ID: 1163121933

View in Genome Browser
Species Human (GRCh38)
Location 19:15223529-15223551
Sequence CGCGGCCGCCGGCGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163121933_1163121942 -9 Left 1163121933 19:15223529-15223551 CCTCCCTCCCGCCGGCGGCCGCG No data
Right 1163121942 19:15223543-15223565 GCGGCCGCGGAGGCGGAAGAAGG No data
1163121933_1163121946 23 Left 1163121933 19:15223529-15223551 CCTCCCTCCCGCCGGCGGCCGCG No data
Right 1163121946 19:15223575-15223597 GTCGCCCTAGCAACCGTCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163121933 Original CRISPR CGCGGCCGCCGGCGGGAGGG AGG (reversed) Intergenic