ID: 1163114623

View in Genome Browser
Species Human (GRCh38)
Location 19:15181435-15181457
Sequence CTCTGATGACTGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 239}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163114623_1163114631 1 Left 1163114623 19:15181435-15181457 CCCTGCCCCATCAGTCATCAGAG 0: 1
1: 0
2: 4
3: 40
4: 239
Right 1163114631 19:15181459-15181481 CCGCAGTGGGTACCAAGCTGAGG 0: 1
1: 0
2: 0
3: 5
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163114623 Original CRISPR CTCTGATGACTGATGGGGCA GGG (reversed) Intronic
900243778 1:1628667-1628689 CCCTGGTGGCTGATGGGGCCGGG + Exonic
900432692 1:2610547-2610569 CACTGATGAGTGAGGGGGCAGGG - Intronic
901184747 1:7365797-7365819 CTCTGCTGACTGATGGAGTCAGG + Intronic
901206618 1:7501205-7501227 CTCTGCTGACTGGAAGGGCAGGG - Intronic
901209945 1:7519028-7519050 GTCTGGTGATGGATGGGGCAGGG - Intronic
902798838 1:18817062-18817084 CTCTGATGTGTGATGGTGCTTGG - Intergenic
903269600 1:22179009-22179031 CTCTGCTGGCTGATCGGGGAGGG - Intergenic
903338137 1:22638307-22638329 CTCTGAAGCCTGAAGGGGCTGGG - Intronic
903605633 1:24573164-24573186 CCCTGAAGGCTGATGGGGCCTGG - Intronic
904321925 1:29703370-29703392 CTCTGCTGACTGCCGGGGCCTGG + Intergenic
904753615 1:32755810-32755832 CTTTCAGGACTGCTGGGGCAGGG - Intronic
905462368 1:38130074-38130096 CTCTTAGGCCTGAAGGGGCAAGG + Intergenic
905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG + Intergenic
906678816 1:47711251-47711273 CTCTTAGGACTGTTGGGGGAGGG + Intergenic
907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG + Intronic
907881478 1:58552934-58552956 CTCTGAAGAATTATGAGGCATGG + Intergenic
909324751 1:74336506-74336528 CTCTGGGGACTGTTGTGGCATGG - Intronic
912908209 1:113729781-113729803 CTCTGAGGACTGAAGGGTGATGG + Intronic
913110754 1:115655157-115655179 CTCTGCTGGCTGCTGGGGCCCGG - Intronic
913346882 1:117818404-117818426 CTCTCGTTCCTGATGGGGCATGG - Intergenic
915857796 1:159408450-159408472 CTCTGGGGACTGTTGGGGGATGG + Intergenic
917442684 1:175080935-175080957 CTCTCCTGCCTGAAGGGGCAAGG + Intronic
919744183 1:200998675-200998697 CTCTGGTCACTGATTGGTCATGG - Intronic
1064333827 10:14419784-14419806 CTCTGGGGACTGTTGTGGCATGG + Intronic
1066663387 10:37758483-37758505 CTCTGTCCACTGAGGGGGCATGG - Intergenic
1066930771 10:41755180-41755202 CTCTGGGGACTGTTGTGGCATGG + Intergenic
1067427377 10:46220301-46220323 CTCTGATGAGTGAGGAGCCAGGG - Intergenic
1068136089 10:52952363-52952385 ATCTGATGATTGATGGGGCCGGG - Intergenic
1068583778 10:58773516-58773538 ACCTGAGGGCTGATGGGGCAAGG + Intronic
1069370358 10:67741144-67741166 CTCTGGGGACTGTTGTGGCATGG + Intergenic
1070450470 10:76552681-76552703 GTCACATGACTGTTGGGGCAGGG + Intronic
1070787009 10:79167837-79167859 CTCTGCTGGCTGATGTGGGAGGG - Intronic
1070955835 10:80462874-80462896 CACTGATGACTGAGTGGGGAGGG + Intronic
1072518262 10:96208087-96208109 GTCTGCTGACAGATGGGGAAGGG + Intronic
1073514360 10:104063810-104063832 CTCCGAAGACTGCAGGGGCAAGG + Exonic
1073528038 10:104204544-104204566 CTCTGGTGAGTGATGGAGAATGG - Intronic
1075295966 10:121275540-121275562 AACTGGTGGCTGATGGGGCAAGG - Intergenic
1075595941 10:123729106-123729128 CTCTGATGACTGCAGTGGGAGGG - Intronic
1075709979 10:124525730-124525752 TTCTGTTGGCTGCTGGGGCAGGG + Intronic
1076671014 10:132121146-132121168 CTCTGCTGACACTTGGGGCAGGG - Intronic
1078487616 11:11738585-11738607 CTCTGATGACTACTGGCACAAGG - Intergenic
1080423914 11:32138818-32138840 CTCTGATGCCTGAAGAGGCAGGG + Intergenic
1080616303 11:33947569-33947591 CTCTGGTGACTGAAGGGGCCTGG - Intergenic
1081764267 11:45598628-45598650 CTGTGATGACTCATGGGGACAGG + Intergenic
1084270206 11:68025322-68025344 CTCTGATCACAGCTGGGTCAGGG - Intronic
1084598896 11:70133295-70133317 CTCTGCTTACTGATGGGGCACGG - Intronic
1084973711 11:72785082-72785104 CCCTGATGGCTGTTGGGGGAGGG + Intronic
1087307246 11:96501629-96501651 AACTGAAGACTGATGGGGCCTGG + Intronic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1090397916 11:126431548-126431570 AGCTGATGACGGATGGGGAATGG + Intronic
1093214125 12:16343259-16343281 CTCACATGACGGAGGGGGCAGGG - Intergenic
1094161149 12:27392427-27392449 CTAAGATGACTGATGTGGGAAGG - Intronic
1094511661 12:31100932-31100954 CTGTGCTGGATGATGGGGCAGGG + Intronic
1095092063 12:38116968-38116990 CCATGAAAACTGATGGGGCACGG - Intergenic
1098331317 12:69356690-69356712 CTCTGTTCACTGATAGGGCCTGG - Intergenic
1101695126 12:107118567-107118589 CTGTGATCACTGATGGTGCTGGG - Intergenic
1101973378 12:109333381-109333403 CTCTGAGGACTCATGGTGCATGG + Intergenic
1103933869 12:124465106-124465128 CTCTGAGCACTGATTGGCCAAGG + Intronic
1104239916 12:126978468-126978490 CTCTGAGGACTCAGGGGGAAGGG - Intergenic
1104283946 12:127405833-127405855 CTCCGATGGCTGAAGAGGCAGGG - Intergenic
1104509871 12:129367491-129367513 CTCTGAAGACTGGCGGGGCAGGG - Intronic
1104706541 12:130951691-130951713 CCCCGATGGCTGATGGGGGAGGG - Intergenic
1104792261 12:131491005-131491027 CACTGATGACTGATGGGAATTGG + Intergenic
1104812898 12:131629047-131629069 CTCTGACCACAAATGGGGCACGG - Intergenic
1105659150 13:22473900-22473922 CTGTGTTGACTGATGGGGGGTGG - Intergenic
1111331243 13:86763429-86763451 CAGTGATGACTGATGGGGCCGGG + Intergenic
1112461033 13:99604040-99604062 CTCTGAGAACTGCTGGGGAAAGG + Intergenic
1114083386 14:19220073-19220095 CTCTGATGCATGATGGGTCAGGG - Intergenic
1114640059 14:24213532-24213554 CCCTGAGGACGGATTGGGCAAGG - Exonic
1115806806 14:37061068-37061090 CTCTGATCCCTGCTGGAGCAAGG + Intronic
1116095899 14:40367089-40367111 GTTTGATGTCTGATGGGGCCTGG + Intergenic
1116959552 14:50955911-50955933 CTGTGATGACCAGTGGGGCAGGG + Intergenic
1117732257 14:58735110-58735132 CTCTGGTGTCTGATGGTGAAAGG - Intergenic
1118757462 14:68855368-68855390 TTGTGATCACTGATGGGGCTCGG - Intergenic
1120713673 14:87818161-87818183 CTCACATGATGGATGGGGCAAGG - Intergenic
1122158155 14:99763548-99763570 CTCTGAGGGCTGGTGGGGCCTGG - Intronic
1122799665 14:104223290-104223312 TGCTGATGGCTGAGGGGGCAGGG + Intergenic
1123153345 14:106203104-106203126 GCCTGATGATTGATGGGGCCAGG - Intergenic
1202895000 14_GL000194v1_random:1842-1864 CTCTGATGCATGATGGGTCAGGG - Intergenic
1123478626 15:20611416-20611438 CTCTGGAGACTGATGGAGGATGG - Intergenic
1123639387 15:22388969-22388991 CTCTGGAGACTGATGGAGGATGG + Intergenic
1124492106 15:30164386-30164408 TCCTGGGGACTGATGGGGCACGG - Intergenic
1124751431 15:32373931-32373953 TCCTGGGGACTGATGGGGCACGG + Intergenic
1125790061 15:42358362-42358384 CTCAGATGCCTAATGTGGCATGG + Intergenic
1125816161 15:42586582-42586604 CCCTGATAGCTGCTGGGGCAAGG - Intronic
1127683157 15:61316858-61316880 ATCTGATGGCTCATAGGGCAGGG + Intergenic
1128528098 15:68426059-68426081 ATCTGACCAGTGATGGGGCAGGG + Intronic
1129047921 15:72753225-72753247 CTCTTACCACTGATGGGGCATGG + Intronic
1129324045 15:74790264-74790286 CTCTGCTGCCTAATGGGGCGTGG - Intronic
1130039481 15:80393940-80393962 CTCTGAAGGTTGCTGGGGCAGGG + Intronic
1132626368 16:893579-893601 CTGTGAGGACTCCTGGGGCACGG + Intronic
1132747363 16:1442633-1442655 CTCTGTTTTCTGGTGGGGCAGGG - Intronic
1132915827 16:2342748-2342770 CTGTGAAGACTGATGGGGAAAGG - Intergenic
1133663987 16:7947221-7947243 CTTTGATGACTCAAGGGGAAAGG + Intergenic
1134661711 16:15989250-15989272 CTCTGCTGAGTTAGGGGGCAGGG + Intronic
1137005758 16:35273314-35273336 GTCTGATGACTGATGGGACCAGG - Intergenic
1139851478 16:69953290-69953312 CTCTGATGAAGGCTGGGGCCAGG - Intronic
1139880454 16:70176202-70176224 CTCTGATGAAGGCTGGGGCCAGG - Intronic
1140372056 16:74419315-74419337 CTCTGATGAAGGCTGGGGCCAGG + Intronic
1141042939 16:80687782-80687804 CTCAGATGACTCATAGAGCAAGG + Intronic
1141514483 16:84534766-84534788 TGCTGAGGGCTGATGGGGCATGG - Intronic
1141664879 16:85460899-85460921 GTCTGATGACAGATGGGAAAGGG + Intergenic
1142066370 16:88065296-88065318 CTTTGAAGACGGATGGGGCCAGG - Exonic
1142319062 16:89369406-89369428 CTCTGATGCCTGCTGCAGCAAGG + Intronic
1143886237 17:10067125-10067147 CTCTGATGAAATATGGGGGAGGG + Intronic
1148765639 17:50036915-50036937 CTCAGGTGCCTTATGGGGCAAGG + Intergenic
1149505021 17:57187064-57187086 CTCTGTTGAGAGAAGGGGCAAGG - Intergenic
1151221056 17:72613435-72613457 CTCTGAAGTCAGACGGGGCAAGG + Intergenic
1151456439 17:74228967-74228989 TTCAGCTGTCTGATGGGGCACGG + Intronic
1152135275 17:78499900-78499922 CTCTAATGACTGATGGGACCGGG + Intronic
1153771908 18:8423370-8423392 CGCTGATGACTCATGGGACAGGG + Intergenic
1154500070 18:14991736-14991758 CTCTGATGCATGATGGGTCAGGG - Intergenic
1155898655 18:31360973-31360995 CTTTGAAGTCTGATGGGACATGG - Intergenic
1158358654 18:56648138-56648160 CTCTGATGAATGACTGAGCAGGG - Intronic
1158872982 18:61706852-61706874 CTCTGAAGACTGAAGGTGGAAGG - Intergenic
1160054272 18:75464646-75464668 CTGGGATGGCTGATGGGGCATGG - Intergenic
1161221558 19:3120375-3120397 CTCTGGGGACTGGTGGGACAGGG - Intronic
1161576697 19:5058401-5058423 CTCTGAGGACTGAGGGAGGAGGG + Intronic
1162044300 19:7988460-7988482 CGCTAAAGACAGATGGGGCATGG + Intronic
1163114610 19:15181369-15181391 CTCTGGTGCCTGAGAGGGCATGG - Intronic
1163114623 19:15181435-15181457 CTCTGATGACTGATGGGGCAGGG - Intronic
1163928338 19:20365864-20365886 GCCTGATGACTGAAGGGGCCAGG + Intergenic
1165253218 19:34557110-34557132 GTCTGATGACTGATGGGACTGGG - Intergenic
1166873621 19:45884707-45884729 CTCTGGGTACTGCTGGGGCAGGG + Exonic
1167255552 19:48425930-48425952 CTATGGTGACTGGAGGGGCAGGG - Intronic
1168486080 19:56763182-56763204 CTCTGGTGACTACTGGGGCATGG + Intergenic
925772919 2:7300942-7300964 CTCTGGTGACTGATGGGATGGGG - Intergenic
926397071 2:12454336-12454358 CTCTGATGATTGTGGGGGCTTGG - Intergenic
926508660 2:13745863-13745885 CTGTGCTGCCTGATGGGGAAGGG + Intergenic
926984711 2:18610399-18610421 CTCAGATAACTAATGGGGCCTGG - Intergenic
928322665 2:30295857-30295879 CTGTGAAGAGTGATGGGGCTGGG - Intronic
929234244 2:39589717-39589739 CTCTGGTGACTGTTGGGGGGTGG - Intergenic
929336818 2:40758250-40758272 CACTGATGCCTGTTGGGGGATGG + Intergenic
929572200 2:43029712-43029734 CTCTGATGGCTGGCGGGGCATGG + Intergenic
932126365 2:69148853-69148875 TTCTGCTGGCTGATGGGGCTTGG - Intronic
932186155 2:69698146-69698168 CTCACATGACTGAAGGAGCAAGG + Intronic
932403928 2:71500937-71500959 CTCTGATCTCTGATGTCGCATGG + Intronic
933301280 2:80544194-80544216 CTCTGAAGATGGATGGGGCCAGG - Intronic
934925677 2:98380381-98380403 CTCTGGTGCCTGCTGGGGCCAGG + Intronic
937350715 2:121159143-121159165 CTCTGAGGAATGATGAGGCAAGG - Intergenic
938493196 2:131776558-131776580 CTCTGATGCCTGATGGGTCAGGG + Intergenic
938499286 2:131822095-131822117 CTCTGATGCCTGATGGGTCAGGG - Intergenic
941988290 2:171529665-171529687 CTATGATGACTGCTGCTGCAAGG - Intronic
944165944 2:196721261-196721283 CTCTGGTGACCAATGGAGCATGG + Intronic
948616911 2:239204963-239204985 CTTTGATGACAGGTGGGGTAGGG - Intronic
948678321 2:239612059-239612081 CTCTGGTGACTGCTGAGGGAGGG + Intergenic
948792514 2:240386292-240386314 CTCTGAGGGCTGTTGGGGGATGG + Intergenic
948916942 2:241039245-241039267 CTTTGGTGGCTGATGGGACATGG - Intronic
948956574 2:241297551-241297573 CTCTGTTGACTGAGAGGGCCTGG + Intronic
1169006659 20:2213043-2213065 CTCTGATGACTGAAGAGCCTTGG + Intergenic
1169066081 20:2694634-2694656 CTCTGCTGACAGCTGGGACAGGG + Intronic
1169265657 20:4165851-4165873 CTCTGGTTGCTGAGGGGGCATGG + Intronic
1169941446 20:10942192-10942214 ATCTGATAACTGATGGGTAAAGG + Intergenic
1170263787 20:14442687-14442709 GTCTGTTGACTGCTTGGGCATGG - Intronic
1170397523 20:15943408-15943430 CTCTGATGAGTGATGGGGTGAGG - Intronic
1173144509 20:40513064-40513086 CTCTGATGAGTGAAGTGGCTTGG + Intergenic
1173848470 20:46202746-46202768 CTCAGATATCTGATGGGGCCAGG - Intronic
1175556957 20:59870677-59870699 TTCTGAGGAATGGTGGGGCAGGG + Intronic
1176614703 21:9017829-9017851 CTCTGATGCATGATGGGTCAGGG - Intergenic
1176710508 21:10146042-10146064 CTCTGATGCATGATGGGTCAGGG + Intergenic
1177007035 21:15686326-15686348 CTCCTATGAGTGGTGGGGCATGG - Intergenic
1178875814 21:36413142-36413164 CCCTGATGACTGTTGGGGCTGGG - Exonic
1179245041 21:39625722-39625744 TCCTGATGTCTGAAGGGGCATGG + Intronic
1180294589 22:10873194-10873216 CTCTGATGCATGATGGGTCAGGG + Intergenic
1180497395 22:15902608-15902630 CTCTGATGCATGATGGGTCAGGG + Intergenic
1181080111 22:20408207-20408229 CTCTGAAGAGTGTTGGGACAGGG - Exonic
1184289480 22:43490737-43490759 TTCTGTTGGCTGATGGGGCTGGG + Intronic
1185172273 22:49301097-49301119 CCCAGATGACTGAGGGGGCTGGG + Intergenic
1185205845 22:49537862-49537884 ACCTTCTGACTGATGGGGCAGGG - Intronic
949423865 3:3895113-3895135 CTCTGGGGACTGTTGTGGCATGG - Intronic
950199235 3:11031079-11031101 CTCTGGAGGCTGATGGGGCTGGG - Intronic
953889994 3:46744383-46744405 CTCTCATGCGTGATGGGGTAGGG + Intronic
954088815 3:48268640-48268662 CTCTGATGTCTGATGAGGTATGG - Exonic
954693695 3:52409646-52409668 CCCTGATGAGTGAGGGCGCAGGG + Intronic
959063515 3:101636037-101636059 GTCTGATGACTGACGGGACTGGG + Intergenic
960391847 3:117086782-117086804 CTCTGATGACTGAATGATCAGGG - Intronic
960903031 3:122571025-122571047 CTCTGTGGACTGGTGGGGGAAGG - Intronic
964092651 3:152894481-152894503 CTCGTATGACAGAAGGGGCAAGG - Intergenic
965721906 3:171671325-171671347 GTGTCATGACTGATGGGCCAGGG - Intronic
966963454 3:184965709-184965731 CGCTGGTGACTGTTGGGGGATGG + Intronic
968179077 3:196577547-196577569 CTCAGAGCACTGATGGTGCAAGG + Exonic
975508598 4:75167519-75167541 CTCTGATGACTGGTGTGGCCAGG + Intergenic
978858006 4:113415125-113415147 CTTTGAGGACTCATGGGGAAAGG - Intergenic
980183347 4:129429983-129430005 CTCTGAAGACTCAAAGGGCATGG - Intergenic
980210498 4:129781545-129781567 TTCTGATGCCAGATGTGGCAGGG + Intergenic
980267118 4:130531201-130531223 CTCAGATGACGGAAGAGGCAAGG + Intergenic
982096506 4:151928210-151928232 ATCTGATGTCTGATGGGACCTGG + Intergenic
983016509 4:162619895-162619917 ATCTCATAATTGATGGGGCAAGG - Intergenic
986853535 5:11841359-11841381 CTGTAATGACTTATGGGGTAGGG - Intronic
988875973 5:35446109-35446131 CTCTGTGGACTGTTGTGGCATGG + Intergenic
989068888 5:37490110-37490132 CTGAGGTGACTGATGGTGCAGGG + Intronic
994617537 5:102124435-102124457 CTTTGGTGACTGATGGGGGAAGG + Intergenic
994887800 5:105587318-105587340 CTCTGAGGACTCAGGGGGCAAGG + Intergenic
995021257 5:107369816-107369838 CACTGATAACTGATTGGACAGGG - Intergenic
995377162 5:111487994-111488016 CTCTGATTCCTGATGGGCCCTGG + Exonic
997665405 5:135626187-135626209 CTCTGATGAATGTTTGGACAAGG + Intergenic
1000985002 5:167856612-167856634 CTCTGACTTCTGGTGGGGCAGGG + Intronic
1001225784 5:169943626-169943648 CTCTAATGCCTGATGAGGCCAGG - Intronic
1001586159 5:172834813-172834835 CTCAGCTGACAGGTGGGGCAGGG + Intronic
1002765626 6:236229-236251 CACTGATGACTGTTGGGGGCAGG + Intergenic
1002923650 6:1592179-1592201 CTGTGATGACTGATGTTGCCAGG - Intergenic
1003009249 6:2410772-2410794 ATCTGCTGACTGCTGGTGCAAGG + Intergenic
1003931556 6:10928826-10928848 GACAGATGGCTGATGGGGCATGG - Intronic
1003983572 6:11412902-11412924 GTCTGATGACAGGAGGGGCATGG + Intergenic
1004299411 6:14443781-14443803 CTCTGGTGACTGGAGGGCCATGG - Intergenic
1004607503 6:17207534-17207556 AGCTGATGACAGATGGAGCAAGG + Intergenic
1005738747 6:28772208-28772230 GTCTGATGACTGATGGAGCCAGG - Intergenic
1007725751 6:43914768-43914790 CTCTGGTGAGTGTTGGGGCTGGG - Intergenic
1009634983 6:66253494-66253516 CTCTGATGTCTGATGTGCCCTGG + Intergenic
1010082472 6:71880369-71880391 ATCTGTTGAGTGATGAGGCATGG - Intergenic
1013289430 6:108707899-108707921 CTCTGAGGACTGGCGGGGCGAGG - Intergenic
1013748456 6:113373306-113373328 CTCTGGTGTCTGGTGGTGCATGG + Intergenic
1016601525 6:145866886-145866908 CTGTGCTGATTGATGGGGGAAGG + Intronic
1016750498 6:147626024-147626046 GTCTTCTGATTGATGGGGCAGGG + Intronic
1018176868 6:161184678-161184700 CCCTGATGACTGACTGGGCATGG - Intronic
1019049776 6:169174016-169174038 CTCTGATGACTGCAGGGACGTGG - Intergenic
1019387954 7:769143-769165 CTCTGATGACTGGCGGCGCCAGG + Intronic
1019557799 7:1641281-1641303 GTGTGAGGACAGATGGGGCAGGG - Intergenic
1020787998 7:12592949-12592971 CACTGAAGACTGATGAGGCCAGG - Intronic
1020837701 7:13174621-13174643 ATCTGATGACAGTTGAGGCATGG - Intergenic
1022359127 7:29642414-29642436 ATCTGATGATTGACGGGGCTGGG - Intergenic
1024756155 7:52534674-52534696 CTTAGATAACTGATGGTGCAAGG + Intergenic
1027888055 7:83935085-83935107 ATCTGATGACTGCTGGGGTCAGG - Intergenic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1030517569 7:110557335-110557357 CTCTGATGACTAATGAGTCTAGG - Intergenic
1031653103 7:124316075-124316097 CTCTGATGACTGCTTGAGCTGGG - Intergenic
1032721175 7:134551895-134551917 ATCTGATGATTGACGGGGCCAGG + Intronic
1035839902 8:2800047-2800069 CTCTGATGACAGTTGTGGGATGG - Intergenic
1037823466 8:22147052-22147074 CTCTGTGGACTGGTGGGGCCAGG + Exonic
1040594255 8:48822258-48822280 CTGTGATGAGTGATGGGCCGAGG - Intergenic
1040673242 8:49717616-49717638 CTCACATGGCAGATGGGGCAAGG - Intergenic
1041128195 8:54666838-54666860 CTCTGAGAACAGATGGGGCTTGG - Intergenic
1043189591 8:77201852-77201874 CTCTGGGGACTGTTGTGGCATGG - Intergenic
1044001427 8:86886108-86886130 CTCTGATGAATGATAGGGACAGG - Intronic
1044052816 8:87529854-87529876 CTTAAATGACTGATGGGGAATGG + Intronic
1047411765 8:124629964-124629986 CGCTGAGGACAGATGTGGCAAGG + Intronic
1048864072 8:138746569-138746591 CTTTGATGACTGAAAGGCCATGG + Intronic
1049548179 8:143244494-143244516 AATTGATGACTGATGGGGCTGGG - Intergenic
1049856525 8:144865380-144865402 AACTGAAGACTGATGGGGCCAGG - Intergenic
1052501869 9:29302056-29302078 CACTGAAGACTGTTGGGGGAGGG + Intergenic
1053647486 9:40131740-40131762 CTCTGATGCATGATGGGTCAGGG + Intergenic
1053684368 9:40507511-40507533 CTGAGATGACTGAGGGGACAGGG + Intergenic
1053758242 9:41332103-41332125 CTCTGATGCATGATGGGTCAGGG - Intergenic
1053934337 9:43135797-43135819 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054279357 9:63117442-63117464 CTGAGATGACTGAGGGGACAGGG - Intergenic
1054297462 9:63342975-63342997 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054328468 9:63729694-63729716 CTCTGATGCATGATGGGTCAGGG + Intergenic
1054395480 9:64647483-64647505 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054430126 9:65152683-65152705 CTGAGATGACTGAGGGGACAGGG + Intergenic
1054500257 9:65868849-65868871 CTGAGATGACTGAGGGGACAGGG - Intergenic
1054537093 9:66244430-66244452 CTCTGATGCATGATGGGTCAGGG - Intergenic
1055336457 9:75237438-75237460 CCCTCATTCCTGATGGGGCATGG - Intergenic
1056291695 9:85149980-85150002 CTCTGGTGAGTGATGGCTCATGG + Intergenic
1058568428 9:106312602-106312624 TCCTGATGACTGATAGGCCAGGG - Intergenic
1058896391 9:109404272-109404294 CTCTGAGGACTGACAGGGCGAGG - Intronic
1061239108 9:129358874-129358896 CTCTGAAGGCTGCAGGGGCACGG + Intergenic
1062399706 9:136367040-136367062 CTCTGATGGCTCAAGGGGTAAGG - Intronic
1062525242 9:136975636-136975658 CTCTGAAGTCTGATGGGGCCGGG - Intergenic
1202795271 9_KI270719v1_random:115037-115059 CTCTGATGCATGATGGGTCAGGG + Intergenic
1185539470 X:890775-890797 CTCTGATGACTAGAGGTGCAAGG - Intergenic
1186652129 X:11572344-11572366 CTCTGATGACTGTTGTGGGGTGG - Intronic
1186684525 X:11911607-11911629 TCCTGATGACTGAGTGGGCAGGG + Intergenic
1187793545 X:22977199-22977221 CTCTGACTTCTGTTGGGGCAGGG + Intergenic
1191762259 X:64658521-64658543 CTCTGGGGACTGTTGTGGCATGG - Intergenic
1192197318 X:69037091-69037113 CTCTGAGGGCTGATGGGGTTTGG + Intergenic
1192569483 X:72191108-72191130 CTCTGTTGACTGATGGGAGTGGG - Intronic
1193002125 X:76574642-76574664 CTCTGGGGACTGTTGTGGCATGG - Intergenic
1193668455 X:84353424-84353446 CTCTCATGGCAGAAGGGGCAAGG - Intronic
1195248596 X:103020616-103020638 CTCTGGGGACTGTTGTGGCATGG - Intergenic
1195738903 X:108042531-108042553 CTATAATCACTTATGGGGCATGG + Intergenic
1196438640 X:115696886-115696908 CTCTGTTGCCTGAAGAGGCAGGG - Intergenic
1198078987 X:133220846-133220868 CTCTGATAACTGAAGGGGCAGGG - Intergenic
1198510260 X:137343359-137343381 CTTTGATGACAGAGGAGGCAAGG - Intergenic
1200124134 X:153805328-153805350 CTCTGAAGGCTGAGGGGGCTGGG - Intronic
1201283108 Y:12357970-12357992 CTCTGATGATTGATGGGACCAGG - Intergenic
1201616564 Y:15907078-15907100 CTCTGGTGGCTCATTGGGCATGG + Intergenic
1202119267 Y:21507771-21507793 CTCTCTTGTCTGGTGGGGCAGGG + Intergenic
1202121719 Y:21531311-21531333 CTCTCTTGTCTGGTGGGGCAGGG + Intronic
1202157286 Y:21898071-21898093 CTCTCTTGTCTGGTGGGGCAGGG - Intronic
1202159733 Y:21921612-21921634 CTCTCTTGTCTGGTGGGGCAGGG - Intergenic
1202186178 Y:22186527-22186549 CTCTCTTGTCTGGTGGGGCAGGG - Intergenic
1202205181 Y:22399869-22399891 CTCTCTTGTCTGGTGGGGCAGGG + Intronic
1202338616 Y:23836358-23836380 CTCTGATTAGTCATGGGTCAAGG - Intergenic
1202532150 Y:25833714-25833736 CTCTGATTAGTCATGGGTCAAGG + Intergenic