ID: 1163125135

View in Genome Browser
Species Human (GRCh38)
Location 19:15240452-15240474
Sequence TGCAATCATCCAGGTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 156}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163125135_1163125143 0 Left 1163125135 19:15240452-15240474 CCTGGCCCACCTGGATGATTGCA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1163125143 19:15240475-15240497 GGGGGTGCAAGACCCAGTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 209
1163125135_1163125152 17 Left 1163125135 19:15240452-15240474 CCTGGCCCACCTGGATGATTGCA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1163125152 19:15240492-15240514 TCCTGGGGGTGGGGATGCTCAGG 0: 1
1: 0
2: 2
3: 36
4: 490
1163125135_1163125146 3 Left 1163125135 19:15240452-15240474 CCTGGCCCACCTGGATGATTGCA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1163125146 19:15240478-15240500 GGTGCAAGACCCAGTCCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 211
1163125135_1163125144 1 Left 1163125135 19:15240452-15240474 CCTGGCCCACCTGGATGATTGCA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1163125144 19:15240476-15240498 GGGGTGCAAGACCCAGTCCTGGG 0: 1
1: 0
2: 3
3: 103
4: 1191
1163125135_1163125149 8 Left 1163125135 19:15240452-15240474 CCTGGCCCACCTGGATGATTGCA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1163125149 19:15240483-15240505 AAGACCCAGTCCTGGGGGTGGGG 0: 1
1: 0
2: 3
3: 59
4: 670
1163125135_1163125147 6 Left 1163125135 19:15240452-15240474 CCTGGCCCACCTGGATGATTGCA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1163125147 19:15240481-15240503 GCAAGACCCAGTCCTGGGGGTGG 0: 1
1: 0
2: 1
3: 48
4: 369
1163125135_1163125145 2 Left 1163125135 19:15240452-15240474 CCTGGCCCACCTGGATGATTGCA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1163125145 19:15240477-15240499 GGGTGCAAGACCCAGTCCTGGGG 0: 1
1: 0
2: 1
3: 17
4: 232
1163125135_1163125148 7 Left 1163125135 19:15240452-15240474 CCTGGCCCACCTGGATGATTGCA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1163125148 19:15240482-15240504 CAAGACCCAGTCCTGGGGGTGGG 0: 1
1: 0
2: 3
3: 32
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163125135 Original CRISPR TGCAATCATCCAGGTGGGCC AGG (reversed) Intronic
900969264 1:5980466-5980488 TCCAATCATGCAGGGAGGCCAGG + Intronic
901514147 1:9733936-9733958 TGCAGCCACGCAGGTGGGCCAGG - Intronic
904395630 1:30219617-30219639 TGCAATCATCCAGGAGAGAGGGG + Intergenic
905500781 1:38434563-38434585 TGCATGCATCAAGCTGGGCCAGG - Intergenic
905973903 1:42162002-42162024 TGCAATTATCCATGTGGGTCTGG + Intergenic
907150574 1:52283106-52283128 TGAAATCATCCAGGTCCTCCAGG + Intronic
909798604 1:79776765-79776787 AGAAATCATCTAGGAGGGCCAGG - Intergenic
909987915 1:82185174-82185196 TGGAATGATCCAGTTTGGCCGGG + Intergenic
910041032 1:82851876-82851898 GGCCATCATCCCAGTGGGCCTGG - Intergenic
910131587 1:83914169-83914191 TGAAATGATACAGGTGAGCCTGG - Intronic
910819373 1:91329384-91329406 AGAAATCATCCAGGCGGCCCTGG - Intronic
914394060 1:147247954-147247976 CTGAATTATCCAGGTGGGCCTGG - Intronic
914878853 1:151532446-151532468 TATAATCCTCCAGCTGGGCCTGG - Exonic
919286465 1:195567758-195567780 TGCAATGATCAATGTGGCCCTGG + Intergenic
919782353 1:201229096-201229118 TGCAATCAACTATGTAGGCCTGG - Intergenic
922482217 1:225946793-225946815 AGGAATCATCCAGAAGGGCCAGG - Intergenic
924777458 1:247119882-247119904 CGCGAGCATCGAGGTGGGCCTGG + Intergenic
1063087845 10:2835751-2835773 TGCAATCCTCCAGAGAGGCCCGG + Intergenic
1064989407 10:21243045-21243067 TGCATTCCTTCAGGTGGGCATGG - Intergenic
1065224225 10:23526647-23526669 TATAAACATCCACGTGGGCCAGG + Intergenic
1067439661 10:46301487-46301509 TGACATCAGCCAGCTGGGCCTGG - Intronic
1069280532 10:66649633-66649655 TCCTAGAATCCAGGTGGGCCTGG - Intronic
1070690197 10:78518630-78518652 TGCAATGTGCCAGGTGGTCCTGG + Intergenic
1071944234 10:90623605-90623627 TGTAATTGTCCAGGTGGGCCTGG - Intergenic
1072092749 10:92145336-92145358 AAGAATCATCCAGGTGGGCATGG + Intronic
1075018055 10:118925495-118925517 ACCAATCATCCAGGTTTGCCTGG - Intergenic
1075266072 10:121000432-121000454 TGCCATCATCCAGGAGGGAGTGG + Intergenic
1076536587 10:131181681-131181703 TGCAGTGGGCCAGGTGGGCCAGG + Intronic
1076769786 10:132656662-132656684 TGCAGCCAGCCAGCTGGGCCAGG + Intronic
1083214950 11:61212666-61212688 GGCAAACAACCAGGTCGGCCTGG + Exonic
1083217834 11:61231495-61231517 GGCAAACAACCAGGTCGGCCTGG + Exonic
1083220825 11:61251245-61251267 GGCAAACAACCAGGTCGGCCTGG + Exonic
1083313177 11:61796369-61796391 AGAAATCATCCAGGCGGCCCTGG - Exonic
1084576259 11:69989741-69989763 TGCAATAATCCAGGTGCACGAGG + Intergenic
1086135148 11:83437363-83437385 TGCAAACAGCCAGGTATGCCTGG - Intergenic
1092064608 12:5579523-5579545 TGCAATGGTCCAGGTAGGGCTGG - Intronic
1093045985 12:14445282-14445304 TCAAATCATATAGGTGGGCCAGG - Intronic
1094400013 12:30052550-30052572 TGCAGTAATCCAGGTGAGACAGG + Intergenic
1096743343 12:53710297-53710319 AGAAGTCATCCAGGTGGGGCTGG + Intronic
1101497430 12:105267978-105268000 TGCAATCATCCAGGTTCATCTGG + Intronic
1101572877 12:105971222-105971244 CGCCATCATCCAGGTGGGGGAGG + Intergenic
1102581567 12:113891530-113891552 TGGAATCGTCCAGGTGGACAGGG + Intronic
1103550061 12:121730291-121730313 TGCCATGATACAGGTGAGCCTGG + Intronic
1103614056 12:122141174-122141196 TGCAGGCAGCCAGGTGGGGCCGG + Intronic
1104902945 12:132198977-132198999 TGCTACCTTCCAGGTGGGGCGGG + Intronic
1105721186 13:23116289-23116311 TGCAATGGTCCAGGTGGGAGGGG - Intergenic
1107051873 13:36059441-36059463 TGAAATCATCACAGTGGGCCTGG + Intronic
1107880830 13:44830597-44830619 TGCAATAATCCAGGAGAGACAGG - Intergenic
1107992680 13:45832091-45832113 TGCAGCCACCCAGGTGGGCAAGG + Intronic
1109875248 13:68394342-68394364 TGGAATCATCCAGGCAGGGCAGG + Intergenic
1112238263 13:97655861-97655883 TAAAATCATCCAGGTGAGTCTGG - Intergenic
1113943314 13:114029618-114029640 TGGCGTCATCCTGGTGGGCCAGG + Intronic
1114587370 14:23826847-23826869 AGGAATCTTCCAGGAGGGCCTGG + Intergenic
1117448329 14:55826560-55826582 TGCATACATCCAGGTTTGCCCGG - Intergenic
1120847315 14:89138082-89138104 TGCAAACATCCAGGTCGTGCAGG - Intronic
1122597266 14:102902343-102902365 TGCCACCATCCAGGTGGGAGGGG + Intronic
1122629566 14:103101341-103101363 TGCAATTGTCCAGCTGGGCATGG - Intronic
1123931220 15:25172589-25172611 TGCAAACATCCAGCAGGACCTGG - Intergenic
1124869043 15:33522397-33522419 AGAAATCTTCCAAGTGGGCCTGG - Intronic
1125506371 15:40270044-40270066 GGCACCCATCCAGGTGGGTCGGG - Intronic
1125710695 15:41783378-41783400 TGTCATCATCCAGGTCAGCCTGG - Intronic
1130959161 15:88648373-88648395 TCCAAAAATCCAGGAGGGCCAGG - Intronic
1133882347 16:9794742-9794764 TAAAAGCATCCAGATGGGCCAGG - Intronic
1138657646 16:58500284-58500306 TGCGGGCATCAAGGTGGGCCGGG + Intronic
1139373432 16:66481953-66481975 TGCAAACACCCACGTGGGCAAGG - Intronic
1141273487 16:82562322-82562344 TACAATCAGCCATGTAGGCCAGG + Intergenic
1141990285 16:87605358-87605380 TGCTATGAGCCAGGTGTGCCAGG + Intronic
1143825073 17:9598892-9598914 TGCTTTCATCCAGGTGAGGCAGG - Intronic
1144119350 17:12135377-12135399 AGAAATTAGCCAGGTGGGCCAGG - Intronic
1144930432 17:18854734-18854756 TGCAAACATCCAAGTGGGCAAGG + Intronic
1147950595 17:44105607-44105629 GGCAAGCAGCCAGGTGGGCAGGG - Intronic
1148537746 17:48455002-48455024 TGCCATCTGCCAGTTGGGCCAGG - Intergenic
1152419982 17:80187545-80187567 TGCAATGGTCCAGCTGGGCTGGG - Intronic
1156127223 18:33920950-33920972 TGCAGTCGGCCAGGTGGGACAGG + Intronic
1158308997 18:56138979-56139001 TACAATATTCCAGGTGGGACAGG + Intergenic
1161228189 19:3157676-3157698 TTCAACCAGCCAGGTGGGACAGG - Intronic
1161973492 19:7596412-7596434 TCCAAGCCTCCAGGTGAGCCGGG + Intronic
1162411619 19:10509591-10509613 AAAAATCACCCAGGTGGGCCGGG - Intergenic
1163125135 19:15240452-15240474 TGCAATCATCCAGGTGGGCCAGG - Intronic
1164158271 19:22609812-22609834 TGCAGTCCACAAGGTGGGCCGGG - Intergenic
1165187504 19:34034626-34034648 TGCAATGCACCAGGTAGGCCTGG + Intergenic
1165935385 19:39385518-39385540 TGAAATCATGGAGGAGGGCCTGG - Intronic
1166170480 19:41024810-41024832 TGTAGGCATTCAGGTGGGCCTGG + Intergenic
1168296411 19:55379154-55379176 TTCTAGCACCCAGGTGGGCCTGG - Intergenic
925125247 2:1450037-1450059 TGCCCTCATCCTGCTGGGCCAGG - Intronic
925851979 2:8090788-8090810 GGGAATCATCCAGGAGGGCCAGG - Intergenic
926312606 2:11685431-11685453 TGCAATAATCCAAGTGGGAGGGG + Intronic
927445396 2:23156443-23156465 TGCAATCAACCAGTTGGGTGGGG + Intergenic
928939536 2:36713606-36713628 TGCAATAATCTAGGTGGGAGAGG + Intronic
930393865 2:50795450-50795472 TGCAATCTTCCAGGTTGGAGTGG - Intronic
931976800 2:67652261-67652283 TGCACTCATTTAGGTTGGCCAGG - Intergenic
932399330 2:71468930-71468952 AGCCATCCTCCAGGTGTGCCTGG + Intronic
932462789 2:71894056-71894078 TGCAACCTTCCAGGTGGAGCTGG - Intergenic
932947032 2:76247044-76247066 TGCAGTCATCCATGTAGGCTTGG + Intergenic
933195128 2:79380651-79380673 TGCAATCATCCAGGTGTTGCAGG - Intronic
933829287 2:86193898-86193920 GGAGGTCATCCAGGTGGGCCTGG + Intronic
934968093 2:98740591-98740613 TGAAATCATCCCTGTGGGGCAGG - Intergenic
937259077 2:120573967-120573989 TGCAATCAGCCTGGTGGTGCTGG - Intergenic
937472720 2:122187917-122187939 TGAAATGATCCAGGTGCTCCTGG - Intergenic
939509996 2:143093394-143093416 TGTAATTATCCAGGTGGCTCAGG + Intronic
941408243 2:165119055-165119077 AAAAATCATCCAGGTGGGCCAGG - Intronic
942487990 2:176459297-176459319 TGCAATCATCCAGGTGAGAGAGG + Intergenic
948366171 2:237456255-237456277 TCCACTCACCCAGGTGGGCCCGG - Intergenic
948944898 2:241214601-241214623 TGCAGTCTTCCAGCTGGACCTGG + Intronic
1169204086 20:3730449-3730471 TTCAATTGTCCAGGTGGGCATGG - Intergenic
1169481374 20:5985148-5985170 TGAAATAATCCAAGTCGGCCTGG + Intronic
1170207987 20:13820126-13820148 AGCAATATTCCAGGTTGGCCTGG + Exonic
1171211909 20:23323754-23323776 TGCAATCCTCAAGGTTGGCCCGG + Intergenic
1171873945 20:30553970-30553992 GGCAATCCTCCAGTTTGGCCAGG + Intergenic
1171936139 20:31277320-31277342 TGCGTTCATGGAGGTGGGCCTGG + Intergenic
1172112136 20:32553220-32553242 TGCAGTGATCCAGGTGAACCAGG - Intronic
1173370212 20:42428298-42428320 AGCAGTCATCCTGGTGGCCCAGG + Intronic
1175863212 20:62161113-62161135 TGCGTTCAGCCTGGTGGGCCGGG + Intronic
1176613018 21:9003204-9003226 AGAAATCATGCAGGTAGGCCGGG - Intergenic
1183951208 22:41354097-41354119 TGCAGTCATCAACGTGGGCATGG + Intronic
1184677844 22:46053386-46053408 TGCAATTATTCATGAGGGCCGGG + Intronic
1185415385 22:50706434-50706456 TGCAAACATACTGGTGGGCCAGG - Intergenic
949639031 3:6014399-6014421 TGCACTCATCAAGGTTGACCTGG + Intergenic
951148824 3:19263072-19263094 TGAAAGCATCCAAGTGAGCCTGG + Intronic
951554623 3:23908817-23908839 AGAAATTATCCAGGTGGGCATGG - Intronic
953820527 3:46204142-46204164 TGGAAACATCCTGGTGGTCCTGG - Exonic
954671858 3:52295342-52295364 TGAAATCCTCCAGCTGGGCCAGG - Intergenic
968551598 4:1226292-1226314 TGCAATCATCCGGATGGGGTGGG - Intronic
969485523 4:7470440-7470462 TCCATTCATCCAGGTGGGATAGG + Intronic
973981937 4:56314726-56314748 TCCAGTCCTCCAGGTGCGCCTGG - Exonic
975652445 4:76607640-76607662 TGCAATAATGCTGTTGGGCCTGG + Intronic
976020475 4:80617879-80617901 TGTAATTACTCAGGTGGGCCAGG - Intronic
978420000 4:108521675-108521697 TGCAAACAACCTGGTGGGTCAGG - Intergenic
978461369 4:108957135-108957157 CACATTTATCCAGGTGGGCCTGG - Intronic
980156807 4:129117678-129117700 TTCAATCATCCATGTGGGTTTGG - Intergenic
980601590 4:135032826-135032848 TGTAATCATCTAGGTGGGCAGGG - Intergenic
980809383 4:137855078-137855100 CGGAATTATCCAGGTTGGCCTGG + Intergenic
985480585 5:107844-107866 TGCAGTGATCCGGGTGGGGCTGG + Intergenic
985561214 5:587037-587059 TGCCATCCACCAGGAGGGCCAGG - Intergenic
985905265 5:2830282-2830304 TGCAACAATGCAGGTGAGCCAGG + Intergenic
986442277 5:7792902-7792924 TGCAGTCCTCCAGGTGAGGCGGG + Intronic
988018738 5:25596267-25596289 GGCCATCATCCAGGTGGGGAGGG + Intergenic
994050168 5:95353602-95353624 TACAATCTCTCAGGTGGGCCTGG + Intergenic
997882000 5:137599938-137599960 TGCTTTCATCCAGGTGGGAGTGG + Intergenic
999663958 5:153893815-153893837 TTCAGTCAACAAGGTGGGCCTGG - Intergenic
999873342 5:155774726-155774748 CTGGATCATCCAGGTGGGCCTGG - Intergenic
1001618833 5:173064857-173064879 TTAAATTAGCCAGGTGGGCCAGG - Intronic
1006925528 6:37652269-37652291 TGAGAACATCCAGCTGGGCCAGG - Exonic
1007247668 6:40473980-40474002 TGCAAACACCCAGGTGTTCCTGG + Intronic
1017282335 6:152637878-152637900 TGCAATCATCCTGTTGGACTTGG - Intergenic
1018152720 6:160955418-160955440 AGTAGTCATCGAGGTGGGCCAGG - Intergenic
1018709879 6:166490769-166490791 TTCATTCATCCAGATGGACCCGG + Intronic
1019010862 6:168842524-168842546 AGGAATCATGCAGGTGGGCCTGG + Intergenic
1024717745 7:52100271-52100293 TGTAACTATCCAGGTAGGCCAGG + Intergenic
1025722347 7:64028009-64028031 TACAATTATCCATGTGGGCAGGG + Intergenic
1026252563 7:68683738-68683760 TGCATAAATACAGGTGGGCCAGG + Intergenic
1026447634 7:70499411-70499433 TGCAGTCCTCCAGGATGGCCGGG + Intronic
1027208855 7:76127444-76127466 TGTAATCATGCAGGTGGTTCCGG + Intergenic
1027271421 7:76521422-76521444 AGAAGTTATCCAGGTGGGCCGGG + Intergenic
1027321187 7:77011361-77011383 AGAAGTTATCCAGGTGGGCCGGG + Intergenic
1031473289 7:122192259-122192281 TTGAATCATCAAGGTGGGCAGGG + Intergenic
1042939197 8:74090175-74090197 TGCAATCATCTAGGTGGCTTTGG + Intergenic
1044371483 8:91416917-91416939 TTCAATCAACCAGGCTGGCCCGG - Intergenic
1048973294 8:139657065-139657087 TGGATTCAGCCAGGTGGACCAGG - Intronic
1049052786 8:140211923-140211945 TGCTACCATCCAGGTGGGAACGG + Intronic
1053448889 9:38176428-38176450 TGCAATCTTGCAGGTGGCTCAGG + Intergenic
1057800105 9:98185779-98185801 TGCCATTTTGCAGGTGGGCCAGG + Intronic
1059507119 9:114809457-114809479 TGCAATCATCCAGGAGAGGCAGG + Intergenic
1060033417 9:120234861-120234883 GCCAATCATCCAGGAGGACCAGG - Intergenic
1203771832 EBV:53548-53570 GGCCATCATCCAGGAGGCCCAGG - Intergenic
1190628882 X:52365919-52365941 TGAACTCATCCAGCTGGACCAGG + Intergenic
1191898899 X:66021479-66021501 AAGAATCATCCAGGTGGACCTGG + Intergenic
1195028858 X:100906956-100906978 TTGAATTATCCAGGTGTGCCTGG - Intergenic
1195889984 X:109682750-109682772 TGCAATCATCCATTCGGCCCTGG + Exonic
1201862438 Y:18614034-18614056 TGGAATCATCCTGGGAGGCCAGG - Intergenic
1201870885 Y:18706346-18706368 TGGAATCATCCTGGGAGGCCAGG + Intergenic