAGCAGGAAGCTGG - Intronic
1061900682 9:133670620-133670642 CTGGAGCAGCAGCGGGCCGCAGG - Exonic
1062121995 9:134838864-134838886 CAGTGGCAGCAGCGTGGAGCTGG + Intronic
1062294838 9:135818928-135818950 CAGTGCCAGCAACGGGACCGGGG + Intronic
1202800944 9_KI270719v1_random:174916-174938 CAGTGGCTGCAGAGGGCCCCTGG + Intergenic
1186833283 X:13412398-13412420 CTGGGGCAGCAGCGGGTCGGGGG + Intergenic
1187856065 X:23637116-23637138 CAGTGGCAGCAGCTGTAGGCAGG - Intergenic
1188451035 X:30308524-30308546 CAGGGGCAGCACCTGGAAGCAGG + Exonic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1192952278 X:76029597-76029619 CAGCGGCAGCAGCGGGGCCTGGG + Intergenic
1196145005 X:112306837-112306859 CAGTGGCCACAGCAGGAAGCTGG + Intergenic
1196310724 X:114162213-114162235 CAGTGGCAGCAGCCACAGGCAGG + Intergenic
1200115670 X:153768735-153768757 CCGGGGCAGCAGCGGCACCCTGG - Intronic
1200167258 X:154045350-154045372 CTGTGGCAGCAGCTGGAGTCAGG - Intronic
1200232280 X:154449985-154450007 CTGGGGCAGCAGCGGGACATTGG + Intronic
1201057581 Y:10011247-10011269 CAGTGGCAGCAACTGCAGGCAGG + Intergenic