ID: 1163122010

View in Genome Browser
Species Human (GRCh38)
Location 19:15223787-15223809
Sequence GACGTCGGAGCCCGCGGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163122010_1163122015 -3 Left 1163122010 19:15223787-15223809 CCTCCGCCGCGGGCTCCGACGTC No data
Right 1163122015 19:15223807-15223829 GTCCGCGACCCCACGTCTCAGGG No data
1163122010_1163122014 -4 Left 1163122010 19:15223787-15223809 CCTCCGCCGCGGGCTCCGACGTC No data
Right 1163122014 19:15223806-15223828 CGTCCGCGACCCCACGTCTCAGG No data
1163122010_1163122016 -2 Left 1163122010 19:15223787-15223809 CCTCCGCCGCGGGCTCCGACGTC No data
Right 1163122016 19:15223808-15223830 TCCGCGACCCCACGTCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163122010 Original CRISPR GACGTCGGAGCCCGCGGCGG AGG (reversed) Intergenic
No off target data available for this crispr