ID: 1163124303

View in Genome Browser
Species Human (GRCh38)
Location 19:15236500-15236522
Sequence GTGGGGGGACAGGATGGAGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 758
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 693}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163124297_1163124303 -7 Left 1163124297 19:15236484-15236506 CCAAGTCCTTTGGTGAGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 148
Right 1163124303 19:15236500-15236522 GTGGGGGGACAGGATGGAGTAGG 0: 1
1: 0
2: 4
3: 60
4: 693
1163124295_1163124303 -6 Left 1163124295 19:15236483-15236505 CCCAAGTCCTTTGGTGAGTGGGG 0: 1
1: 0
2: 1
3: 7
4: 122
Right 1163124303 19:15236500-15236522 GTGGGGGGACAGGATGGAGTAGG 0: 1
1: 0
2: 4
3: 60
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163124303 Original CRISPR GTGGGGGGACAGGATGGAGT AGG Exonic
900035354 1:403180-403202 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
900056974 1:638929-638951 GTGGAGGGACAGAAAGAAGTAGG + Intergenic
900187757 1:1340272-1340294 GTTGAGGGACATGGTGGAGTCGG + Exonic
900338831 1:2178194-2178216 GTGTGGGGAGAGGCTGGAGTGGG - Intronic
900400179 1:2469788-2469810 GTGTGGGGGCAGGGTGGAGTTGG + Intronic
900792212 1:4688080-4688102 GTGGGGAGCCAGGATGGGGAAGG + Intronic
901145455 1:7061749-7061771 GTGGAGAGAGAGGCTGGAGTAGG + Intronic
901159354 1:7163277-7163299 GTGGGTGGCCAGGCTGGGGTGGG + Intronic
901232374 1:7648458-7648480 GTGTGGGCACAGTAAGGAGTGGG + Intronic
902805074 1:18855928-18855950 GTGGCTGGACAGGAGGGAGTGGG - Intronic
903009825 1:20321736-20321758 GTGGGAGGAATGGATGGAGAGGG + Intronic
903225773 1:21893516-21893538 GTGGGGAGAGAGGATGGGGAGGG + Intronic
903594279 1:24482297-24482319 GTGGGGGGCCAGGATGGGGGTGG - Intergenic
904276511 1:29388248-29388270 GTGGGTGTACAGGAGGGAGGAGG + Intergenic
905202648 1:36324324-36324346 GGTGGGGGACGGGATGGGGTGGG - Intronic
905986752 1:42291992-42292014 GTGGGAGGAAAGGCAGGAGTGGG + Intronic
906122514 1:43403796-43403818 GTGGGAAGAAAGGATGGGGTGGG + Intronic
906323010 1:44828239-44828261 GTGAGGGGACAGGCTGGCGTGGG + Intronic
906504278 1:46366341-46366363 GTAGGGGGATAGGATGGGGCTGG + Intergenic
906751678 1:48268087-48268109 GTGGGGGGCCAGGGTGGTCTTGG + Intergenic
907203335 1:52746912-52746934 ATGGAGGGAAAGGATGGAGGGGG - Intronic
907461693 1:54609142-54609164 CCTTGGGGACAGGATGGAGTGGG - Intronic
907487546 1:54788003-54788025 GTGGGGGTACGGGATGGAAGAGG - Intronic
907706825 1:56839634-56839656 GTGGGGGGGCAGGGTGGTTTTGG + Intergenic
908643803 1:66254890-66254912 GTGGAGGGATAGATTGGAGTGGG - Intronic
908929969 1:69306338-69306360 GTGGAGGGCCAGGATGGTCTTGG + Intergenic
908953099 1:69586502-69586524 GGCGGGGGACAGGATGCAGCAGG + Intronic
909488535 1:76200858-76200880 GTAAGGAGGCAGGATGGAGTGGG + Intronic
910245327 1:85132665-85132687 GTGCTGGGAAAGGAGGGAGTGGG - Intronic
910292402 1:85612243-85612265 GTGGGGAGAACGGATGCAGTGGG - Intergenic
910452576 1:87361984-87362006 GAGGGAGGACAGGAAGGAGGTGG - Intergenic
910599968 1:89020485-89020507 GTTGGGGGACAGAAGGGACTTGG + Intronic
911857009 1:102891505-102891527 GCGGGGGGGCAGGACAGAGTTGG - Intronic
912342016 1:108925701-108925723 GTGGGGACAAAGGATTGAGTGGG + Intronic
913255270 1:116947430-116947452 GCTGAGAGACAGGATGGAGTAGG - Intronic
913347783 1:117825531-117825553 CTGGGGAGACTGGATGGAGTTGG - Intergenic
913586289 1:120278391-120278413 GTGGGGGGAGAGGGTGGGGCTGG + Intergenic
913621897 1:120619978-120620000 GTGGGGGGAGAGGGTGGGGCTGG - Intergenic
914568298 1:148890249-148890271 GTGGGGGGAGAGGGTGGGGCTGG + Intronic
914604527 1:149240000-149240022 GTGGGGGGAGAGGGTGGGGCTGG - Intergenic
915112150 1:153570838-153570860 TTGGGGGGCGAGGATGGAGGTGG - Intergenic
915911452 1:159918186-159918208 GTGGGGTGAGGGGATGGAGAGGG - Exonic
915935117 1:160085959-160085981 GTGGGGGAAGAGGAAAGAGTCGG - Intronic
916389829 1:164319727-164319749 GTGGAGGGATGGGAAGGAGTAGG + Intergenic
916894785 1:169151317-169151339 GTGAAGTGGCAGGATGGAGTGGG + Intronic
917802049 1:178580424-178580446 GTGAGAGGGGAGGATGGAGTAGG - Intergenic
919914393 1:202130661-202130683 GTGGGGGAGCAGGTTGGAGAGGG + Exonic
919973937 1:202598862-202598884 GTGGCTGGAGAGGATGGAGGTGG + Intronic
920685374 1:208105157-208105179 GAGGGTGGCCAGGATGGGGTGGG + Intronic
922033203 1:221824428-221824450 TTTGGGGGAAGGGATGGAGTGGG + Intergenic
922257888 1:223908739-223908761 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
922471328 1:225879193-225879215 GTGTGGGGACAGGAAGGAGGAGG - Intronic
922605197 1:226885814-226885836 GGTGGGAGACAGGATGGGGTGGG - Intronic
922807304 1:228397099-228397121 GAGGGGGGGCAGGAGGGAGTGGG - Intronic
922969507 1:229724109-229724131 GTGTGGGGGGAGGAGGGAGTGGG + Intergenic
923041516 1:230323271-230323293 CTGGAGGGACAGGATGGACCTGG - Exonic
923454200 1:234148947-234148969 GTGGGGGCAGGGGATGGAATGGG + Intronic
923782019 1:237033142-237033164 GTGAGGGGACAGGCTGGTGAAGG - Intergenic
924070286 1:240270831-240270853 CTGAGGGGACAGGATGGATGGGG + Intronic
924112061 1:240710031-240710053 GTGTGGGGACAGGAAGGTGTGGG - Intergenic
924151789 1:241137128-241137150 GAGGGGAGAGAGGAAGGAGTAGG - Intronic
924339085 1:243011514-243011536 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
924493225 1:244560407-244560429 GTGGGGGGGCAGGATGGGAGTGG + Intronic
924581892 1:245330537-245330559 GTGGGGGGACTGGGGGAAGTGGG + Intronic
1062940957 10:1421120-1421142 GTGGGGGCACCGGCTGGAGGAGG + Intronic
1064583525 10:16817225-16817247 GTGCGGGGAGGGGATGGAGTGGG + Exonic
1065510992 10:26478338-26478360 GTGGGGCGGGAGGATGGAGGCGG + Intronic
1066293587 10:34035388-34035410 GTGGAGGGAGAGGCGGGAGTGGG + Intergenic
1066952726 10:42137487-42137509 GTGGGGAGACAAGAGGGAGAGGG - Intergenic
1067256434 10:44647341-44647363 GGGGGTGGGCAGGATGGGGTGGG - Intergenic
1067844283 10:49707340-49707362 GTGATGGGAAGGGATGGAGTGGG - Intronic
1067925258 10:50502259-50502281 GTGTGGGGAGAGGCTGGAGGTGG - Intronic
1068892759 10:62164994-62165016 TTGGGGTGACAGGTTGGTGTGGG - Intergenic
1069495695 10:68901402-68901424 CTGGGGGGACATTATGGAGCTGG + Exonic
1069824423 10:71246390-71246412 GTGGGGGGCCAGGATGGTAGGGG + Intronic
1070306488 10:75242538-75242560 GATGGGGGACGGGATGGAGGTGG - Intergenic
1070351523 10:75597389-75597411 GGTGGGGGACTGGGTGGAGTGGG - Intronic
1070540368 10:77411282-77411304 GTGGGAGGGAAGGAAGGAGTGGG + Intronic
1070673812 10:78398190-78398212 CTGGGAGGACACGATGTAGTTGG - Intergenic
1071569460 10:86688923-86688945 GGGAGGGGACAGGAGGGAGATGG - Intronic
1071710379 10:88043674-88043696 GTGTGGAGACTGGATGGGGTTGG + Intergenic
1072822989 10:98576719-98576741 GGGGCAGGACAGGATGGAGGAGG - Intronic
1073835932 10:107442345-107442367 GTCGGGAGACAGGCTTGAGTGGG + Intergenic
1075589924 10:123684014-123684036 GTTGGGGGAGGGGATGGAGCTGG - Intronic
1075623980 10:123948543-123948565 GTGGGGGGAAGGGACGGAGACGG - Intergenic
1075807624 10:125201552-125201574 GCTGGGGGATAGGATGGAGGGGG - Intergenic
1077118450 11:896006-896028 GTGGGAGGGCAGGAGGCAGTAGG - Intronic
1077261871 11:1626366-1626388 CTGGGGGTACAGGAAGGAGGCGG - Intergenic
1077360279 11:2137761-2137783 GGGCGGGGCCAGGATGGAGAGGG - Intronic
1077366179 11:2162268-2162290 CTGGGGGGCCAGGACGGAGCTGG - Intergenic
1077409044 11:2395059-2395081 GTGCAGGGACAGGGTGGGGTGGG + Intronic
1077426418 11:2480909-2480931 GGAGAGGGACAGGATGGAGCAGG + Intronic
1077557842 11:3234471-3234493 GTAGGGGAACTGGAAGGAGTGGG - Intergenic
1078919518 11:15816502-15816524 GTGGAGGGGCAGGAAGGTGTTGG + Intergenic
1080466484 11:32502346-32502368 GTGGGGGGATAGGACGGTTTCGG - Intergenic
1080911567 11:36605267-36605289 GTGGGGGGGCAGGGGGGAGGTGG - Intronic
1081456512 11:43228624-43228646 GGGAGGGAACAGGATGGAGTAGG - Intergenic
1081623924 11:44635377-44635399 GTGGGGGGCCACGTGGGAGTGGG + Intergenic
1083581656 11:63828869-63828891 GTGGGGGCACAGGTGGGACTTGG + Intergenic
1083749895 11:64755135-64755157 GTGGGGGCACAGGATGCACAAGG + Intronic
1083933874 11:65860426-65860448 CTGGGGTGACAGGAAGGAGCCGG + Exonic
1084161991 11:67355109-67355131 GTGGGGGCACTGCATGGAGCTGG + Intronic
1084360422 11:68665308-68665330 GTGGGGGGACTGTGTTGAGTTGG - Intergenic
1084797662 11:71519141-71519163 GTGAGGGGATGGGAGGGAGTCGG - Intronic
1084953960 11:72681507-72681529 GTGGGAGGACAGGGTGGAGGAGG + Intergenic
1086863015 11:91947497-91947519 GGGTGGGAACAGGATGGGGTGGG - Intergenic
1087139516 11:94751626-94751648 GTTGGGAGAGAGAATGGAGTAGG + Intronic
1087384677 11:97455872-97455894 GAGAGAGGACAGGAAGGAGTTGG + Intergenic
1087439203 11:98161437-98161459 GTGGTGGGCCAGGATGGTTTTGG - Intergenic
1088298134 11:108323405-108323427 GTGGAGGGAGAGGATGAAGAGGG + Intronic
1088787364 11:113194340-113194362 GAAGGGGGAAAGGATGGAGAAGG - Intronic
1089284542 11:117397081-117397103 GTGGGAGGACAGGCTGGAGCAGG - Exonic
1089494918 11:118903023-118903045 GTGGTAGGCGAGGATGGAGTCGG + Exonic
1089778919 11:120859513-120859535 GTGTGGGGAGAGGATGGAGTTGG + Intronic
1089916066 11:122158051-122158073 GTGGGTGGATAGGATGGCTTGGG + Intergenic
1090465015 11:126925816-126925838 GTGGCAGGAGAGGATGGAGAAGG - Intronic
1090472656 11:126994220-126994242 GTAGGGGGTCAGGAGGGCGTGGG + Intronic
1090662422 11:128891527-128891549 GTGAAGGGACAGGATGGCTTAGG + Exonic
1090800638 11:130169466-130169488 GGTGGGGGACAGGAGGGAGGTGG + Intronic
1091334400 11:134755523-134755545 GCACAGGGACAGGATGGAGTGGG + Intergenic
1091862776 12:3801595-3801617 GTGTGGGGAAAGCAGGGAGTGGG - Intronic
1091863854 12:3812669-3812691 GTGGGGGCAGGGGATGGTGTTGG - Intronic
1092283969 12:7118140-7118162 GTGGGGAGACAGGCTGGGGTGGG + Intergenic
1092919491 12:13218445-13218467 GTGGGGGGAGAGAAGGGAATAGG + Exonic
1094526923 12:31237294-31237316 GGTGGGAGACAGGATGCAGTGGG + Intergenic
1095953785 12:47795450-47795472 GTGGGGGGCCAGGGTGCAGCAGG + Intronic
1096023891 12:48344846-48344868 GTGGGGGAAGAGGTTGGGGTGGG - Intronic
1096106486 12:48999293-48999315 GTGGGGGGCCGGGGTGGGGTGGG - Exonic
1096159951 12:49367691-49367713 GCGGGGGGACGGGAAGGAGGGGG + Intronic
1096180444 12:49547781-49547803 TTGGGGTCACAGGATGCAGTTGG - Intronic
1096469888 12:51869326-51869348 GTGGGGGAAGAGGAGGGAGGAGG + Intergenic
1097044574 12:56177973-56177995 ATGTGGGGACAGGAGGGAGAAGG + Intronic
1097251437 12:57634619-57634641 GTGGAGGGAGCTGATGGAGTTGG + Intergenic
1097291840 12:57923191-57923213 GTGTGGGGACAGGAGGCAGATGG + Intergenic
1098065975 12:66616616-66616638 GTGTGGGGAGAGGATGGTGGGGG + Intronic
1098101414 12:67021289-67021311 GTTGGGGGACAGGAAGAAGGAGG - Intergenic
1098208455 12:68137099-68137121 GTAGGGAGAGAGGAGGGAGTGGG + Intergenic
1098236382 12:68422370-68422392 GAGAGGGGACAGGAAGGAGGGGG - Intergenic
1098339989 12:69441754-69441776 GTGGGGGGATGGGATGGGGCAGG + Intergenic
1098444258 12:70550165-70550187 GTGGGCTGACAGGATAGTGTGGG + Intronic
1099271279 12:80513529-80513551 GTGGTGGGCCAGGGTGGTGTTGG + Intronic
1100008455 12:89922980-89923002 GTGGGGGGATGGGGTGGAATAGG - Intergenic
1100578165 12:95912469-95912491 GTGGGGGGATAGGAAGAGGTTGG + Intronic
1101398966 12:104372029-104372051 GAGGGGGGTCAGGATGGTTTTGG + Intergenic
1102577161 12:113863059-113863081 GTGGGGGGAGAGAAGGGAGGAGG + Intronic
1103229692 12:119318777-119318799 GTGGGTGGGGAGGGTGGAGTAGG + Intergenic
1103568477 12:121829088-121829110 GTGGGGTAAGAGGATGGGGTGGG + Intronic
1103725543 12:122995805-122995827 GTGGGAGGACAGAAGGGAATGGG - Intronic
1103995798 12:124829271-124829293 GATGGGGGCCAGGATGGTGTTGG - Intronic
1104176819 12:126341172-126341194 GTTGGGGAAGAGGATGGAGTGGG + Intergenic
1104647099 12:130505478-130505500 GTGGGGGGAGTGGAGGGGGTGGG - Intronic
1104647126 12:130505537-130505559 GTGGGGGGAGTGGAGGGGGTGGG - Intronic
1104647220 12:130505767-130505789 GTGGGGGGAGTGGAGGGGGTGGG - Intronic
1104749200 12:131227805-131227827 GTGGGGGGAGAGGCGGGAGTGGG + Intergenic
1104921227 12:132291793-132291815 GTGTGGGGACAGGAGGGGATGGG - Intronic
1104921463 12:132292780-132292802 GGGTGGGGAGAGGGTGGAGTCGG + Intronic
1105027509 12:132858905-132858927 GTGGGTGGAGTGGGTGGAGTGGG - Intronic
1105344302 13:19559846-19559868 GAGGGGGGAGGGGAGGGAGTGGG + Intergenic
1105535732 13:21261728-21261750 GAGGGGGGAGGGGAGGGAGTGGG - Intergenic
1105618570 13:22044927-22044949 TTGGGGGGACAGGATGGGGTTGG + Intergenic
1105722475 13:23130746-23130768 GTGGGGAGAAAGGATGGCCTGGG - Intergenic
1105947587 13:25202831-25202853 GAGGCGGGAATGGATGGAGTCGG + Intergenic
1106402530 13:29443872-29443894 GTGGGGGGACATGGGGGAGATGG + Intronic
1106862751 13:33928201-33928223 GTGAGGAGACAAGATTGAGTAGG + Intronic
1107445897 13:40470323-40470345 GTGGGGGTAGAGGCAGGAGTGGG - Intergenic
1107482414 13:40795639-40795661 CTGGGGGGACAGGATAGGGAGGG + Intronic
1107689913 13:42943311-42943333 TTGGGGGTAAAGGCTGGAGTTGG + Intronic
1109062375 13:57634069-57634091 GTGCGAGGGCAGGATAGAGTAGG - Exonic
1109784478 13:67156182-67156204 GTGGTGGGCCAGGATGGTCTTGG - Intronic
1110374533 13:74777315-74777337 GGGGAGGGAGAGGATGGTGTGGG - Intergenic
1110484320 13:76020050-76020072 GTGGCGGGACAGGGTGGTCTTGG + Intergenic
1110824458 13:79956303-79956325 GTGGGGTGGCAGGATGGGGGAGG + Intergenic
1110992380 13:82058492-82058514 ATGGGGGGAAAGGATGGGGGGGG + Intergenic
1111900004 13:94188897-94188919 GAGGGGAGAGAGGATGGATTTGG - Intronic
1112330611 13:98474549-98474571 GCGGGGACACAGGATGGAGCGGG - Intronic
1113408353 13:110062438-110062460 ATGGAAGGAGAGGATGGAGTGGG - Intergenic
1114046629 14:18881509-18881531 GACGGGGGACTGGATGGAGATGG + Intergenic
1114117582 14:19637938-19637960 GACGGGGGACTGGATGGAGATGG - Intergenic
1114277245 14:21157944-21157966 GTGGTGGGATGGGATGGGGTAGG + Intergenic
1114811178 14:25901409-25901431 GTGGGGGGACAGAAGAGAGGAGG - Intergenic
1115012990 14:28572897-28572919 GTGGGGGGACAGGGTGGTCTTGG + Intergenic
1115401269 14:32963483-32963505 GTGAGGGGAGGGAATGGAGTGGG + Intronic
1115518161 14:34206034-34206056 GTGGAGGTAAAGGATGTAGTGGG - Intronic
1116054068 14:39840751-39840773 GTGAGGGCACAGGAAGAAGTTGG + Intergenic
1116900337 14:50356524-50356546 TTGCAGGGACAGGATGGAGCTGG + Intronic
1117272356 14:54157965-54157987 GTGAGAGGGCAGGATGGATTTGG - Intergenic
1117338966 14:54777673-54777695 GTGGGGGGGTAGGCTGGAATTGG + Intronic
1117780893 14:59230602-59230624 GTGGGGGGCTTGGAGGGAGTGGG + Intronic
1117964260 14:61190628-61190650 GGTGGGAGACAGGCTGGAGTGGG - Intronic
1118425396 14:65655071-65655093 TTGGGGGGACAGCATATAGTTGG - Intronic
1118953323 14:70455084-70455106 GAAGAGGTACAGGATGGAGTTGG + Intronic
1120711263 14:87795769-87795791 GTGGGGGGAAAGGAAGGGGAGGG - Intergenic
1120800081 14:88678136-88678158 TTGTGGGGACATGATGGAGCTGG + Intronic
1120972196 14:90216857-90216879 GTGTGGGGAGAGGATGTAGAGGG - Intergenic
1121017106 14:90555533-90555555 CTGGGAGGACAGGATGGCATGGG + Intronic
1121225258 14:92317143-92317165 GTGGGAGGAGAGCATGGAGGAGG - Intergenic
1121270195 14:92632699-92632721 GTGGAGGGAGCGGCTGGAGTGGG - Intronic
1121447544 14:93988267-93988289 ATGGGAGGAAAGGATGGAGGAGG + Intergenic
1121688604 14:95858222-95858244 GTGGGAGGAGAGGAAGGAGAAGG - Intergenic
1121720450 14:96105254-96105276 GTGGGGGGTCAGCATGGGGCGGG - Intergenic
1121837167 14:97102370-97102392 GTGGGGGGGCACCATGGTGTGGG + Intergenic
1122302378 14:100738528-100738550 GTGGGTGGCCTGGATGGAGCTGG + Intergenic
1122322878 14:100866182-100866204 GTGGGTTGACAGGATGGGGTGGG + Intergenic
1123014132 14:105365525-105365547 GTGGGAGGGCAGGAAGGAATGGG - Intronic
1123440726 15:20289238-20289260 GTGGGAGGAGGGGCTGGAGTTGG + Intergenic
1124723540 15:32134112-32134134 GGGGTGGGACAGGATGGATGTGG - Intronic
1124787714 15:32697661-32697683 GTGGAGGGCCAGGAGGGAATGGG + Intergenic
1127002696 15:54528615-54528637 GTGGGGGGACAGACTGGACAAGG - Intronic
1127393016 15:58522110-58522132 GTGGGGGTACAGGACCAAGTTGG - Intronic
1127647074 15:60969561-60969583 GCTGGTGGACAGGATGGAGAAGG + Intronic
1127656985 15:61064864-61064886 GTGAAGGGACAGGGTGGAGTGGG - Intronic
1127859254 15:62979348-62979370 GTGGTGGGAAGGGGTGGAGTGGG - Intergenic
1128073278 15:64810591-64810613 GTGGAGGGACAGCAGGTAGTGGG + Intergenic
1128551612 15:68601298-68601320 AGGCGGGGACAGGATGGGGTTGG + Intronic
1128877468 15:71214247-71214269 CTGGAGGGACTGGAGGGAGTGGG - Intronic
1129441754 15:75586213-75586235 GAGGGGGCAGAGGATGCAGTGGG - Intergenic
1129663242 15:77565010-77565032 GAGGAGGGATAGGGTGGAGTGGG + Intergenic
1129741791 15:77992866-77992888 GTGGGGGGAGTGGGGGGAGTGGG - Intronic
1129741796 15:77992875-77992897 GTGGGGGGAGTGGGGGGAGTGGG - Intronic
1130046024 15:80445586-80445608 GGTGGGAGACAGGATGGAGGAGG + Intronic
1130225943 15:82058650-82058672 GGGGGAGGAGAGGGTGGAGTGGG - Intergenic
1130516007 15:84626146-84626168 GGGAGGGGGCAGGATGAAGTAGG - Intronic
1131548256 15:93333641-93333663 GTGGGGGAACAGGTAGGTGTGGG + Intergenic
1131609204 15:93943485-93943507 ATTGGGGGCCAGGATGGGGTGGG + Intergenic
1131855372 15:96587987-96588009 GTGGGGGGAGGGGAGGGAGGTGG - Intergenic
1132372041 15:101306114-101306136 GGGGGCGGACAGGGAGGAGTGGG + Intronic
1132709132 16:1258761-1258783 GAGGGGGCTCAGGATGGAGGAGG - Exonic
1132709144 16:1258798-1258820 GAGGGGGCTCAGGATGGAGGAGG - Exonic
1132709157 16:1258835-1258857 GAGGGGGCTCAGGATGGAGGAGG - Exonic
1132731367 16:1363855-1363877 GTGGGGGGACAGCTGGGAGATGG - Exonic
1132976873 16:2715466-2715488 GTGGGTGGAGGGGATGGAGGGGG + Intronic
1132989825 16:2786926-2786948 GAGGGGGGTGAGGATGGAGGAGG - Intronic
1133392708 16:5422615-5422637 GTGGAGGGACAGGGAGGAGGAGG + Intergenic
1133414249 16:5593978-5594000 GTGTGGGGGCAGGATGGGGGTGG - Intergenic
1134004248 16:10807322-10807344 GTGGGGGGCAAGGAAGGAGAGGG - Intronic
1135191424 16:20357776-20357798 GTGGGGGGTCAGGAGGGAAATGG + Intergenic
1135378447 16:21971779-21971801 GTTTGGGGACAGGATGGCATGGG + Intronic
1135992853 16:27228448-27228470 GTGGGGTGCCATGATGGATTTGG - Intronic
1136106493 16:28034072-28034094 GGGTTGGGACAGGATGGAATAGG - Intronic
1136282946 16:29224577-29224599 GAGGGAGGACAGGAAGGAGAGGG + Intergenic
1136656999 16:31715436-31715458 GAGTGGGGAAAAGATGGAGTAGG - Intronic
1136726128 16:32359152-32359174 GTGGGAGGAGGGGCTGGAGTTGG - Intergenic
1136844460 16:33565197-33565219 GTGGGAGGAGGGGCTGGAGTTGG - Intergenic
1137379751 16:47986401-47986423 GTGGGGAAGCAGGATGTAGTAGG + Intergenic
1137704803 16:50527078-50527100 GGGGTGGGTCAGGATGGAGGCGG + Intergenic
1137789313 16:51161511-51161533 GGGTGGGGACAGGATGGGGCTGG + Intergenic
1137973219 16:53006385-53006407 CTGTGGGGACAGGATTGAGCAGG - Intergenic
1138614845 16:58157192-58157214 CTGAGGGGACAGGATTGAGATGG + Intergenic
1139317747 16:66087657-66087679 GTGGTGGGGTGGGATGGAGTGGG + Intergenic
1139592929 16:67943364-67943386 CTGGGGGGACAGCAGGGAGAGGG - Intronic
1141056721 16:80823256-80823278 GTGGGAGGAAGGGATGGTGTTGG - Intergenic
1141347424 16:83260344-83260366 GTGGAGGGACAGGAATGAGTGGG + Intronic
1141347590 16:83261475-83261497 GTGGAGGGACAGGAATGAGTGGG + Intronic
1141423618 16:83932151-83932173 GTGGTGGGACAGGCTGGGGGTGG - Intronic
1142087322 16:88190478-88190500 GAGGGAGGACAGGAAGGAGAGGG + Intergenic
1142224824 16:88872272-88872294 GTGGGTGGAGAGGGTGGGGTGGG + Intergenic
1203000303 16_KI270728v1_random:158604-158626 GTGGGAGGAGGGGCTGGAGTTGG + Intergenic
1203131905 16_KI270728v1_random:1695007-1695029 GTGGGAGGAGGGGCTGGAGTTGG + Intergenic
1203154627 16_KI270728v1_random:1865496-1865518 GTGGGAGGAGGGGCTGGAGTTGG - Intergenic
1142591023 17:1006172-1006194 GTGGGGAGACAGGAAGGCGGAGG + Intronic
1142656662 17:1399425-1399447 GTGGGGGGAGAGGGGTGAGTGGG - Intronic
1143513486 17:7408127-7408149 GCGGGGGGAAAGGAGGGAGGAGG - Intronic
1143697204 17:8629977-8629999 GTGGAGGGACAGGAGGGCATTGG - Intronic
1143979377 17:10854931-10854953 GGGAGGGGAGTGGATGGAGTTGG + Intergenic
1144001022 17:11055265-11055287 GAGGGGTTACAGGATGGATTTGG + Intergenic
1145144038 17:20466450-20466472 GTGGGGAGACAGAATGGGGAGGG - Intronic
1145408334 17:22631142-22631164 GTTGTGGGACAGGAGGGAATGGG - Intergenic
1146370432 17:32262785-32262807 TTGGGGGCAGAGGAGGGAGTAGG - Intergenic
1146910202 17:36643530-36643552 GTGGGTGGAGAGGATGGTGGGGG + Intergenic
1147338176 17:39739256-39739278 GTGGGGGGACCTCATGGAGGCGG + Intronic
1147609461 17:41793114-41793136 GTGGAGGGAGAGGCTGGAGGAGG + Intergenic
1147771760 17:42872698-42872720 GTCGGCGGTCAGGAGGGAGTGGG + Intergenic
1147939240 17:44034115-44034137 GGGGGGGGACAGGAAGATGTGGG + Intergenic
1148032186 17:44628982-44629004 GTGGCAGGACAGGGTGGACTTGG - Intergenic
1148037527 17:44678827-44678849 ATGGGGGGAAAGAATAGAGTAGG + Exonic
1148079930 17:44962133-44962155 GTGAAGGGACAGGATAGAGAGGG - Intronic
1148160305 17:45445988-45446010 CTGGGAGGACAGGAAAGAGTGGG - Intronic
1148437448 17:47694756-47694778 CTGGGGGGAGGGGATGGCGTGGG + Intronic
1148699913 17:49581134-49581156 GTGAAGGAACAGGCTGGAGTGGG + Intronic
1148825187 17:50387923-50387945 GTGGGGGGACAGTATTGTGGTGG - Intronic
1148865120 17:50624310-50624332 GTGGGGGGAGAGAATGGAGCTGG - Intronic
1149866485 17:60153993-60154015 GAGTGGGGACAGGATGGGGAAGG - Intronic
1150359620 17:64519931-64519953 CACGGTGGACAGGATGGAGTAGG - Intronic
1150391597 17:64792867-64792889 CTGGGAGGACAGGAAAGAGTGGG - Intergenic
1151212451 17:72554788-72554810 CAGGGGTGACAGGATGGGGTGGG - Intergenic
1151386875 17:73760349-73760371 GTGTGGGGAGAGGATGGAGTGGG + Intergenic
1152021199 17:77781225-77781247 GTGGGGGGGCCTGCTGGAGTGGG - Intergenic
1152021308 17:77781508-77781530 GTGGGGGGGCCTGCTGGAGTGGG - Intergenic
1152021333 17:77781563-77781585 GTGGGGGGGCCTGCTGGAGTAGG - Intergenic
1152021340 17:77781581-77781603 GTGGGGGGGCCTGCTGGAGTGGG - Intergenic
1152100810 17:78300884-78300906 GTGGGGGAACAGGAAGGTGGAGG - Intergenic
1152285022 17:79407426-79407448 GGGGGAGGACAGGAAGGAGTGGG + Intronic
1152609428 17:81308309-81308331 GTGGGGGGGCACCATGGAGAGGG + Intergenic
1152624459 17:81381914-81381936 GTGAAGGGACAGGATGGAGCGGG - Intergenic
1152663486 17:81553720-81553742 CTGGGAGGACTGGATGGGGTTGG - Intronic
1152754397 17:82081135-82081157 GTGGGTGGCCAGGCGGGAGTGGG - Intronic
1153755332 18:8276821-8276843 GTTGGAGGACAGGTTGGAGCAGG + Intronic
1154166091 18:12015484-12015506 GTGGCGGGCCAGGATGGATGAGG + Intronic
1155683639 18:28520527-28520549 GTGGAGGGCCAGGGTGGTGTTGG - Intergenic
1157260395 18:46171726-46171748 GTGGAAGGCCAGGATGGAGGGGG + Intergenic
1158278204 18:55791910-55791932 GTGGGAGGGCAGGATGGGGAGGG - Intergenic
1158889755 18:61862175-61862197 TAGGGGGGTCAGGATGGAGGAGG - Intronic
1159672658 18:71241207-71241229 GTGGGAGGAGAGGAAGCAGTAGG - Intergenic
1159684215 18:71396884-71396906 GTGGGGAGAAAGTATGGACTTGG + Intergenic
1160227148 18:77020117-77020139 GTGGAGGGATATGATGGAGATGG + Intronic
1160785985 19:900511-900533 GTGTGGGGCCAGGATGGGGTAGG - Intronic
1160810589 19:1011335-1011357 GCGCGGGGGCAGGGTGGAGTGGG - Intronic
1160844207 19:1159492-1159514 GTGGGGGGACAGGGGGCAGCAGG + Intronic
1160875885 19:1295988-1296010 GTGTGGGGCCAGGGGGGAGTGGG + Intronic
1160878601 19:1309451-1309473 CTGGGGCGACTGGCTGGAGTCGG - Intergenic
1160953483 19:1678936-1678958 GTCAGGGGACAGGGTGGAGCTGG - Intergenic
1161118174 19:2511084-2511106 GAGGGTGGACGGGATGGTGTGGG + Intergenic
1161387961 19:4007085-4007107 GTGGGGAGGCAGGATGGGGGGGG + Intergenic
1161483905 19:4524677-4524699 GTGGGGGGAAAGGGGGGTGTTGG - Intronic
1161871681 19:6875340-6875362 ATGGGGGGGGAGGATGGAGGAGG + Intergenic
1162015920 19:7846433-7846455 GTGGGCAGGCAGGATGGAGTGGG + Intronic
1162345437 19:10115588-10115610 GTGGAGGGGCGGGATGGGGTCGG + Intronic
1162526286 19:11208770-11208792 GTCGGGCGACAGGATGTCGTCGG + Exonic
1162909928 19:13843066-13843088 GTTGGGGGACGGGACAGAGTTGG - Intergenic
1163124303 19:15236500-15236522 GTGGGGGGACAGGATGGAGTAGG + Exonic
1163124310 19:15236519-15236541 TAGGGGGGACAGGATGGAGTAGG + Exonic
1163252287 19:16133118-16133140 GCGGGAGGACACGAAGGAGTGGG - Exonic
1163348251 19:16758603-16758625 TTGGTGGGCCAGGGTGGAGTGGG + Intronic
1163417881 19:17197616-17197638 GTGGGGGGAAAGGAGTGGGTGGG - Intronic
1163418360 19:17200614-17200636 GAGGGGGGACAGGAAGCAGCCGG - Intronic
1163444725 19:17339600-17339622 GTGGGCGGACAGGGTGGTGATGG + Intronic
1163479764 19:17548190-17548212 GGGGGTGAACAGGATGCAGTGGG + Intronic
1165002525 19:32776706-32776728 GGTGCTGGACAGGATGGAGTAGG - Intronic
1165394133 19:35555113-35555135 GTGTGGGCACAGGAGGGAGAGGG - Intronic
1165788759 19:38478215-38478237 GTGGGGAGTCAGGATGGGGGTGG - Intronic
1165795506 19:38517008-38517030 GCGGGGAGACAGGGTGGGGTTGG + Intronic
1165901818 19:39172873-39172895 GTGGGGGCCCAGCAAGGAGTGGG - Intronic
1166347982 19:42178142-42178164 GTGGGGGGAGAGGAGGGAGGAGG + Intronic
1166761719 19:45228279-45228301 GAGGGGAGACAGGCAGGAGTTGG + Intronic
1166824206 19:45599177-45599199 GTGGGGGGACAGGAAAGACTAGG + Intronic
1167407839 19:49325295-49325317 GTGGGGAGAGAGCAGGGAGTTGG - Intergenic
1167416320 19:49374961-49374983 TCGGGGGGACAGCCTGGAGTGGG - Exonic
1167610964 19:50507569-50507591 GTGGTGGGACAGGAGGAGGTAGG - Exonic
1167695769 19:51015024-51015046 GTGGTGGGGAAGGAAGGAGTTGG + Intronic
1167765549 19:51479879-51479901 TAGTGGGGACAGGATGGGGTAGG + Intronic
1167765717 19:51480841-51480863 GTGGGAGGAGAGGGCGGAGTTGG + Intronic
1168069975 19:53943619-53943641 GGGTGGGGACAGGGTGGGGTGGG + Exonic
1168078623 19:53993516-53993538 CTGGGGGTACAGGATGGCCTGGG - Intronic
1168078650 19:53993631-53993653 GTCGGGGTACAGGATGGTCTTGG - Intronic
1168327078 19:55543971-55543993 GTGGGGGCTCAGGGTGGAGATGG + Intronic
1168471763 19:56645866-56645888 GTGGGTGGAGAGGAAGGAATTGG + Intronic
1202645114 1_KI270706v1_random:132069-132091 GTGGGGGGAGAGGATGATATTGG + Intergenic
925332652 2:3070972-3070994 GTTGGGGGAAAGGATGGCCTTGG + Intergenic
926049822 2:9737611-9737633 GTGGGGGTACTAGAGGGAGTAGG - Intergenic
926099236 2:10103467-10103489 GTGGAGGGACAGGTTGGCGTGGG - Intergenic
926302769 2:11616451-11616473 CTGAGGAGACAGGAGGGAGTGGG - Intronic
926598273 2:14814180-14814202 GTGGAGGGAAAATATGGAGTTGG + Intergenic
926994238 2:18716728-18716750 GTGGAGGGGGAGGCTGGAGTGGG - Intergenic
927129935 2:20050703-20050725 GTAGGTGGCCAGGATGGAGAGGG + Intronic
927168544 2:20350182-20350204 GTGGGTGAAGAGGAAGGAGTGGG - Intronic
927240108 2:20913843-20913865 GTTGGGGGAAGGGATGGACTAGG - Intergenic
927399013 2:22689298-22689320 TTGGGGACACAGAATGGAGTAGG - Intergenic
927700266 2:25263779-25263801 GTGGGGGAAGGGCATGGAGTGGG - Intronic
927876037 2:26655781-26655803 GCGGGGGGCCAGGGTGGAGGGGG - Intergenic
927896981 2:26789147-26789169 GTGGGGAGTCAGATTGGAGTGGG - Intronic
928321293 2:30284543-30284565 GTGGGGGCAAATGATGGAGAAGG - Intronic
929863539 2:45699146-45699168 GGAGGAGGACAGGAGGGAGTTGG - Intronic
932123322 2:69121032-69121054 GTTGGGTGATGGGATGGAGTGGG - Intronic
932297446 2:70638721-70638743 GAGGGGGGACAGGAAGCAGACGG + Intronic
932413004 2:71558358-71558380 GTGGGAGGACAGAGTGGGGTTGG + Intronic
933227151 2:79763971-79763993 GGGAGGGGAGTGGATGGAGTGGG - Intronic
934554622 2:95280887-95280909 GTGGGAGGACAGGTTGAGGTGGG - Intronic
936059291 2:109283947-109283969 GTGTGGGGACAGGAGGGAGGCGG - Intronic
936993595 2:118391204-118391226 GTGGAAGGCTAGGATGGAGTAGG + Intergenic
937319789 2:120954292-120954314 GTGGGTAGGCAGGAAGGAGTAGG + Intronic
937367189 2:121271960-121271982 GTGGGGGGAAGGAATGGAGTGGG - Intronic
940369840 2:152889051-152889073 CGGGGAGGACAGGATGCAGTGGG + Intergenic
940779738 2:157919847-157919869 GTGGGGGAACTGAATGGAATGGG - Intronic
941493760 2:166175284-166175306 TTGGAGTGACAGGATGGAATGGG + Intergenic
942341680 2:174955479-174955501 GTGAGGGGAAAGGATGGACGGGG + Intronic
943235478 2:185313237-185313259 GTTGGGGGATAGCATGGAATAGG + Intergenic
943626940 2:190211647-190211669 ATGCAGGGACAGGAGGGAGTTGG - Intronic
943735460 2:191348948-191348970 GTGGGAGACCAGGAAGGAGTAGG - Intronic
944237541 2:197453719-197453741 GTTGGGGGACCGGAAGGATTTGG + Intronic
944544038 2:200781457-200781479 GTTGAAGGGCAGGATGGAGTTGG - Intergenic
944975102 2:205040961-205040983 GTGGGGTGAAAGCATGGAGAAGG - Intronic
946061985 2:216950374-216950396 GGAGGGGGACAGGCTGGAGGGGG + Intergenic
946179961 2:217943076-217943098 GTGGGGGGAGAGGGAGGAGCAGG + Intronic
946229054 2:218280392-218280414 CTGGGGGGTCACGATGTAGTGGG + Intronic
946301411 2:218826807-218826829 TGGGGGGTACAGGATGGACTGGG - Intronic
946325136 2:218981150-218981172 GTGTGGGGACAGGAGGAAGGGGG + Exonic
946331084 2:219009687-219009709 GGGGTGGGATGGGATGGAGTGGG + Intronic
946331147 2:219009841-219009863 GGGGTGGGATGGGATGGAGTGGG + Intronic
946748755 2:222871743-222871765 GTTGGTGGCCAAGATGGAGTGGG + Intronic
946796851 2:223363482-223363504 GTTGGGGGACAGCAGGGAGGTGG + Intergenic
947418237 2:229920672-229920694 GGTGGGGGACAGGAGGGAATTGG - Intronic
948379569 2:237542902-237542924 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379579 2:237542936-237542958 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379588 2:237542970-237542992 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379599 2:237543022-237543044 GTTGGGGGACAGTAGTGAGTGGG + Intronic
948379605 2:237543040-237543062 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379689 2:237543367-237543389 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379727 2:237543507-237543529 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379746 2:237543575-237543597 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379778 2:237543697-237543719 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379797 2:237543765-237543787 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379811 2:237543817-237543839 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379820 2:237543851-237543873 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379842 2:237543937-237543959 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379861 2:237544005-237544027 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379875 2:237544057-237544079 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379885 2:237544091-237544113 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379904 2:237544160-237544182 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379914 2:237544193-237544215 GTGGGGGGACAGTGGTGAGTTGG + Intronic
948379941 2:237544296-237544318 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948379982 2:237544449-237544471 GTGGGGGGACAGTAGTGAGTGGG + Intronic
948379999 2:237544502-237544524 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948380034 2:237544647-237544669 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948380048 2:237544699-237544721 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948380058 2:237544733-237544755 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948380077 2:237544802-237544824 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948380087 2:237544835-237544857 GTGGGGGGACAGTGGTGAGTTGG + Intronic
948380114 2:237544938-237544960 GTGGGGGGACAGTGGTGAGTGGG + Intronic
948816394 2:240512417-240512439 CTGGTGGGACAGGATGGCTTCGG + Intronic
948880090 2:240852281-240852303 GTGGGGCCACAGGAAGGATTTGG - Intergenic
948895323 2:240924623-240924645 GTGGGGGGCCGGGATAGTGTGGG - Intronic
949071989 2:242030954-242030976 GTGTGGGGCCAGGCTGGGGTCGG - Intergenic
949086314 2:242158737-242158759 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1168949364 20:1786141-1786163 GAGGAGGGACAGGCTGGAGGTGG + Intergenic
1169235381 20:3926038-3926060 GTGGGTGGCCAGAATGGAGAGGG + Intronic
1169385403 20:5145036-5145058 GAAGAGGAACAGGATGGAGTAGG + Intronic
1169408933 20:5350514-5350536 CTGAGGGGACAGGGTGGAGAGGG - Intergenic
1170528281 20:17262949-17262971 GTGCAGGGACAGGAAGGAGAAGG - Intronic
1171078809 20:22156711-22156733 ACTGGGGGACAGGATGGAGGAGG - Intergenic
1171209922 20:23309290-23309312 GGAGGGAGACAGGAGGGAGTGGG - Intergenic
1171440010 20:25152673-25152695 GGGGTGGGACAGGATTGACTGGG - Intergenic
1171810411 20:29741986-29742008 GCCGGCGGAGAGGATGGAGTCGG + Intergenic
1171895075 20:30750988-30751010 GTGGGGGGAGAGGATGATATTGG + Intergenic
1171991370 20:31699069-31699091 GTAGGTGGACAAGAGGGAGTCGG + Intronic
1172267001 20:33624890-33624912 GTGGAGGGGTAGGATGGAATTGG - Exonic
1172376617 20:34447204-34447226 GCGGGGGGACAGGATGATGAAGG - Intronic
1172608103 20:36229270-36229292 GTGGGGGGAAAGGAAGGAAGAGG - Intronic
1172872933 20:38147076-38147098 GCCGGGGGACAGGAGGGAGATGG + Intronic
1172964566 20:38825273-38825295 GTGGGGAGACAGCATGCTGTTGG - Intronic
1173502888 20:43566450-43566472 CTGGGGGGACAGGGAGGAGCAGG - Exonic
1173539966 20:43843875-43843897 GTGGGTGAAGAGGAAGGAGTAGG + Intergenic
1173689883 20:44952484-44952506 GAAGGGGGACAGGAAGGGGTGGG - Intronic
1173828489 20:46062763-46062785 GTGGGGGGTGCAGATGGAGTGGG + Exonic
1174412370 20:50344313-50344335 GCTGGGGGGCAGGATGGAGTTGG + Intergenic
1175388866 20:58614002-58614024 GTGGAAGGACAGGAGGCAGTGGG - Intergenic
1175534833 20:59702288-59702310 GTGGGGAAAGAAGATGGAGTGGG - Intronic
1175780135 20:61676919-61676941 GTGGTGGGCCAGGCTGCAGTGGG + Intronic
1175988689 20:62776975-62776997 GGGGCGGGACAGGAAGGAGGGGG + Intergenic
1175988716 20:62777049-62777071 GGGGCGGGACAGGAAGGAGGGGG + Intergenic
1176079557 20:63265467-63265489 GTGGGGGGAGAGAAAGGACTGGG - Intronic
1176290581 21:5042406-5042428 CAGGGAGGACAGGCTGGAGTCGG + Intergenic
1176457560 21:6927766-6927788 GTAGGGGGCCAGGATGGTGGTGG + Intergenic
1176606780 21:8840674-8840696 GTGGGGGGAGAGGATGATATTGG - Intergenic
1177577798 21:22981817-22981839 GCGTGGGGACAGGGTGGCGTTGG - Intergenic
1178859159 21:36274685-36274707 GTGGGTGGTCAGGATGGTGAGGG + Intronic
1179866674 21:44221235-44221257 CAGGGAGGACAGGCTGGAGTCGG - Intergenic
1180224291 21:46380564-46380586 GGTGGGGGACAGAATGGATTTGG - Intronic
1180308009 22:11145473-11145495 GTGGGAGGAGGGGCTGGAGTTGG + Intergenic
1180356848 22:11850375-11850397 GTGGGGGGAGAGGATGATATTGG - Intergenic
1180381414 22:12141956-12141978 GTGGGGGGAGAGGATGATATTGG + Intergenic
1180465167 22:15604148-15604170 GACGGGGGACTGGATGGAGATGG + Intergenic
1180546485 22:16507286-16507308 GTGGGAGGAGGGGCTGGAGTTGG + Intergenic
1180831684 22:18910022-18910044 GTGGGGTGGGAGGATGGAGGAGG + Intronic
1181068166 22:20316347-20316369 GTGGGGTGGGAGGATGGAGGAGG - Intronic
1181694095 22:24584463-24584485 GGGTGAGGACAGGATGGTGTTGG - Intronic
1181831844 22:25565604-25565626 GGGAGGTGAGAGGATGGAGTTGG - Intronic
1182212704 22:28690093-28690115 GTGGGAGGAGGGGCTGGAGTTGG - Intronic
1182284123 22:29234086-29234108 GTGTTGGGGCAGGATGGAGTGGG - Intronic
1182599070 22:31445681-31445703 TTGGGGCTGCAGGATGGAGTGGG + Intronic
1183433432 22:37779785-37779807 CTGCGGGGACAGGCTGGAGCTGG + Intergenic
1183482918 22:38074829-38074851 GTCGGGGGACAGGCTGCAGTGGG - Intronic
1183718722 22:39549784-39549806 GTGGGGAGTAAGGATGGGGTAGG - Intergenic
1183726817 22:39594534-39594556 GTGAGGGGACGGGAAGGAGCAGG + Intronic
1184250713 22:43258551-43258573 GGGGTGGGACAGAATGGACTTGG + Intronic
1184599358 22:45533374-45533396 GTTGGGAAAGAGGATGGAGTTGG + Intronic
1184672405 22:46021730-46021752 GTGGTGGGAATGGCTGGAGTTGG - Intergenic
1185118022 22:48949113-48949135 ATGGGGGGGGAGGCTGGAGTAGG - Intergenic
1203281764 22_KI270734v1_random:135293-135315 GTGGGGTGGGAGGATGGAGGAGG + Intergenic
949545653 3:5069977-5069999 GTAGGGGAACAGGAGGGAGATGG + Intergenic
950083360 3:10239350-10239372 GGGAGGGGCCAGGATGGAGGAGG - Intronic
950569089 3:13788929-13788951 GTGGGTAGAGAGGGTGGAGTTGG + Intergenic
950635599 3:14312187-14312209 GTGGGGGCACACAAGGGAGTAGG + Intergenic
950641850 3:14353599-14353621 TTGGGGCCACAGGATGGATTAGG - Intergenic
951412718 3:22384287-22384309 GTGGGGGGATGGGAGGGAGGTGG + Intergenic
951609159 3:24471921-24471943 TTGTGGGGACAGGAAAGAGTAGG - Intronic
952156720 3:30651347-30651369 ATTGGGAGAGAGGATGGAGTGGG - Intronic
952564260 3:34635657-34635679 GTGGTGGGCCAGGATGGTCTTGG + Intergenic
952580200 3:34824280-34824302 GTGGGAGGCCAGGATGGTCTTGG - Intergenic
953451593 3:43010976-43010998 GTGGGTGGAGAGGGGGGAGTTGG - Intronic
953982036 3:47417938-47417960 GTGGGGGGAGAGGGTGGTGCGGG + Intronic
954464595 3:50647038-50647060 CTGGGAGAAGAGGATGGAGTAGG + Intronic
955207291 3:56907877-56907899 GTGGGAGGACAGGGAGGATTGGG + Intronic
955224229 3:57048116-57048138 GTGGTGGTGCTGGATGGAGTGGG - Intronic
955371839 3:58358516-58358538 CTTGGGATACAGGATGGAGTGGG - Intronic
955838256 3:63082397-63082419 GTAGGGGGATGGGAGGGAGTGGG - Intergenic
956406301 3:68932193-68932215 GAGGGGCGAGAGGATGGGGTGGG - Intronic
958036173 3:88172737-88172759 GTGGGGAGACATGATGAAGCTGG + Intergenic
958658729 3:97038294-97038316 GGGGGGGGAAAGGATGAAGAGGG - Intronic
959484101 3:106908262-106908284 GGGAGGGCACAGGAAGGAGTTGG + Intergenic
959513467 3:107240316-107240338 GTGGGGTGACGGGGTGGGGTGGG - Intergenic
959680194 3:109087119-109087141 TGGGGGGCAGAGGATGGAGTGGG - Intronic
960165843 3:114400523-114400545 GGGAGAGGAGAGGATGGAGTGGG - Intronic
960969042 3:123126200-123126222 GAGGGGTGGGAGGATGGAGTAGG - Intronic
961075989 3:123982435-123982457 GAGGAGGGAGAGGATGGAGAGGG + Intronic
961083375 3:124045088-124045110 GTGGGGGCACAATATTGAGTTGG + Intergenic
961391085 3:126552711-126552733 GTGGGGGGTGAGCATGGAGTGGG + Intronic
961546016 3:127633881-127633903 GTGGTGGGACAGGACAGAGATGG + Intronic
961796835 3:129415214-129415236 GTGGAGGCACAGGATGGGGAGGG + Intronic
961933041 3:130554264-130554286 GTGGCAGCACAAGATGGAGTGGG + Intergenic
962236148 3:133709333-133709355 GAAGGGGGACAGGATGGAAATGG + Intergenic
962347078 3:134626132-134626154 GTGGGAAGACAGGATGGGGGTGG + Intronic
962368033 3:134798466-134798488 GTGGGGGGAAAGGAGGGAAGAGG - Intronic
962986930 3:140544710-140544732 GGGAGGGGGCAGGGTGGAGTAGG + Intronic
963073033 3:141320632-141320654 GTGTGGGGCCAGGAGGGATTTGG + Intergenic
963559427 3:146843471-146843493 TTGGGTGCACAGTATGGAGTTGG + Intergenic
964728868 3:159843898-159843920 GTGGGAGGAGGGGAAGGAGTAGG - Intronic
965590210 3:170356071-170356093 GTGGGGGGGCGGGGTGGAGAGGG + Intergenic
965822381 3:172697663-172697685 GTGGAGGGAGAGGAGGGAGAAGG + Intronic
966218861 3:177530748-177530770 GTGGAGGGATTGGTTGGAGTTGG + Intergenic
966630012 3:182062026-182062048 GTGGTGGGTAGGGATGGAGTTGG + Intergenic
966945666 3:184775555-184775577 GTGAGGGGAGAGGAGGCAGTGGG - Intergenic
967937512 3:194740815-194740837 GGGCGTGGACAGGATGTAGTGGG - Intergenic
968449705 4:669379-669401 GTAGGGGGATAGCATGGGGTAGG - Intronic
968449804 4:669755-669777 GTAGGGGGATAGCATGGGGTAGG - Intronic
968530029 4:1086724-1086746 TTGGGGAGAGAGGATGGGGTAGG + Intronic
968530091 4:1086895-1086917 GTGGGGTGAGAGCATGGGGTGGG + Intronic
968530301 4:1087504-1087526 GGGGGGTGACAGGATGAGGTGGG + Intronic
968729829 4:2264467-2264489 CTGGGGGAGCAGGAAGGAGTTGG + Intergenic
969315353 4:6378408-6378430 GTTGGTGGACAGGAGTGAGTGGG + Exonic
969425517 4:7121827-7121849 GTGGGGGGTCGGGAGGGAGGTGG - Intergenic
969525209 4:7700794-7700816 GTGGGGTCGCAGGCTGGAGTGGG - Intronic
971403888 4:26302410-26302432 GAGAGGGGAAAGAATGGAGTTGG - Intronic
971437013 4:26638232-26638254 GTTGTTGGACAGGATGTAGTAGG + Intronic
972446613 4:39150408-39150430 GTGGGGGCAGGGGATGGAGAGGG + Intergenic
972697493 4:41462167-41462189 GTGTGGGGATACGATGGATTTGG + Intronic
973134459 4:46689281-46689303 GTGGTGGGTCAGGATGGTCTTGG - Intergenic
973371331 4:49250483-49250505 GTGGGGGGAGAGGATGATATTGG + Intergenic
973389673 4:49544828-49544850 GTGGGGGGAGAGGATGATATTGG - Intergenic
975460834 4:74651228-74651250 GGGAGGGGAGAGGATGGAATGGG + Intergenic
976379176 4:84379707-84379729 GTGGGGGGAGAGGGAGGAGCAGG + Intergenic
976510041 4:85897923-85897945 GTGGGAGGTAAGGATGGAGCTGG + Intronic
976832948 4:89335696-89335718 GTGGAGGGAAGGGAGGGAGTGGG - Intergenic
979238034 4:118423720-118423742 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
979267093 4:118716391-118716413 GGGGGTGGACAGGATGGTGGAGG + Intergenic
980485383 4:133450857-133450879 GTGGTGGGCCAGGATGGTCTTGG - Intergenic
980982614 4:139667473-139667495 GTTAGGGGGCTGGATGGAGTGGG + Intronic
982260308 4:153488617-153488639 CTGAGGGGGCTGGATGGAGTAGG + Intronic
983984557 4:174042351-174042373 CTGGGGGAAGAGGATGGAGGAGG + Intergenic
984236093 4:177160251-177160273 GTGGGGTGGCAGGATGTACTTGG - Intergenic
984714397 4:182913265-182913287 GTGGGAAGAGAGGATGGAGTTGG - Intronic
985271421 4:188197593-188197615 GAGGGGGAAGGGGATGGAGTGGG - Intergenic
985508099 5:296289-296311 GTGTGGGGCCAGGCTGGGGTGGG - Intronic
985662548 5:1164331-1164353 GTGGGTGGGAAGGATGGTGTGGG + Intergenic
985739937 5:1609380-1609402 GTGTGGGGCCAGGCTGGGGTGGG + Intergenic
985817426 5:2137129-2137151 GTGGGTGGACAGAAGTGAGTAGG + Intergenic
985882891 5:2653936-2653958 CTGTGGGGACAGGATCCAGTAGG - Intergenic
986548579 5:8926834-8926856 GTGGGGGGTCAGGAGGAAGTAGG + Intergenic
988168151 5:27620518-27620540 GTGTGGGGAGAGGATGGTTTTGG - Intergenic
989623835 5:43410678-43410700 CTGTGGGGACAGGTGGGAGTAGG + Intronic
989666684 5:43862596-43862618 GTGAGGTGGCAGGATGGGGTGGG + Intergenic
989825345 5:45848110-45848132 GTGGGGGGAGGGGCTTGAGTAGG + Intergenic
991217441 5:64171829-64171851 GTGGGGGGGCGGGGTGGAGAAGG - Intronic
991645454 5:68796402-68796424 GTGGGGGGACAGCCTGCAGAGGG - Intergenic
992234118 5:74691243-74691265 GTGGGAGGACATGTTGGAGGAGG + Intronic
992905011 5:81337314-81337336 CTGGTGGAACAAGATGGAGTGGG + Intronic
993023340 5:82618177-82618199 GTGGGGTGAGGGGATGGAGGAGG + Intergenic
993188991 5:84656936-84656958 GTGGGGAGGGAGGATGGTGTGGG + Intergenic
993472487 5:88322908-88322930 GTTGGGGGAGAGGATGGAACAGG - Intergenic
995919788 5:117297865-117297887 GTTGGGGGAAGGGATGGATTAGG - Intergenic
996277518 5:121685211-121685233 GTTGGGGGATAGGGAGGAGTGGG - Intergenic
996412008 5:123168867-123168889 GTGTGGGCACAGAAAGGAGTAGG - Intronic
996700466 5:126445626-126445648 GTGGGGGGTGAGGAGGGGGTGGG + Intronic
997199293 5:132000014-132000036 GGGGGGTGACAGGAAGTAGTGGG + Intronic
997425682 5:133801154-133801176 GTGTGGGGTCAGGATGGACCAGG - Intergenic
997614501 5:135237188-135237210 GTTGGGGGACAGGCTGGGGTGGG + Intronic
998890845 5:146744197-146744219 GTGGGGGCAGGGGATGGTGTGGG - Intronic
999671269 5:153960744-153960766 GTGGGAGGACAGGATGTGGTGGG - Intergenic
999716334 5:154363688-154363710 GTGGGGAGAGAGGTTTGAGTGGG + Intronic
999924349 5:156358896-156358918 GTGGGGAGACAGGTGGGAGAGGG + Intronic
1001632429 5:173185747-173185769 GTTGGGGGAAAGGGTGAAGTGGG + Intergenic
1002061339 5:176627665-176627687 GTGGGGGAAGAGGCTGGTGTGGG + Intronic
1002061883 5:176630205-176630227 CTGGGGCGACAGGAGGGAGCTGG - Intronic
1002276038 5:178104919-178104941 TTGGGGGGACAGGATGATTTGGG + Intergenic
1002638689 5:180620314-180620336 GGGAGGGGACAGGGAGGAGTGGG + Intronic
1002738465 5:181415691-181415713 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1002791500 6:440912-440934 GGGAGGGGATGGGATGGAGTAGG - Intergenic
1002844868 6:937330-937352 GTAGGGGGAGGGGATGGGGTGGG - Intergenic
1004512227 6:16292293-16292315 GTGGGGGGATTGGGGGGAGTGGG + Intronic
1004881703 6:20014820-20014842 GTGGGGGGACAGGGAGGAAAGGG - Intergenic
1004884280 6:20036791-20036813 ATGGGAGGACAGGTTGGAGGAGG - Intergenic
1005102787 6:22191360-22191382 ATGTGGGGACAGGCTGGTGTGGG + Intergenic
1005939908 6:30553139-30553161 GGCGGGGGAGAGGATGGACTCGG - Exonic
1006009806 6:31032776-31032798 GAGGAGGGAAAAGATGGAGTTGG + Intronic
1007022723 6:38538379-38538401 GTGGGGGGAGTGGGAGGAGTAGG + Intronic
1007171579 6:39867844-39867866 GTGAGGGGCCAGGCTGGAGGTGG + Intronic
1007178909 6:39914580-39914602 GGAGGGGGCCAGGATGCAGTAGG - Intronic
1007304587 6:40893989-40894011 GTGGGGGCCCAGGAGGGAATGGG + Intergenic
1007393285 6:41562805-41562827 ATGGGGAGACAGGAGGGAGGGGG - Intronic
1008807558 6:55450286-55450308 ATGGGAGGACAGGATAGAGCTGG + Intronic
1011821831 6:91262109-91262131 GAGAGGGGACAAGAGGGAGTAGG + Intergenic
1012755511 6:103225388-103225410 GTGGGGTGGCGGGATGGAGGAGG + Intergenic
1013189386 6:107789384-107789406 GTGGGGAGGCAGGATGGGCTGGG - Intronic
1013459422 6:110360397-110360419 CTGGGGGTGGAGGATGGAGTGGG + Intergenic
1015043857 6:128755543-128755565 GTGGGGTGGCAGGATGGGGGAGG + Intergenic
1015110347 6:129585844-129585866 GTGTGGGCACAGGTTGGAATTGG - Intronic
1015717401 6:136206669-136206691 GTGGTGGTACAGGAGGGGGTGGG + Intergenic
1016232910 6:141827935-141827957 ATGGAGGGACAGGATGGATCTGG - Intergenic
1016979019 6:149837286-149837308 GTGGCTGGAAGGGATGGAGTTGG - Intronic
1017554769 6:155551190-155551212 GTGAGCAGACAGGATGCAGTTGG + Intergenic
1018839590 6:167508248-167508270 GAGAGGGGACAGGAAGGAGAGGG - Intergenic
1018839805 6:167508836-167508858 GGGAGGGGACAGGAAGGAGACGG - Intergenic
1019243568 6:170691244-170691266 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1019964879 7:4490683-4490705 GTGGGTGGTCAGGATGGAAAAGG - Intergenic
1020179794 7:5913520-5913542 GTGGGGGAACAGGAAGGAGCGGG + Intronic
1020303142 7:6811364-6811386 GTGGGGGAACAGGAAGGAGCGGG - Intronic
1021633202 7:22665870-22665892 GTCTGGGGACAGGGTGGAGGGGG + Intergenic
1022526822 7:31043293-31043315 GTGAGGGGCCAGGATGGCGGTGG - Intergenic
1022626799 7:32045059-32045081 GTGGGGGGAAGGGAGGGGGTGGG - Intronic
1022694674 7:32692568-32692590 GAGGGGGAACAGGATTGGGTGGG + Intergenic
1023224079 7:37950891-37950913 GTGCAGGGACAGGGTGGAGTAGG - Exonic
1023848271 7:44135526-44135548 GTGGGTGGACAACATGGAGCTGG + Intergenic
1024550900 7:50561662-50561684 GTGGGGGGAGGGGGTGGAGGTGG - Intronic
1024615673 7:51109503-51109525 GTGGGGGGCAAGGAGGGAGATGG - Intronic
1025210565 7:57017733-57017755 GTCGGGGGACACCATGGGGTGGG - Intergenic
1025661391 7:63559114-63559136 GTCGGGGGACACCATGGGGTGGG + Intergenic
1025855309 7:65271298-65271320 GTGGTGGGAGAAGATGGGGTGGG - Intergenic
1026306041 7:69142857-69142879 GTGGGGTCACAGGGTGGGGTTGG - Intergenic
1026344848 7:69465178-69465200 GTGGGGGGGCGGGGTGGGGTCGG - Intergenic
1026787379 7:73310368-73310390 GTGGGGATATAGGATGGAGGGGG + Intergenic
1026828470 7:73597605-73597627 GTGGGGGTACAGGAGGGGGTGGG + Exonic
1027249554 7:76390378-76390400 GTGGGGGGACAGGGCTGGGTTGG + Intronic
1028923576 7:96332761-96332783 TTGGAGGGGCAGGATGGAGTAGG + Intergenic
1029327443 7:99822416-99822438 ATGGAGGGACAGGGTGGACTTGG - Intergenic
1029344207 7:99966863-99966885 GTGGGGGGACAGACAGGAGGTGG - Exonic
1029347290 7:99987659-99987681 GTGGGGGGACAGACAGGAGGTGG + Intergenic
1029503582 7:100949118-100949140 TGCGGGGGACAGGATGGAGCAGG + Intergenic
1029732357 7:102446821-102446843 GTGGGGGGCCAGGCTGGCGCCGG - Exonic
1031067327 7:117119091-117119113 GGGGCGGGGCAGGAAGGAGTGGG - Intronic
1032479504 7:132235185-132235207 GTGGGAGCAGAGGCTGGAGTTGG - Intronic
1033088190 7:138361603-138361625 GTGGGGTGAAAGGATGGAGATGG - Intergenic
1033895149 7:146059351-146059373 GTGTTGGGATAGGCTGGAGTGGG + Intergenic
1034425247 7:151010574-151010596 CTGGCGGGGCAGGATGCAGTGGG - Intronic
1034433106 7:151050733-151050755 GTGGGGGGACAGGGTTAAGGAGG - Intronic
1034980331 7:155471690-155471712 GTGGGGGGAAGGGATGGGGTGGG - Intergenic
1034994928 7:155571313-155571335 GGGTGGGGACAGGACGGGGTGGG - Intergenic
1035122375 7:156579249-156579271 GTGGGGGGGCGGGGGGGAGTGGG + Intergenic
1035375170 7:158402796-158402818 GTGGAGGGACAGGGTGGTGGGGG + Intronic
1035504554 8:116914-116936 GTGGAGGGACAGAAAGAAGTGGG + Intergenic
1035728461 8:1839159-1839181 GTGTGGGGACAGTCTGGTGTGGG + Intronic
1035767691 8:2120002-2120024 GTGGGGGGAGTGGCAGGAGTGGG + Intronic
1036065727 8:5379652-5379674 GTTGGAGGACAGGATGGGATGGG + Intergenic
1036481292 8:9141856-9141878 GTGGGGGGACGAGATGCGGTGGG + Intronic
1037829130 8:22177807-22177829 GTGGGGGGAGAGGAGGGGGTGGG - Intronic
1037831838 8:22194420-22194442 GTGGGGACACAGGATGGGGTGGG - Intronic
1037948633 8:23004731-23004753 GGGGTGGGACAGGATGGGTTGGG + Intronic
1038436951 8:27542992-27543014 GGGGGGGGAGAGGATGGGATGGG - Intronic
1038443196 8:27585913-27585935 GTGTGGGGACAGGGTGGAAGAGG - Intergenic
1039617281 8:38966210-38966232 TTGGGGTGACAGGAAGGGGTAGG + Intronic
1039876292 8:41589356-41589378 GTGGCGGGATGGGATGGGGTGGG + Intronic
1042467665 8:69146600-69146622 GTGGTGGGACAGGGTGGACATGG + Intergenic
1042483897 8:69331253-69331275 GTGTGGGGTCAGGCTGGGGTGGG - Intergenic
1042741105 8:72048043-72048065 GGGGGTGGACAGGATGGTGGGGG + Intronic
1043526765 8:81105706-81105728 TTGGGGTGAAAGGATGGCGTAGG + Intronic
1043609983 8:82050450-82050472 GTGGGGAGACATGATTCAGTAGG + Intergenic
1044307674 8:90656810-90656832 GTGGAAGGAAAGTATGGAGTGGG + Intronic
1044562441 8:93626568-93626590 GGGGGGTGACAGGACGGAGTGGG - Intergenic
1044591580 8:93917712-93917734 GGGGGGGAAGAGGATGGAGGAGG - Intronic
1044717339 8:95112700-95112722 ATGGAGGGACAGGAGGGAGCAGG - Intronic
1045583140 8:103500516-103500538 GTGGGGTGACTGGAGGGAGCAGG - Intergenic
1046495620 8:115010206-115010228 GTGGAGGGAAAGTGTGGAGTTGG - Intergenic
1046685517 8:117221710-117221732 GGTAGGGGACAGGAAGGAGTGGG + Intergenic
1047067332 8:121299953-121299975 GAGGAGGGATAGGATAGAGTGGG + Intergenic
1047362537 8:124182335-124182357 TTGGGGGGAGAGGGTGGGGTGGG + Intergenic
1047869655 8:129068694-129068716 CTGAGGGAATAGGATGGAGTAGG + Intergenic
1048060360 8:130913321-130913343 GTGGGGGGTTAGGAGGGAGGTGG - Intronic
1048213855 8:132479164-132479186 GAGGGGGGAGAGGATGGTGGGGG - Intronic
1048250985 8:132866745-132866767 GTGGGGGAACAGAACGGGGTGGG - Intergenic
1048268223 8:133005946-133005968 GTGCAGGGAGAAGATGGAGTAGG - Intronic
1048353234 8:133632775-133632797 GTTGGGGGACAGGACTGAGTTGG + Intergenic
1049203334 8:141352154-141352176 GTGGGGGGTCAGGATGTAGGGGG + Intergenic
1049404938 8:142448109-142448131 ATGGGAGGACAGGGTGGGGTGGG + Intergenic
1049421264 8:142517639-142517661 GTGGAGGGACAGGTGGGTGTGGG + Intronic
1049647540 8:143742361-143742383 GGGGGAGGTCAGGCTGGAGTTGG + Intergenic
1049708211 8:144052391-144052413 CTGGGTGGGCAGGCTGGAGTAGG - Intronic
1050096250 9:2069929-2069951 CTGGGGGGGAAGGAGGGAGTGGG - Intronic
1051893537 9:21966418-21966440 GTGGCGGGACAGGGTGGTCTTGG - Intronic
1051930475 9:22379348-22379370 GTTGGTGGACAGCAGGGAGTGGG + Intergenic
1052367428 9:27628494-27628516 CTGGGTGGAGGGGATGGAGTGGG + Intergenic
1053156218 9:35781413-35781435 GTGGGGGGGCAGGCAGGAGGGGG + Intergenic
1053352445 9:37422663-37422685 GGGCGGGGCCAGGCTGGAGTGGG - Exonic
1053670807 9:40359337-40359359 GTGGGGGAGCAGGATGGAGATGG - Intergenic
1054353574 9:64041779-64041801 GTGGGGGGAGAGGATGATATTGG - Intergenic
1054381930 9:64499399-64499421 GTCGGGGAGCAGGATGGAGATGG - Intergenic
1054513806 9:66016964-66016986 GTGGGGGAGCAGGATGGAGATGG + Intergenic
1054981248 9:71209365-71209387 GTGGGGGGAGAAGAGGGGGTAGG + Intronic
1055168309 9:73223623-73223645 GTGGGTGGTCAGGCTGGAGGTGG - Intergenic
1055480288 9:76702931-76702953 GTGGGGGGAATGGAAGGAGTAGG - Intronic
1056552006 9:87659980-87660002 GCGTGGTGACAGGAAGGAGTGGG + Intronic
1056808368 9:89745637-89745659 GTGGGGGGCCTGGGTGGAGCCGG + Intergenic
1057350764 9:94295552-94295574 AGGGGAGGACAGGAAGGAGTGGG - Intronic
1057702737 9:97375587-97375609 CTGGTGAGACAGGGTGGAGTGGG + Exonic
1057839544 9:98474664-98474686 GTGAGAGGACAGGAGGGTGTAGG + Intronic
1058204617 9:102087730-102087752 ATGTGGGTACAGGAGGGAGTGGG + Intergenic
1058826256 9:108778358-108778380 GTGGGAGCACAGGATTGGGTGGG + Intergenic
1059123211 9:111661304-111661326 GTGGGACGCGAGGATGGAGTGGG - Intronic
1060760097 9:126239758-126239780 TTGGGTGGACAGGATGGAGGTGG + Intergenic
1060919420 9:127409420-127409442 GTGGGGGGAGATGATGAGGTGGG + Intergenic
1060919433 9:127409452-127409474 GTGGGGGGAGCTGATGGGGTGGG + Intergenic
1061043650 9:128153159-128153181 GTGGGAGGCCAGGGTGCAGTGGG + Intronic
1061055092 9:128218338-128218360 GACGGGGGAGAGGCTGGAGTGGG - Intronic
1061231786 9:129319737-129319759 GTGGGGGTGCAGGGTGGGGTGGG + Intergenic
1061672621 9:132197612-132197634 GTGGGAGGGCAGGTTGGGGTTGG + Intronic
1061839194 9:133347886-133347908 GTGGGGGGTGGGGATGGAGGGGG - Intronic
1062048496 9:134435382-134435404 GTGGGGGGGCGGGAGGGAGGGGG - Intronic
1062097819 9:134711998-134712020 GGAGGGGGACAGGAAGGAGGGGG - Intronic
1062097861 9:134712117-134712139 GAGGGGGAACAGGAAGGAGGGGG - Intronic
1062097920 9:134712296-134712318 GAGGGGGGACAGGAAGAAGGGGG - Intronic
1062097926 9:134712312-134712334 GGAGGGGGACAGGAAGGAGGGGG - Intronic
1062097959 9:134712418-134712440 GAGGGGGAACAGGAAGGAGTAGG - Intronic
1062098024 9:134712634-134712656 GAGGGGGAACAGGAAGGAGGGGG - Intronic
1062314168 9:135957606-135957628 GGGGAGGAGCAGGATGGAGTGGG - Intronic
1062354186 9:136154132-136154154 CTGGGGGGACAGGAAAGACTGGG - Intergenic
1062591720 9:137277485-137277507 GTGGGGGCACAGCATGCAGCAGG + Intergenic
1203695760 Un_GL000214v1:95425-95447 GTGGGGGGAGAGGATGATATTGG + Intergenic
1203702103 Un_KI270742v1:5478-5500 GTGGGGGGAGAGGATGATATTGG - Intergenic
1203603757 Un_KI270748v1:40467-40489 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1203640513 Un_KI270751v1:8638-8660 GTGGGGGGAGAGGATGATATTGG - Intergenic
1185577560 X:1185896-1185918 TTTGGGGGGCAGGATGGAGGGGG + Intergenic
1186877381 X:13829595-13829617 GGGGTGGGACCGGGTGGAGTGGG - Intronic
1187194572 X:17070858-17070880 GTGGAGGGAGAGGAAGGAGTTGG + Intronic
1188860123 X:35245150-35245172 GAGAGGGCACAGGAAGGAGTCGG - Intergenic
1188882277 X:35503654-35503676 GTGGGTGGAGTGGAGGGAGTGGG + Intergenic
1188977340 X:36691165-36691187 TAGGAGGGACAGGCTGGAGTTGG - Intergenic
1189194924 X:39144840-39144862 GTGTGGAGAGGGGATGGAGTGGG + Intergenic
1189857479 X:45237864-45237886 GTGGGAAGAGAGGATGGTGTTGG - Intergenic
1190490152 X:50973832-50973854 GTGGGGTCACAGTATGGAGTGGG + Intergenic
1192363541 X:70453692-70453714 GTAGGAGGAGAGGATGGAGAAGG + Exonic
1192436388 X:71145937-71145959 GAGGTGGGGCAGGAGGGAGTGGG - Intronic
1194463935 X:94208331-94208353 GTGGTGGGCCAGGATGGTCTTGG - Intergenic
1194746239 X:97631374-97631396 GTAGAGGGTCAGGAAGGAGTAGG + Intergenic
1195550167 X:106160185-106160207 GTGTGGGAACAGGGTGGAGAGGG - Intergenic
1195926581 X:110031759-110031781 GTAGGGGGAAAGGAGGGATTAGG - Intronic
1197034202 X:121854443-121854465 GTGGCTGATCAGGATGGAGTTGG - Intergenic
1197747198 X:129939629-129939651 GTGGGGCGGCAGGGTGGAGGGGG - Intergenic
1198119743 X:133580051-133580073 GTTGGAGCATAGGATGGAGTAGG + Intronic
1198321331 X:135521334-135521356 GTGGGGGGACAGGCGGGAAGCGG + Intronic
1199106262 X:143872881-143872903 GTGGGGGAAGATGGTGGAGTAGG + Intergenic
1199527694 X:148810876-148810898 GAGGGGGATCAGGAGGGAGTTGG - Intronic
1199600116 X:149536820-149536842 GTGGGGGGGCAGGGTAGGGTAGG + Intergenic
1199607230 X:149586559-149586581 GGGGGGGGTGAGGATGGAGGTGG + Intronic
1199631893 X:149782808-149782830 GGGGGGGGTGAGGATGGAGGTGG - Intronic
1199650467 X:149943120-149943142 GTGGGGGGGCAGGGTAGGGTAGG - Intergenic
1201140458 Y:11023264-11023286 GGGGGGGGAGGGGATGGAGTGGG - Intergenic
1201511071 Y:14763789-14763811 CTGGCTGGACAGGATGGATTGGG - Intronic
1201984681 Y:19952892-19952914 GTGGGGTGGCAGGATGGGGGAGG + Intergenic
1202093690 Y:21221398-21221420 GTAGTAGGACAGGAAGGAGTGGG + Intergenic
1202385817 Y:24325519-24325541 GTGGAGGGACAGAAAGAAGTGGG - Intergenic
1202484969 Y:25344609-25344631 GTGGAGGGACAGAAAGAAGTGGG + Intergenic