ID: 1163119751

View in Genome Browser
Species Human (GRCh38)
Location 19:15210358-15210380
Sequence CCCGGCCACATGGAGTACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163119746_1163119751 -6 Left 1163119746 19:15210341-15210363 CCTGGGTCTCAGTGACTCCCGGC No data
Right 1163119751 19:15210358-15210380 CCCGGCCACATGGAGTACAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163119751 Original CRISPR CCCGGCCACATGGAGTACAG GGG Intergenic
No off target data available for this crispr