ID: 1163113625

View in Genome Browser
Species Human (GRCh38)
Location 19:15176608-15176630
Sequence CAAAAGTTACCCGGGCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114978
Summary {0: 1, 1: 10, 2: 626, 3: 16635, 4: 97706}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163113620_1163113625 -3 Left 1163113620 19:15176588-15176610 CCCATCTCTAAGAAAAAGCACAA 0: 1
1: 1
2: 27
3: 728
4: 9916
Right 1163113625 19:15176608-15176630 CAAAAGTTACCCGGGCGCGGTGG 0: 1
1: 10
2: 626
3: 16635
4: 97706
1163113621_1163113625 -4 Left 1163113621 19:15176589-15176611 CCATCTCTAAGAAAAAGCACAAA 0: 1
1: 0
2: 44
3: 1363
4: 19563
Right 1163113625 19:15176608-15176630 CAAAAGTTACCCGGGCGCGGTGG 0: 1
1: 10
2: 626
3: 16635
4: 97706
1163113619_1163113625 -2 Left 1163113619 19:15176587-15176609 CCCCATCTCTAAGAAAAAGCACA 0: 1
1: 0
2: 23
3: 719
4: 9151
Right 1163113625 19:15176608-15176630 CAAAAGTTACCCGGGCGCGGTGG 0: 1
1: 10
2: 626
3: 16635
4: 97706
1163113618_1163113625 17 Left 1163113618 19:15176568-15176590 CCTGGACAACATGGCGAAACCCC 0: 250
1: 11556
2: 109303
3: 209870
4: 218600
Right 1163113625 19:15176608-15176630 CAAAAGTTACCCGGGCGCGGTGG 0: 1
1: 10
2: 626
3: 16635
4: 97706

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163113625 Original CRISPR CAAAAGTTACCCGGGCGCGG TGG Intronic
Too many off-targets to display for this crispr