ID: 1163117150

View in Genome Browser
Species Human (GRCh38)
Location 19:15195686-15195708
Sequence GGGCCGCAGTGGTCGCCCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 136}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163117150_1163117164 20 Left 1163117150 19:15195686-15195708 CCGCAGGGCGACCACTGCGGCCC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1163117164 19:15195729-15195751 GCGCGCTGCGCTGGGCGCCGAGG 0: 1
1: 0
2: 1
3: 35
4: 302
1163117150_1163117157 -3 Left 1163117150 19:15195686-15195708 CCGCAGGGCGACCACTGCGGCCC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1163117157 19:15195706-15195728 CCCCGACCGCGCGTCGGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 48
1163117150_1163117152 -9 Left 1163117150 19:15195686-15195708 CCGCAGGGCGACCACTGCGGCCC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1163117152 19:15195700-15195722 CTGCGGCCCCGACCGCGCGTCGG 0: 1
1: 0
2: 0
3: 6
4: 44
1163117150_1163117163 12 Left 1163117150 19:15195686-15195708 CCGCAGGGCGACCACTGCGGCCC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1163117163 19:15195721-15195743 GGGAGGGGGCGCGCTGCGCTGGG 0: 1
1: 0
2: 2
3: 39
4: 327
1163117150_1163117153 -8 Left 1163117150 19:15195686-15195708 CCGCAGGGCGACCACTGCGGCCC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1163117153 19:15195701-15195723 TGCGGCCCCGACCGCGCGTCGGG 0: 1
1: 0
2: 0
3: 6
4: 50
1163117150_1163117154 -5 Left 1163117150 19:15195686-15195708 CCGCAGGGCGACCACTGCGGCCC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1163117154 19:15195704-15195726 GGCCCCGACCGCGCGTCGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 75
1163117150_1163117155 -4 Left 1163117150 19:15195686-15195708 CCGCAGGGCGACCACTGCGGCCC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1163117155 19:15195705-15195727 GCCCCGACCGCGCGTCGGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 56
1163117150_1163117162 11 Left 1163117150 19:15195686-15195708 CCGCAGGGCGACCACTGCGGCCC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1163117162 19:15195720-15195742 CGGGAGGGGGCGCGCTGCGCTGG 0: 1
1: 0
2: 5
3: 49
4: 383
1163117150_1163117165 28 Left 1163117150 19:15195686-15195708 CCGCAGGGCGACCACTGCGGCCC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1163117165 19:15195737-15195759 CGCTGGGCGCCGAGGATAGCTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1163117150_1163117159 -2 Left 1163117150 19:15195686-15195708 CCGCAGGGCGACCACTGCGGCCC 0: 1
1: 0
2: 2
3: 10
4: 136
Right 1163117159 19:15195707-15195729 CCCGACCGCGCGTCGGGAGGGGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163117150 Original CRISPR GGGCCGCAGTGGTCGCCCTG CGG (reversed) Intronic
901190411 1:7406779-7406801 GGGCAGCAGTGGGCCACCTGGGG - Intronic
904010022 1:27383969-27383991 GGGCAGGAGTGGTAGCCGTGGGG - Intergenic
907407092 1:54260345-54260367 GAGCCCCACTGCTCGCCCTGAGG - Intronic
908087481 1:60651712-60651734 GGGCCGCAGTCGACATCCTGAGG - Intergenic
915252815 1:154602663-154602685 GGGCTGCAGTGGTGAACCTGTGG + Intronic
924787500 1:247211698-247211720 GGGCAGCAATGGTCTACCTGTGG - Intergenic
1068120407 10:52778532-52778554 TGGCCGCAGTGGTCGCGCCGCGG + Intergenic
1074696619 10:116055639-116055661 GAGCCGCAGCGAGCGCCCTGGGG - Intergenic
1075707151 10:124508149-124508171 GGGCCGGAGTGGCCCCCATGTGG - Intronic
1076398744 10:130162798-130162820 AGGCCGCAGGGGTGGGCCTGAGG - Intronic
1076715898 10:132363544-132363566 GGTCTCCAGTGGTCTCCCTGAGG - Intronic
1077056769 11:597728-597750 GGGCCGCTGGGGTCACCCTGGGG - Intronic
1077177556 11:1197603-1197625 GGGCAGCACTGGCCGGCCTGTGG - Intronic
1083945068 11:65919103-65919125 CGGCCGCAGCGGCCGCGCTGTGG + Exonic
1084050940 11:66599468-66599490 GGGCAGCAGTGGCCATCCTGGGG + Exonic
1090185667 11:124737829-124737851 TGGCCACAGTGCTGGCCCTGGGG - Intergenic
1097054777 12:56242903-56242925 TGGCAGAAGGGGTCGCCCTGGGG + Exonic
1101506567 12:105352227-105352249 TGGCCACATTGGTCACCCTGGGG + Intronic
1102760922 12:115384265-115384287 GGGCCTCAGTGTTCTCTCTGGGG + Intergenic
1104042964 12:125142452-125142474 GGGCCGCAGGTGTGGCACTGTGG + Exonic
1105437914 13:20392319-20392341 GCGGCGGAGTGGGCGCCCTGTGG - Intergenic
1105678700 13:22703947-22703969 GGGCCTCAGTGGACGCCTGGAGG - Intergenic
1106230612 13:27818460-27818482 GGGCCACAGTGGTCTCCCCAGGG - Intergenic
1107838802 13:44435202-44435224 GGGACGCGGTGGGCGCGCTGTGG - Intronic
1113607885 13:111623285-111623307 GGGCAGCAGAGGTGGCACTGCGG - Intronic
1113662697 13:112118020-112118042 GTGCCGCGGTGGAAGCCCTGGGG + Intergenic
1115851617 14:37594502-37594524 GGGACGAAGAGGTCGCCTTGTGG + Intronic
1117922030 14:60734959-60734981 GGGCGGCAGTGGATTCCCTGGGG + Intronic
1122023708 14:98859500-98859522 GGGGCTCAGTGTTTGCCCTGTGG - Intergenic
1123710212 15:22980866-22980888 GGGCCGCAGGGGCCGGCCGGGGG - Intronic
1125592922 15:40865985-40866007 GGGCCACATTAGTCACCCTGTGG - Intergenic
1129236712 15:74228125-74228147 GGACTGCAGTGCTCTCCCTGTGG - Intergenic
1131515405 15:93073332-93073354 CGGCCGCAGCGCTCGCCGTGAGG + Intronic
1132709818 16:1261446-1261468 GGGCCGCCGGAGTCACCCTGAGG + Intergenic
1132715168 16:1286496-1286518 GGGCCCCCGTTGTCGCCCTGTGG + Intergenic
1132976312 16:2712798-2712820 GGGCCGCCCGAGTCGCCCTGCGG + Exonic
1133001907 16:2856095-2856117 GGGCAGCAGTGATCACCCAGCGG + Exonic
1133237049 16:4392259-4392281 GGGCGGCAGTGGGGGTCCTGGGG + Intronic
1133311321 16:4848167-4848189 GGGCCGCAGACGTCCCCCCGCGG - Intronic
1134828585 16:17305028-17305050 GGCCCACAGTGGGCACCCTGCGG - Intronic
1136171727 16:28494149-28494171 GGGCCGGATTGGTGGCTCTGGGG - Intronic
1136654139 16:31699690-31699712 GGGCAGCAGTGGTCGACCTGTGG + Intergenic
1137426673 16:48385759-48385781 CGGCCGGAGGGGTCGCCCAGCGG + Intronic
1139501315 16:67368537-67368559 AGGCCGCACTGGCCTCCCTGAGG - Intronic
1140472814 16:75224699-75224721 GGGCCGCCAGAGTCGCCCTGTGG - Exonic
1141697691 16:85627942-85627964 GGCCCGCATCGGTCTCCCTGGGG + Intronic
1141867502 16:86760853-86760875 GGGCCCTTATGGTCGCCCTGGGG + Intergenic
1142131848 16:88434770-88434792 GGGCCGAGGGGGTCCCCCTGGGG - Exonic
1143449518 17:7027497-7027519 AGGCCACAGGGGTCGCACTGTGG - Exonic
1143659273 17:8314857-8314879 GGGCAGCAGTGGTGGCCCTGGGG + Intronic
1144804652 17:17956635-17956657 GGGTCTCAGCGGTCTCCCTGCGG - Intronic
1145290605 17:21542661-21542683 GGGCAGCAGTGGCCTACCTGTGG + Intronic
1148475891 17:47928246-47928268 CGGCCACTGTGGACGCCCTGGGG + Exonic
1148805971 17:50264239-50264261 GGCCCGCTGTGGTAGCCCTGTGG + Intergenic
1149582851 17:57763247-57763269 GGGAAACAGTGGTCCCCCTGTGG + Intergenic
1151596214 17:75079348-75079370 GGTCCGCAATGGTGGTCCTGAGG + Intergenic
1152897845 17:82923527-82923549 GGGACACCGTGGTCACCCTGAGG - Intronic
1157574146 18:48732487-48732509 TGGAGGCAGTGGTTGCCCTGTGG - Intronic
1160514452 18:79470782-79470804 AGGTCGCAGTGGTCGGCCTCCGG + Intronic
1160685538 19:434836-434858 GGGCCGGAGGAGTCGGCCTGGGG - Exonic
1160760344 19:781067-781089 GGTCTGCACTGGCCGCCCTGTGG + Intergenic
1160936693 19:1599518-1599540 GGGGCGCTGTGGGCGCCGTGGGG - Exonic
1161156112 19:2732646-2732668 GGGCCACAGTGCTCGCTCTTGGG + Exonic
1163117150 19:15195686-15195708 GGGCCGCAGTGGTCGCCCTGCGG - Intronic
1163993213 19:21018759-21018781 GGCCAGCAGTGGTCTACCTGTGG + Intergenic
1164030029 19:21395509-21395531 GGCCAGCAGTGGTCTACCTGTGG + Intergenic
1164123015 19:22285227-22285249 GGCCAGCAGTGGTCTACCTGTGG + Intergenic
1164177169 19:22785306-22785328 GGCCAGCAGTGGTCTACCTGTGG - Intergenic
1164307926 19:24021222-24021244 GGCCAGCAGTGGTCCACCTGTGG - Intergenic
1166370234 19:42296202-42296224 GGGCAGCAGGGGTCACACTGAGG - Intergenic
1167072824 19:47230643-47230665 GGGCCGCACTGGCCGCCAGGGGG + Intronic
1167467567 19:49658320-49658342 GGGCGGCCGTGGGGGCCCTGGGG - Exonic
1167506355 19:49873070-49873092 GAGCAGCAGTGGCAGCCCTGTGG + Exonic
1167627800 19:50604119-50604141 GGGGCAGAGGGGTCGCCCTGAGG + Intergenic
1167628157 19:50606014-50606036 GGGGCAGAGGGGTCGCCCTGAGG + Intergenic
925051375 2:818296-818318 GGGCTGCAGTGATTCCCCTGGGG + Intergenic
927809346 2:26173047-26173069 GGGCCGGGGTCGGCGCCCTGCGG + Intergenic
927990180 2:27442182-27442204 GTGCTGCAGTGGTGGCCCTGGGG + Exonic
931671811 2:64654101-64654123 GGGGCGCAGTGGGCGCCTGGTGG + Intronic
935128959 2:100247241-100247263 GGGCCTCAGTGGTGGCTGTGGGG + Intergenic
940377077 2:152969021-152969043 GGGCCCAAGTGATTGCCCTGAGG + Intergenic
941580595 2:167292753-167292775 GGCCCGCAGGGGTGGGCCTGGGG - Intergenic
1169116942 20:3072071-3072093 GGGCCGCAGGGGAGGCACTGCGG - Exonic
1169118729 20:3083162-3083184 GGGCCGCAGGGGAGGCACTGCGG + Exonic
1172407048 20:34697711-34697733 GGGAGGCAGTGGATGCCCTGGGG - Intronic
1175424444 20:58854795-58854817 GGGCTGCAGAGGCCGCCCGGCGG - Exonic
1175946880 20:62563055-62563077 AGGCCGCAGTGGCCTCCCCGTGG + Intronic
1175966564 20:62662766-62662788 GGGCTGGAGTGGGCACCCTGGGG - Intronic
1176103969 20:63377063-63377085 CGGCCCCGGTGGTCGCCCGGGGG - Intronic
1178948293 21:36966310-36966332 GGGCCGCACAGGCCGCACTGAGG + Intronic
1179546824 21:42118260-42118282 GGGCAGCTGTGGTCTCCCTGGGG + Intronic
1180143660 21:45908122-45908144 GGGCCTCACTGGCTGCCCTGGGG - Intronic
1180154850 21:45972824-45972846 GGGCAGCAGTGGGAGCCCTCGGG - Intergenic
1180830915 22:18905764-18905786 GGCCTGCCGTGGTCGCCCCGGGG - Intergenic
1182583758 22:31331079-31331101 TGACCGCAGTGGTCTGCCTGAGG + Intronic
1182696934 22:32204302-32204324 TGGCTGCACTGGTCGCGCTGGGG - Intergenic
1184161856 22:42701720-42701742 TGGCCGCAGTGGTCCGGCTGAGG + Intronic
1185276439 22:49951969-49951991 GGGCCTCAGTGGAGGGCCTGCGG - Intergenic
1185287857 22:50010524-50010546 AGGCCACAGTGGGCGCCCAGAGG - Intronic
1203281002 22_KI270734v1_random:131035-131057 GGCCTGCCGTGGTCGCCCCGGGG - Intergenic
951949681 3:28185958-28185980 TGGTGGCAGTGGTAGCCCTGTGG - Intergenic
953509738 3:43523993-43524015 GGGCCACAGTGGAAGCCATGGGG + Intronic
953911701 3:46896537-46896559 GGGAGGCTGTGGTCACCCTGTGG + Intronic
959041110 3:101424169-101424191 GGGCAGCATTGGGTGCCCTGGGG + Intronic
960864290 3:122184304-122184326 GGGCCGCAGCGGCCGCCCAGAGG + Intronic
961414933 3:126750311-126750333 GGGTCTCAGTGGAAGCCCTGAGG - Intronic
962454076 3:135549069-135549091 GGGCCCCAGTGGATGCCATGTGG - Intergenic
966595700 3:181723230-181723252 TGCCCGCAGTGGTGGCACTGAGG - Intergenic
968577747 4:1375870-1375892 GGACCTCAGCGGTGGCCCTGAGG + Intronic
969442010 4:7222801-7222823 CGGCAGCTGTGGTCTCCCTGGGG + Intronic
979033211 4:115678633-115678655 GGGCCTCAGCGGCCTCCCTGAGG - Intergenic
979758792 4:124374264-124374286 GGGTAGTAGTGGTCGGCCTGTGG + Intergenic
984754560 4:183313425-183313447 GGGGGGCAGTGGCTGCCCTGTGG + Intronic
985005878 4:185535263-185535285 GGGACGCAGTGGATGCCCCGGGG - Intronic
986970694 5:13332737-13332759 GGGCAGCAGTGGTCTACCTGTGG + Intergenic
998137830 5:139683752-139683774 AGGCCGCAGGGGGCCCCCTGGGG - Exonic
998740119 5:145190981-145191003 GGGCCGCATTGGTGGACATGTGG + Intergenic
1001591873 5:172871145-172871167 GGGCTGCAGAGGTCCCCGTGGGG + Intronic
1006642021 6:35494543-35494565 GGGTCCCAGGGGTGGCCCTGAGG - Intronic
1007072972 6:39049723-39049745 GGGCTGCGGTGGTCCACCTGTGG - Intronic
1019281151 7:200915-200937 GGCCAGCAGTGGGCACCCTGGGG - Intronic
1021291040 7:18845984-18846006 GGGCCGTAGTGGGCTTCCTGGGG + Intronic
1022559858 7:31336678-31336700 CGCCCGCAGTGGGCGCCCTGGGG - Intergenic
1024148587 7:46543468-46543490 TGGCCACAGGGGTCTCCCTGAGG + Intergenic
1025777686 7:64573539-64573561 TGGCAGCAGTGGTCTACCTGGGG + Intergenic
1027266379 7:76497199-76497221 GGGACGCACAGGTCTCCCTGGGG - Intronic
1027317759 7:76995317-76995339 GGGACGCACAGGTCTCCCTGGGG - Intergenic
1029707292 7:102282654-102282676 GGGCTGCAGGGGTGGCCTTGAGG + Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1030431268 7:109452239-109452261 GGAGCGCAGTGGACACCCTGCGG - Intergenic
1034276072 7:149824414-149824436 TGGTCCGAGTGGTCGCCCTGTGG + Intergenic
1034306614 7:150048889-150048911 GGGCGGCAGAGGACGCCCAGAGG + Intergenic
1034488620 7:151381381-151381403 GAGCGGGAGTGCTCGCCCTGGGG - Exonic
1034800231 7:154051754-154051776 GGGCGGCAGAGGACGCCCAGAGG - Intronic
1037380936 8:18284462-18284484 GGATCACAGTAGTCGCCCTGAGG - Intergenic
1038348375 8:26753104-26753126 GGGCCGAAAGGGTAGCCCTGAGG + Intronic
1042408725 8:68436817-68436839 GAGCCGCAGAGGTAGACCTGAGG - Intronic
1045694188 8:104789232-104789254 GGGCCTCCCTGGTTGCCCTGTGG - Intronic
1047381790 8:124371771-124371793 GGGCCGCAGCGGGCTCCCGGTGG + Intronic
1047981488 8:130187825-130187847 GGTCCCCAGTGGTCACACTGTGG + Intronic
1048441364 8:134461957-134461979 GGTCTGCAGTGGCTGCCCTGGGG + Intergenic
1049288613 8:141790139-141790161 TGACCGCAGTGGTCCCGCTGAGG - Intergenic
1051901175 9:22042585-22042607 GGGCCACAGTGGTGGCCATGGGG - Intergenic
1057218191 9:93241107-93241129 AGGCAGCAGTGTTGGCCCTGGGG - Intronic
1061165401 9:128919455-128919477 GGGCCAACGTGGGCGCCCTGCGG + Intergenic
1062045912 9:134424404-134424426 GGACCTCAGTGGGCGCCCAGGGG - Intronic
1062397628 9:136358792-136358814 AGGCTGCAGTGGCAGCCCTGAGG + Exonic
1188041001 X:25369671-25369693 GGGAAGCAGTGGTTGCACTGTGG + Intergenic
1197635347 X:128908622-128908644 GGGCAGCAGTGGTGGCACAGAGG - Intergenic