ID: 1163125414

View in Genome Browser
Species Human (GRCh38)
Location 19:15241734-15241756
Sequence CTGTCCTCCCTGGGAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163125414_1163125420 -1 Left 1163125414 19:15241734-15241756 CCAGTATTTCCCAGGGAGGACAG 0: 1
1: 0
2: 2
3: 19
4: 182
Right 1163125420 19:15241756-15241778 GGCAGCTTGTTCTTGGCTCAGGG 0: 1
1: 0
2: 1
3: 18
4: 248
1163125414_1163125418 -8 Left 1163125414 19:15241734-15241756 CCAGTATTTCCCAGGGAGGACAG 0: 1
1: 0
2: 2
3: 19
4: 182
Right 1163125418 19:15241749-15241771 GAGGACAGGCAGCTTGTTCTTGG 0: 1
1: 0
2: 2
3: 19
4: 237
1163125414_1163125421 18 Left 1163125414 19:15241734-15241756 CCAGTATTTCCCAGGGAGGACAG 0: 1
1: 0
2: 2
3: 19
4: 182
Right 1163125421 19:15241775-15241797 AGGGCATGCAGAGATCCACTTGG 0: 1
1: 0
2: 2
3: 19
4: 135
1163125414_1163125419 -2 Left 1163125414 19:15241734-15241756 CCAGTATTTCCCAGGGAGGACAG 0: 1
1: 0
2: 2
3: 19
4: 182
Right 1163125419 19:15241755-15241777 AGGCAGCTTGTTCTTGGCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163125414 Original CRISPR CTGTCCTCCCTGGGAAATAC TGG (reversed) Intronic
900306233 1:2009966-2009988 CCGTCCTCCCAGGGCACTACAGG - Intergenic
903344685 1:22676874-22676896 CAGTGCTCCCTGGGAAATTCTGG + Intergenic
903682553 1:25106891-25106913 CTGTCCTCCTTGGGAGATGGTGG - Intergenic
904849106 1:33443769-33443791 GGGCCCTCCCTGGGAAATGCTGG - Intergenic
906581748 1:46940838-46940860 CTGTGCTCCCTGGCAAACACAGG + Intronic
906601969 1:47138060-47138082 CTGTGCTCCCAGGCAAATGCAGG - Intronic
906635376 1:47406196-47406218 CTGTCCTCCCTGGGCCTCACAGG + Intergenic
907212102 1:52832703-52832725 CTGGACTCCTTGGGAAAAACAGG - Intergenic
909848822 1:80434218-80434240 GTGTACTCCCTGGGTATTACTGG + Intergenic
912922305 1:113881131-113881153 CTGTCTTCCCTAGGAAAATCTGG - Exonic
913476587 1:119244319-119244341 CCTATCTCCCTGGGAAATACTGG + Intergenic
914457110 1:147846308-147846330 CTGTCCTGCCTGGGAAAAACAGG + Intergenic
915185594 1:154102430-154102452 TTGTCCTACATGGGAAATAAGGG + Intronic
916801156 1:168217721-168217743 CAGACCAGCCTGGGAAATACAGG - Intergenic
918586603 1:186195417-186195439 CTTCCCTCTCTGTGAAATACTGG - Intergenic
921228430 1:213044095-213044117 CTGTGGTACCTGGGTAATACTGG + Intergenic
922047924 1:221964715-221964737 CTTTCCTCCCTGTGGAATTCAGG + Intergenic
1063843727 10:10102074-10102096 CTGTGCTCCCTGGGAAGTCAAGG - Intergenic
1064940972 10:20735193-20735215 CTCTCAACCCTGGGGAATACAGG - Intergenic
1066351588 10:34641826-34641848 CTGTCCTGCACGTGAAATACAGG + Intronic
1071921346 10:90354331-90354353 CTGTCCTTCCAGGGAACTACTGG + Intergenic
1073402007 10:103265514-103265536 CTGTTCTCCACGGGAAATAGAGG - Intergenic
1074703876 10:116114761-116114783 TTGTCCTCCCTGATAAAAACTGG + Intronic
1078698449 11:13658472-13658494 CTGAGATCCCTGGGAAAAACAGG - Intergenic
1081787480 11:45757550-45757572 CCCTCCTCCCTGGGGAATATTGG + Intergenic
1082087702 11:48063602-48063624 CTTCCCTCTCTGGGAAAGACTGG - Intronic
1083239596 11:61377615-61377637 CTGTCCTCCCTTTGGAATTCAGG - Intergenic
1084674314 11:70625188-70625210 CCGTCCTCCCTGGGAAAGTGGGG + Intronic
1085192869 11:74644055-74644077 CTCACCTCCCTGGAAAAAACTGG + Intronic
1087227061 11:95613278-95613300 CTGGTCTCCTTGGGAAAAACAGG - Intergenic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1089334467 11:117713528-117713550 CAGGCCTCCCTGGGAAATTGTGG - Intronic
1092280836 12:7096650-7096672 CAGGCCTCCCTGGGAGCTACAGG + Exonic
1095175528 12:39087881-39087903 CTGTACTCCAAGGGATATACAGG - Intergenic
1097254313 12:57660820-57660842 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1098017874 12:66125572-66125594 ATGTCCTGCCTGGGGAATTCTGG - Intronic
1098553844 12:71795715-71795737 CTGTCATCTCTTGGAAACACTGG + Exonic
1099960641 12:89393669-89393691 CTGTCCTCGTTGGGAAATTCAGG - Intergenic
1101299058 12:103459142-103459164 GAGCCCTTCCTGGGAAATACGGG - Intronic
1102507554 12:113393181-113393203 CTGTGCACCCTGGGAAACTCAGG - Intronic
1102756813 12:115348291-115348313 CTGTCCTCCCCGAGAAGTAGGGG + Intergenic
1104812721 12:131628404-131628426 TTGTCCTTCCTGGGAAAAACAGG + Intergenic
1105031732 12:132888671-132888693 CTGTCCTCCCTTTGGAATTCAGG + Intronic
1106251816 13:27987583-27987605 CTGTCCTCTCTGTCACATACAGG + Intronic
1106369643 13:29118850-29118872 GTGTCCTCCCTGGGAAGTGAGGG + Intronic
1106742623 13:32662018-32662040 CTGTCTTACATGGTAAATACAGG - Intronic
1107911265 13:45107782-45107804 CTTTCCTCCCTTTGAAATTCAGG - Intergenic
1108257319 13:48623218-48623240 CTGTCCACCCTGTCAAAGACTGG + Intergenic
1109847277 13:68011329-68011351 TTGTCCTCACAGGTAAATACTGG - Intergenic
1112606585 13:100912409-100912431 CCATCCTCCCTGGGAATGACAGG + Intergenic
1112750500 13:102578593-102578615 CTGCCATCCCTGGGAAATGGAGG + Intergenic
1112991286 13:105516566-105516588 CTGTGCTCACTGGAAATTACAGG + Intergenic
1113375793 13:109764641-109764663 CTGTGCTGCCAGGGAAAGACAGG + Intronic
1114537697 14:23433337-23433359 CTGTCTTCCCTGTGAGATCCTGG - Intronic
1115343488 14:32317678-32317700 CTGTCCTTCCTGGGGTACACAGG + Intergenic
1115923159 14:38400820-38400842 CTTAACTCCCTGGGTAATACAGG + Intergenic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1119002201 14:70892621-70892643 CTTTCCTCCCTGGAAAATACTGG + Intergenic
1121978692 14:98432637-98432659 CAGTCCTCCATGGGAAGTGCTGG + Intergenic
1127367705 15:58306980-58307002 CTGTCCTCTCTGGGGCAAACAGG + Intronic
1129884315 15:79027898-79027920 CTCGCCTCCCTGGGAAGTAGGGG - Intronic
1131316855 15:91346834-91346856 CTGTCTGCCCTGGGAATCACAGG - Intergenic
1132414064 15:101608206-101608228 CTGACCTTCCTGGAAATTACAGG - Intergenic
1134082345 16:11333722-11333744 CTGTCCTGCCTGGGGAAAAGGGG - Intronic
1134362277 16:13542644-13542666 TTGTTGTCCCTGGGAAATAGGGG - Intergenic
1137752196 16:50873240-50873262 CTGACCTTACTGGGAAATAAAGG - Intergenic
1138246479 16:55470619-55470641 CTGTGCTCCCTGGGATGGACTGG + Intronic
1141834553 16:86530140-86530162 CAGGCCTCCCTGGGAAGGACAGG + Intergenic
1141885254 16:86887540-86887562 ATTACCTCCCTGGGAAATCCAGG + Intergenic
1145112144 17:20173159-20173181 CAGTCCACTCTGGGAAACACAGG + Intronic
1145114555 17:20197185-20197207 CTGAACTCCTTGGGAAAAACAGG - Intronic
1147332860 17:39709190-39709212 CTCTCCTCCCTGGGGAATCTGGG + Intronic
1148103006 17:45104147-45104169 CTGTCCTCCCAGGGAAGGCCTGG - Intronic
1149627016 17:58086889-58086911 GTTCCCACCCTGGGAAATACAGG - Intronic
1151367984 17:73629555-73629577 CCGTCTTCCCTAGGAAATGCTGG - Intronic
1152308165 17:79533214-79533236 CCGTCCTACCAGGGAAACACAGG - Intergenic
1152685977 17:81694071-81694093 CTGTCCTCTCTGGGAAGCCCGGG - Intronic
1153531753 18:6054045-6054067 CTTTCCTACCTGGGAGATAGAGG + Intronic
1155109127 18:22696824-22696846 TTGTCATGCCTGGGGAATACAGG - Intergenic
1156105804 18:33658902-33658924 CTGCCCTCCCTCTGAAATTCTGG + Intronic
1156263759 18:35467853-35467875 CTGTCCTCCCTGGGGAAATGCGG + Intronic
1158337237 18:56426277-56426299 CTGTGCTCCTTGGCAAATTCAGG - Intergenic
1158709362 18:59823814-59823836 TTGTCCTCCCAGGTAATTACAGG + Intergenic
1159035174 18:63270299-63270321 CTGTTCATCCTGGGAAAAACTGG + Intronic
1163125414 19:15241734-15241756 CTGTCCTCCCTGGGAAATACTGG - Intronic
1163570860 19:18081487-18081509 CAGTCCTTGCTGGGAGATACTGG - Intronic
1165248837 19:34513887-34513909 CTGTCCTCCCTCTGAAATGGTGG - Intergenic
1165256378 19:34579220-34579242 CTGTCCTCCCTCTGAAATGGTGG - Intergenic
1165266195 19:34665123-34665145 CTGTCCTCCCTCTGAAATGGTGG + Intronic
1165273825 19:34732181-34732203 CTGTCCTCCCTCTGAAATGGTGG + Intergenic
1165943775 19:39429006-39429028 CTGTCCTCTCTGGGACATTTAGG + Intergenic
1166308921 19:41951626-41951648 CAGTCTCCCCTGGGGAATACTGG + Intergenic
1166388029 19:42392916-42392938 CCCTCCTCCTTTGGAAATACAGG + Intergenic
1167615231 19:50529359-50529381 ATCACCTCCCTGGGAAATGCTGG + Intronic
931835910 2:66098089-66098111 ATGTCCTCCCTTGGCAAAACAGG + Intergenic
932896942 2:75649479-75649501 CTGGCTTCCCTGGGACACACTGG - Intronic
937265949 2:120614775-120614797 CTGTCCTCTCAGGGAGACACAGG - Intergenic
939776482 2:146393439-146393461 TTGTTCTTCCTGGGAAAAACAGG + Intergenic
942071970 2:172324441-172324463 CGGTCCTCCCTGGGCAAGCCTGG - Intergenic
946195144 2:218028317-218028339 CTGTTCTGTCTGGGAAATAGAGG - Intergenic
947304258 2:228725949-228725971 CTTTACTCACTGGGAAATACGGG + Intergenic
948624500 2:239260781-239260803 CTGCCCTCCATGGGAAAGAGAGG - Intronic
1170495640 20:16921896-16921918 CTGCCTTTCCTGGGAAAAACTGG + Intergenic
1170871894 20:20213509-20213531 GTGTCCTCCCTGGGAATTCCTGG - Intronic
1172152051 20:32797528-32797550 CTGTACACCCTGGGCAACACAGG - Intronic
1172187794 20:33042066-33042088 CTATTCTCCCTCGGAACTACAGG + Intronic
1172963820 20:38818503-38818525 CTTCCCTCCAAGGGAAATACAGG + Intronic
1173246339 20:41340426-41340448 CTGTCCAGTCTGGGAGATACGGG + Intergenic
1173617258 20:44411246-44411268 CTGTCTTCCCAGGGAACTCCTGG - Intronic
1180764781 22:18340025-18340047 CTGTCCTCCCTGGTAGGTACAGG + Intergenic
1180814248 22:18779659-18779681 CTGTCCTCCCTGGTAGGTACAGG - Intergenic
1180953614 22:19731585-19731607 CTGTCTTCCATCGGAAACACAGG - Intergenic
1180953959 22:19733178-19733200 CTCTTCTCCCTGGGACATTCTGG - Intergenic
1181200434 22:21213994-21214016 CTGTCCTCCCTGGTAGGTACAGG - Intronic
1181701304 22:24622965-24622987 CTGTCCTCCCTGGTAGGTACAGG + Intronic
1182619574 22:31611510-31611532 CCGTCTTCCCTGGGAGACACTGG - Intronic
1183030927 22:35103968-35103990 CCTTCCTCCCTGGGGAGTACAGG - Intergenic
1183356386 22:37362040-37362062 CGGTCCACCCTGGGAAGGACAGG + Intergenic
1183376402 22:37467894-37467916 CTCTCCTCCCTGGAAAACAAAGG + Intergenic
1184095592 22:42314628-42314650 CTGTTCTCCCTGGGAGAGGCGGG - Intronic
1185082473 22:48717694-48717716 CTGTGGTCCCTGGGAAGCACTGG - Intronic
1203226404 22_KI270731v1_random:80930-80952 CTGTCCTCCCTGGTAGGTACAGG + Intergenic
1203264346 22_KI270734v1_random:5346-5368 CTGTCCTCCCTGGTAGGTACGGG - Intergenic
949962827 3:9328420-9328442 CTGGACTCCTTGGGAAAAACAGG - Intronic
950216293 3:11162102-11162124 CTGTCCTTCCTGGGAGAGAGTGG + Intronic
950605716 3:14078215-14078237 CTGGACTCCTTGGGAAAAACAGG - Intronic
951085049 3:18502534-18502556 CTCTCCTTGCTGGGAAAGACAGG + Intergenic
951253488 3:20421651-20421673 CTGTCATCTTTGGGAAATTCTGG - Intergenic
954331953 3:49895924-49895946 TGGACCTCCCTGGGAAACACGGG - Intronic
956728281 3:72174642-72174664 CTGTTCTCCAAGGGAATTACAGG - Intergenic
959191148 3:103113059-103113081 GTGTACTCCCTGGGTATTACTGG - Intergenic
961628808 3:128281646-128281668 CTGTCCTCCCTGGTCCATCCAGG - Intronic
963064530 3:141252971-141252993 CTGGCCTCCTTGGGGAATACTGG - Intronic
964785947 3:160396713-160396735 CTGGCCTACCTGGAAAAGACTGG - Intronic
965535823 3:169822771-169822793 CTGCTCTACCTGGGAAACACCGG + Exonic
965588456 3:170340511-170340533 CTGGACTCCTTGGGAAAAACAGG - Intergenic
967871743 3:194235492-194235514 CTGTCCTCTCTGGCAAGCACAGG + Intergenic
968081726 3:195850993-195851015 CTGTCCTCGCTGAGAACGACTGG - Intergenic
969532267 4:7736594-7736616 CTTTCCTCGCTGGGAAATCGAGG + Intronic
969836680 4:9848110-9848132 GTGTCCTCCCTAGGAATTCCTGG + Intronic
971277220 4:25209828-25209850 CTGTCCTCCCTTTGGAATTCAGG - Intronic
971756435 4:30714543-30714565 TTCACTTCCCTGGGAAATACGGG - Intergenic
972254251 4:37336432-37336454 CTGTCCAGCCTGGGAGCTACTGG - Intronic
972359564 4:38314638-38314660 GTGTCCTCCCTCCGAATTACAGG + Intergenic
976077873 4:81320103-81320125 CTGTGCTCACGGGGAAATAGAGG - Intergenic
978080744 4:104588302-104588324 CTCTCCTACCTGGGAGATGCAGG + Intergenic
978679579 4:111363331-111363353 CAGTGCACCCTGGGAAATATTGG - Intergenic
980866516 4:138559722-138559744 CTGTACTTTCTTGGAAATACAGG - Intergenic
985715617 5:1458083-1458105 CTGACCTGCCTGGGAGAGACGGG + Intronic
986894005 5:12343660-12343682 CTGACCTCACTGGGAACTCCTGG + Intergenic
988863233 5:35306590-35306612 CTGTCTAACCTGGTAAATACTGG - Intergenic
998436051 5:142109280-142109302 CCGCCCGCCCTGGGAAATGCGGG - Intronic
999858417 5:155619854-155619876 GTGTCCTCCCTGGGTAAGCCTGG - Intergenic
1003243788 6:4367449-4367471 CTATCTACCCTGGGAAATAGAGG - Intergenic
1010603224 6:77856447-77856469 CTGTCCTTCCTGATAAATTCAGG - Intronic
1011583116 6:88894237-88894259 TTTCCCTCCCTGGGAAATATGGG + Intronic
1012665614 6:101964685-101964707 CTGGCATCCCAGGGAAATTCTGG + Intronic
1016854464 6:148652668-148652690 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1017404752 6:154107209-154107231 CTGGACTCCTTGGGAAAAACAGG - Intronic
1018537634 6:164838359-164838381 CTGGCTGCCCTGTGAAATACAGG + Intergenic
1018807415 6:167272016-167272038 CTGTCCTTCCTGGTAGAGACAGG + Intronic
1019557214 7:1638587-1638609 CTGTCCTCACTCGGAAATTCAGG - Intergenic
1020974537 7:14988660-14988682 CTCTCCTCCCTTTGAAATTCAGG - Intergenic
1021154241 7:17190314-17190336 TTGGCTTCCCTGGGAAACACTGG - Intergenic
1023177410 7:37448018-37448040 CTCTCCTCCCGGGGACACACCGG - Intronic
1023588597 7:41757621-41757643 CTGAGCTCCTTGGGAAAAACAGG - Intergenic
1024602403 7:50995325-50995347 CTGTCCTCCCTGGCAAGAGCAGG - Intergenic
1024997090 7:55280174-55280196 CTGACCTCCCTGGGCAGCACAGG - Intergenic
1025768865 7:64484654-64484676 CTGGACTCCTTGGGAAAAACAGG + Intergenic
1027056384 7:75052707-75052729 TTACCCTCCATGGGAAATACTGG + Exonic
1029117342 7:98244140-98244162 GAGGCCTCCCTGGGACATACAGG - Intronic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1032512952 7:132486582-132486604 CGGTCCTCCCGGGGAAAGCCAGG - Intronic
1032755707 7:134888940-134888962 CTCTCCTCCATGGAGAATACTGG + Intronic
1034852981 7:154513624-154513646 ATGTCCACCCTGGGAAACATGGG + Intronic
1035444807 7:158932963-158932985 CTGTCCTCACTGGAACACACTGG - Intronic
1036543311 8:9740490-9740512 TTGTCCTCTCTCTGAAATACAGG - Intronic
1037790008 8:21930459-21930481 CAGTCCTCCCTTGGAGATCCAGG + Intronic
1039106333 8:33994028-33994050 CTGTCCAGCCTGGGCAATAGAGG - Intergenic
1041031532 8:53741109-53741131 CTGTCTTTACAGGGAAATACTGG - Intronic
1044382934 8:91555280-91555302 CTGTCCCCACTGGGAGATTCTGG + Intergenic
1044516228 8:93142000-93142022 CTGTACTCCCAGGGGAATGCTGG - Intronic
1046067228 8:109211400-109211422 CTGGCCTCCCTGGAAAAGAGAGG - Intergenic
1046653187 8:116862919-116862941 CTGTTCTCCCTGTGAAGTAATGG - Intronic
1046754065 8:117955315-117955337 CTCTCCTCCCTGGAGAATAGGGG + Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1051918501 9:22235944-22235966 CTGTCCTCCTGGGGAGATGCAGG + Intergenic
1052663631 9:31467972-31467994 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1055970845 9:81911319-81911341 CTGGACTCCTTGGGAAAAACAGG - Intergenic
1056494399 9:87141752-87141774 TTGACCTCCCTGGGAAACAATGG + Intergenic
1056547037 9:87621488-87621510 CTTTCCTCCCTGGGAAGGCCAGG - Intronic
1060210391 9:121706773-121706795 CTGTCCTCCCTTGTGTATACAGG + Intronic
1060328689 9:122643951-122643973 GTGTCCTCCCTGGGTATTGCTGG - Intergenic
1061799342 9:133105553-133105575 CTGGCCTCCCGGGGACAGACTGG + Intronic
1062263797 9:135677424-135677446 CTATCCTCACTGGGAAATAGAGG - Intergenic
1185485401 X:478084-478106 CTAACCTCCCTTTGAAATACCGG - Intergenic
1186338962 X:8622783-8622805 CTGTCTTCCCTATGGAATACAGG - Intronic
1189086103 X:38026261-38026283 CAGTCCTTCCGGAGAAATACAGG - Intronic
1190724748 X:53181549-53181571 CTTTACTTCCTGGGACATACAGG - Intergenic
1199615529 X:149652280-149652302 CTGTCAGCCCTGGGAAGTTCCGG - Intergenic
1199634894 X:149805517-149805539 CTGTCAGCGCTGGGAAATGCTGG + Intergenic
1200843083 Y:7803648-7803670 AAGTCCTCCCTGGGAAAAAGGGG - Intergenic
1202175308 Y:22093539-22093561 TGTTCCTCTCTGGGAAATACAGG + Intronic
1202216054 Y:22492844-22492866 TGTTCCTCTCTGGGAAATACAGG - Intronic