ID: 1163125771

View in Genome Browser
Species Human (GRCh38)
Location 19:15243403-15243425
Sequence GCTGGGGGCCGGGCGGGCTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 564}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163125753_1163125771 27 Left 1163125753 19:15243353-15243375 CCATGGGGGGCTGTGGGAGCAGG 0: 1
1: 0
2: 4
3: 82
4: 950
Right 1163125771 19:15243403-15243425 GCTGGGGGCCGGGCGGGCTTGGG 0: 1
1: 0
2: 3
3: 50
4: 564

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163125771 Original CRISPR GCTGGGGGCCGGGCGGGCTT GGG Exonic
900014907 1:141366-141388 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
900045173 1:499975-499997 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
900067370 1:741705-741727 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
900102371 1:967367-967389 GCTGGGGGGGGGGTGGGCATGGG - Intronic
900126682 1:1071863-1071885 GCCGGGGGCCGGGGGGGCAGGGG + Exonic
900163205 1:1234303-1234325 GCTCGGGGCAGGGCTGGGTTAGG + Exonic
900183767 1:1323911-1323933 GCTGGGGGACTGGGGGGCTGAGG + Intronic
900183818 1:1324039-1324061 GCTGGGGGGCTGGGGGGCTGAGG + Intronic
900183856 1:1324135-1324157 GCTGGGGGGCTGGGGGGCTGAGG + Intronic
900269168 1:1778408-1778430 GCCGGGGTCCGGGCGGCCATGGG - Intronic
900319232 1:2074321-2074343 GCTGGGGGCCGGGGGGCTTGGGG + Intronic
900386177 1:2412116-2412138 GCTGGGGACGGGAAGGGCTTGGG + Intronic
900432762 1:2610814-2610836 GCTGGGGGCTGGGGGGCCTGTGG - Intronic
900461832 1:2805419-2805441 GGTGGGGGCCGGGAGGGGTGGGG - Intergenic
900464230 1:2816631-2816653 GTTGAGGGCTGGGCGGGCTGTGG + Intergenic
900579883 1:3403638-3403660 TCTGGGGCCTGGGCGGCCTTGGG + Intronic
900607657 1:3531058-3531080 GGTGGGCGCCGGGCGAGCCTGGG - Intronic
900639341 1:3681346-3681368 GCTGTGGGCAGGGTGGGCTCGGG + Intronic
900851134 1:5143862-5143884 GCTGGGGGGAGGGCGAGATTGGG + Intergenic
900997533 1:6130514-6130536 GCTGGGGGCTAAGTGGGCTTGGG - Intronic
901066533 1:6497200-6497222 GGTGGGCGCCGACCGGGCTTCGG - Intronic
901433926 1:9234826-9234848 GGTGGCGGCCGGGCTGGCCTTGG + Exonic
901454043 1:9353184-9353206 TCGAGGGGCCGGGCGGGCTGAGG - Intronic
901506589 1:9689471-9689493 GCTGGGGGCGGGGCGTCCTCGGG - Intronic
901808324 1:11751463-11751485 GCCTGGTGCCGAGCGGGCTTGGG + Intronic
902387133 1:16082468-16082490 GCTGGTGGCCTGGAGGCCTTGGG + Intergenic
902829006 1:18997620-18997642 GGTGCGGGCCGGGCTGGGTTGGG - Intergenic
902920723 1:19664941-19664963 GCCGCGGGCCGGGCGGGCGGCGG - Intergenic
903652613 1:24930691-24930713 GCTGGGGGCCGCGGGGTCTCAGG + Intronic
903661517 1:24981580-24981602 GCAGGGGGCAGGGCGGGGTGGGG - Intergenic
904006566 1:27366227-27366249 GCTGGGGGCGGGGCCGGATCCGG - Intronic
904255404 1:29251493-29251515 GCTGGGAGCCAGGCTGGCTGAGG + Intronic
904338127 1:29810997-29811019 GCTGTGGGTGGGGCTGGCTTTGG + Intergenic
904827029 1:33280474-33280496 GATGGGGTCCGAGTGGGCTTGGG + Intronic
905463097 1:38134057-38134079 GGTGGGGGCCTCGCGGGGTTGGG + Intergenic
906323805 1:44832104-44832126 GCTGGGGGCGAGGCGTGCTGTGG - Intronic
906640253 1:47437359-47437381 GCTGGAAGCCGTGCGGGCTCGGG + Exonic
907051061 1:51330292-51330314 GCCAGGGGCCGGGCGGGGTGGGG + Intronic
907430240 1:54406953-54406975 CCCGGGGGCGGGGCGGGCTGGGG - Intronic
907714493 1:56914778-56914800 GGTGGGGGCAGGGCGGGCTGAGG - Intronic
907767367 1:57424159-57424181 GCGGGGCGCCGGGCGGGCGCGGG - Intronic
908272846 1:62437292-62437314 GCCGGGGACCCGGCGGGCTCGGG + Exonic
910676616 1:89821792-89821814 GCTGGGAGCCCGGCGGGCGGGGG + Intronic
910838826 1:91542005-91542027 GCTGGGGGGCGGGTGGGTGTTGG - Intergenic
914000856 1:143693080-143693102 GGTGGGGAACGGGCGGGCTGAGG - Intergenic
914048128 1:144106728-144106750 GCTGGAGGCTTGGCTGGCTTGGG + Intergenic
914510822 1:148330438-148330460 GGTGGGGAACGGGCGGGCTGAGG - Intergenic
914757828 1:150574950-150574972 GCTTGGGGCAGTGAGGGCTTAGG - Exonic
915601890 1:156927681-156927703 GCTGGGAGCAGGGGCGGCTTGGG + Intronic
915977492 1:160400642-160400664 GCTGGGGGCCAGGGGGGAATAGG - Exonic
917291575 1:173477179-173477201 GCTGGGCGCGGGGCGGGGCTGGG - Intergenic
918480661 1:184974094-184974116 ACCGGGGACCGGGAGGGCTTGGG - Intronic
919926429 1:202194084-202194106 GCAGGGGGCCGGGCAGGCGGTGG - Exonic
920120245 1:203650656-203650678 GCGGGGAGCGGGGCGGGCTAGGG + Intronic
920333347 1:205228028-205228050 GGAGGGGGCCGGGCGCGCTGCGG + Intergenic
921381819 1:214532383-214532405 GCTGGGGGCCTGGCAGGAATAGG + Intronic
922101978 1:222484479-222484501 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
922263060 1:223959601-223959623 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
922937190 1:229431943-229431965 GCCGGGGGCCGGCGGGGCCTGGG + Intronic
923461849 1:234215076-234215098 GCTGGTGGCCGGAAAGGCTTCGG - Intronic
923490367 1:234478737-234478759 GCTGGCGGCCGCGCTGGCTGAGG - Exonic
923656307 1:235920320-235920342 GCTGGGGGCCTGTTTGGCTTAGG - Intergenic
924172472 1:241356838-241356860 GCCGGGGGCCGGGAGGGCTCTGG + Intronic
924344897 1:243064602-243064624 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
924539846 1:244970615-244970637 GCGGCGGGCCGGGCGGGCTACGG - Exonic
924763143 1:247007718-247007740 GGTGGGGGCCGGGCCGGCAGCGG - Intronic
1062855016 10:775721-775743 GCTGGGGGCCGGGCAGGCACCGG + Intergenic
1062968651 10:1629471-1629493 GTTGGGCGCAGGGCGGGGTTGGG - Intronic
1063931172 10:11029625-11029647 GCTGGAGGCAGGGGGGCCTTTGG + Intronic
1065099100 10:22316304-22316326 GCTGGCGGCGGCGCGGGCTGCGG - Exonic
1066731438 10:38440472-38440494 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
1067372750 10:45700155-45700177 GCTGGAGGCCTGCCGGGCGTAGG - Intergenic
1067387027 10:45825969-45825991 GCTGGAGGCCTGCCGGGCGTAGG + Exonic
1067419101 10:46131282-46131304 GCTGGAGGCCTGCCGGGCGTAGG - Intergenic
1067447244 10:46358638-46358660 GCTGGAGGCCTGCCGGGCGTAGG - Intergenic
1067504452 10:46837871-46837893 GCTGGAGGCCTGCCGGGCGTAGG - Intergenic
1067513086 10:46911515-46911537 GCTGGGGGCCAGGTGGGCAGGGG + Intronic
1067590135 10:47502129-47502151 GCTGGAGGCCTGCCGGGCGTAGG + Exonic
1067637256 10:48010224-48010246 GCTGGAGGCCTGCCGGGCGTAGG + Intergenic
1067649167 10:48140327-48140349 GCTGGGGGCCAGGTGGGCAGGGG - Intergenic
1067816274 10:49479760-49479782 GCTGGGGAACGGCCGGGCTGTGG + Intronic
1067876234 10:50010110-50010132 GCTGGAGGCCTGCCGGGCGTAGG - Exonic
1069886227 10:71625455-71625477 GCTGGGGGGCGGGTGGGGGTAGG + Intronic
1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG + Exonic
1070133850 10:73674653-73674675 GCTGGAGGCCTGCCGGGCGTAGG + Exonic
1070162546 10:73874655-73874677 GCCGGGGGCCGGGCGGGGGGGGG - Intergenic
1070610022 10:77926648-77926670 GCCGGGGCCTGGGCGGGCTGGGG + Intergenic
1070725342 10:78783905-78783927 GCTGGAGGCAGGGCAGGCTGGGG - Intergenic
1070799692 10:79238038-79238060 GCGGGGAGCCGGTAGGGCTTGGG - Intronic
1070827296 10:79398789-79398811 GCTGGGGGTCTGACGGGCTGTGG - Intronic
1071607864 10:87009829-87009851 GCTGGAGGCCTGCCGGGCGTAGG - Intergenic
1071997678 10:91163323-91163345 GCCGGGCGCCGGGCGGGCAAGGG + Intronic
1072102285 10:92240153-92240175 GTTGGGGGCCGGGGGGGCAGCGG + Exonic
1072656779 10:97335059-97335081 GGCGGGAGTCGGGCGGGCTTAGG - Intergenic
1073035637 10:100562644-100562666 GCTGCAGGCAGGGCGGGTTTCGG + Intergenic
1073047575 10:100649654-100649676 GATGGGGGCTGGGGGGGGTTAGG + Intergenic
1073076457 10:100827945-100827967 GCAGGGTGGCTGGCGGGCTTCGG - Exonic
1073099295 10:100998540-100998562 CCTGGGGCCCGGGCGAGCTCCGG + Intronic
1073134680 10:101213941-101213963 GCTGGGGGCCGGGCTCGGGTAGG + Intergenic
1073178504 10:101570415-101570437 GCTGGGGGCGGGGCGGGTATTGG - Intergenic
1073465643 10:103693253-103693275 CCTGGGGGCCGGGCTGGCAGGGG - Intronic
1073762795 10:106648840-106648862 GATGGGGGCAGGGCAGGCTAGGG - Intronic
1074186623 10:111103839-111103861 CCCGGGGGCCGGGGGGTCTTGGG - Intergenic
1074772436 10:116742638-116742660 GCGGGGCGCCGGGCGGGCCGGGG - Intergenic
1075059187 10:119242844-119242866 GCTGGGGGCGGGGGGAGCTCAGG - Intronic
1075483339 10:122800259-122800281 CCTGGGGGCAGGAAGGGCTTGGG + Intergenic
1076639051 10:131901434-131901456 GATGGGGGCCGGGCGGGGCAGGG + Intronic
1076883851 10:133252424-133252446 GCGGGGTGCAGGGCGGGCTGGGG - Intergenic
1076971502 11:136466-136488 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
1077244152 11:1527897-1527919 GCCGGGGGCCGGGGGAGCTGGGG - Intergenic
1077501918 11:2913180-2913202 GCTGGGGGGGCGGCGGGCCTGGG - Intronic
1078377403 11:10808057-10808079 GCTGGGCGCCGGGCTGGCGGGGG - Intronic
1079035256 11:17014629-17014651 GCTGGGGGCGGGGAAGGCTCGGG - Intergenic
1081637016 11:44727717-44727739 GATCGGGGCCGGGAGGGCTGTGG + Intronic
1082262275 11:50085789-50085811 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
1083186785 11:61022277-61022299 GCTGGGGGCAGGGCGGGGCAAGG + Intergenic
1083265831 11:61546495-61546517 GAGGGGGACCGGGCGGGCTGGGG + Intronic
1083708040 11:64530065-64530087 GCTGTGGGCTGGGCTGGCTAAGG - Intergenic
1083741468 11:64713712-64713734 GCCGGGGGCCGGGCGGGGCCGGG - Exonic
1083822558 11:65181481-65181503 GCTGGGGACCGGGCGGGCCCGGG + Exonic
1083861456 11:65422453-65422475 GCTGGGGGCGTGGCGGGCGGGGG - Intergenic
1084195789 11:67523185-67523207 TCCGAGGGCCGGGCGGGGTTGGG - Intronic
1084892697 11:72244281-72244303 GGTGGGGGTCGGGGCGGCTTTGG - Intronic
1085026529 11:73239771-73239793 GCTGGGGGCCTGGAGGGTCTTGG - Intergenic
1085045374 11:73349699-73349721 GCTGGGAGCAGGCAGGGCTTGGG + Intronic
1085173497 11:74467601-74467623 GCTGGGGCCCGGGCGGGGCAGGG - Exonic
1085445932 11:76600518-76600540 GCTGGGAGCGGGGCTGGCATGGG + Intergenic
1086466811 11:87062412-87062434 GCGGGGGGGGGGGGGGGCTTGGG - Intronic
1086888295 11:92226998-92227020 GCTGGGGCCGGGGCGGGTTGGGG - Intergenic
1089046089 11:115503500-115503522 GCTGTGGGGCGGGCGGGCTGCGG + Intronic
1089258037 11:117204376-117204398 GCTGGGGGAGGGCCGGGCTCAGG - Exonic
1089537410 11:119169098-119169120 GCGGGGGGCAGGGCGGGCCGGGG + Exonic
1089729444 11:120511484-120511506 GCTGCGGGCAGGGCGGGCGCGGG - Intergenic
1090826602 11:130391567-130391589 ACTGGGGGGCGGAAGGGCTTGGG + Intergenic
1091588180 12:1827879-1827901 GATGGGGGCGGGGCAGGCTTCGG - Intronic
1091791576 12:3274969-3274991 CCTGGGGGCCTGGAGGACTTTGG + Intronic
1091807058 12:3364355-3364377 GCTGGGGCCAGGGCTGGCTCTGG + Intergenic
1092256222 12:6928040-6928062 GCCGAGGGCCGGGCGGGCCGCGG + Intronic
1092879317 12:12875707-12875729 GCTGGGGGCCTGGAGGGGGTAGG - Intergenic
1094025741 12:25958645-25958667 GCTGGGGGCCGGGCCGGGCCGGG - Intergenic
1095949403 12:47773633-47773655 GGTGGCGCCCGGGCGGGCATCGG - Intronic
1095957059 12:47813084-47813106 GCTGGAGGCGGGGCGGGCGGCGG - Intronic
1096784437 12:54009129-54009151 GCTGGGGGCTGGGCAGGTTGGGG - Exonic
1096791407 12:54047421-54047443 CCTGGGTCCGGGGCGGGCTTCGG - Intronic
1097439815 12:59595996-59596018 GGTGGGGGCCGGACAGGCTGCGG - Intergenic
1097861918 12:64526456-64526478 GCTGGGGGTTGGGAGGGGTTAGG - Intergenic
1098114160 12:67156567-67156589 GCTGGTGGGGGGGGGGGCTTAGG + Intergenic
1099973598 12:89524932-89524954 GCTGGGGGCCGGGATGGCAGAGG + Intronic
1100594606 12:96061118-96061140 GATGGGGGCAGGGCAGGCTGTGG + Intergenic
1102457204 12:113078043-113078065 GCTGGGGCCCGGGCCGGTTGAGG - Exonic
1102498073 12:113333188-113333210 GCTGGGGGCCAGGTGGGACTGGG - Intronic
1103447254 12:121002233-121002255 CCTGGGGGCCTGGCTGGCTGAGG + Exonic
1103506042 12:121442889-121442911 GCAGGGGGGCGGGAGGCCTTGGG - Intronic
1103595588 12:122022693-122022715 GCGGGCGGCCGGGCGGGCCGGGG - Intronic
1103601013 12:122054655-122054677 GCTGGGGGGCTGGAGGGCTGGGG - Intronic
1103942372 12:124508119-124508141 GCTGGGGGCTGGGATGGGTTGGG - Intronic
1104247833 12:127060554-127060576 GCTGGGGGCGTGGCGGGCCAGGG - Intergenic
1104568303 12:129903962-129903984 GCCCGGGGCCGGGCGGGCCGAGG - Intergenic
1104845937 12:131846890-131846912 GCTGAGGGCCGGGCAGGCGATGG - Intronic
1104866990 12:131961532-131961554 GCTGGGGGCGCAGCGGGGTTTGG + Exonic
1104885539 12:132104900-132104922 GCTGGGGGCGCAGCGGGGTTTGG + Exonic
1105768062 13:23579872-23579894 GCCGGGGCCGGGTCGGGCTTGGG - Intronic
1105975471 13:25468777-25468799 GCCGGGGGCGGGGCCGGCCTTGG + Intronic
1106325798 13:28688245-28688267 GCTGGGGGGTGGGAGGGCTGGGG - Intergenic
1107481557 13:40789727-40789749 GCGGGGCGCGGGGCGGGCCTCGG + Intronic
1112050660 13:95641893-95641915 GATGGGGGGCGGGCAGGCTGGGG + Intronic
1113655242 13:112063698-112063720 GCTGGGGGGCGGGCGGGAGCGGG + Intergenic
1113771293 13:112911004-112911026 GGTGGGGGCGGGGCGGGGGTGGG + Intronic
1113841587 13:113364224-113364246 GCTGGGGGCGGGGAGGACTTGGG + Intergenic
1114273767 14:21122781-21122803 GCTGGGGGCTGGACAGCCTTAGG + Intergenic
1114618807 14:24082584-24082606 GCTGGGGGCTGGGGAGGCATTGG - Exonic
1114673911 14:24428955-24428977 CCTGGGGGCCGGGTGGGCCCAGG - Exonic
1115174567 14:30547609-30547631 GCGGGTGGCAGGGGGGGCTTAGG + Intergenic
1115576122 14:34714283-34714305 GGTCGGGGCCGGGCGGGCGGGGG - Intronic
1116149983 14:41128703-41128725 GCTGGGGGGCTGGAGGGCTGGGG - Intergenic
1116876376 14:50116258-50116280 GCTGGCGGGCGGGCGGGATGTGG - Intronic
1116950181 14:50872208-50872230 GCTGGGGGCCCGGGCGGCTCGGG - Exonic
1118854726 14:69611939-69611961 GCCGGAGCCCGGGCCGGCTTCGG + Intronic
1118992603 14:70809611-70809633 GCGCGGGGCGGGGCGGGCGTGGG - Intergenic
1119976251 14:79027431-79027453 GCTGGGGGACTGGATGGCTTGGG + Intronic
1120135605 14:80865083-80865105 GCTAGGGGCAGGGCAGGGTTGGG - Intronic
1121323235 14:93004943-93004965 GCTGGGGGCCTGGCAGGGCTGGG + Intronic
1121761153 14:96446175-96446197 GCTGGGGGCCGGTCCTGCTGGGG + Intronic
1122534920 14:102455385-102455407 GCTGGGCCCCAGGCGGGCTCTGG + Intronic
1122688723 14:103521796-103521818 GGTAGGGGCCGGGCGGGCCGAGG - Exonic
1122798757 14:104219544-104219566 GCTGGGGGCCTGGGGGGTTGGGG - Intergenic
1123039125 14:105483217-105483239 GCTGGGGGCAGGGCTGGCTGAGG + Intergenic
1123068614 14:105630288-105630310 CCTGGGGGCCGAGGGGACTTGGG + Intergenic
1123092637 14:105748615-105748637 CCTGGGGGCCGAGGGGACTTGGG + Intergenic
1123105775 14:105840445-105840467 GCTGAGGGCTGGGCGGGGCTGGG + Intergenic
1123630740 15:22258196-22258218 GCCGCGGGCCGGGCGGGCGCCGG - Intergenic
1124142346 15:27088453-27088475 GCTGTGTGCCGGGCAGGCTGCGG + Intronic
1126823533 15:52528506-52528528 GCTGGGGGCAGAGCGGGCTTCGG - Intronic
1126837033 15:52678641-52678663 GCTGGGGGCTGGGCGGGAGGAGG - Intronic
1127165848 15:56244026-56244048 GCTGGGGGCCGGGAGGAGTCCGG + Intronic
1127847795 15:62886619-62886641 GCAGGGGGCCAGGCAGGCTTGGG + Intergenic
1128113050 15:65088489-65088511 GCGGAGGGACGGGCAGGCTTTGG - Intergenic
1128269164 15:66293695-66293717 GCTGCGGGCAGAGCGGGCTGTGG - Exonic
1128622426 15:69161368-69161390 GCTGGGGCCGGGGCCGCCTTGGG + Intronic
1129386991 15:75201840-75201862 GCTGGGGGCGGGGCGGGGGCGGG - Intronic
1129706271 15:77796337-77796359 GCTGGGGGCAGGCAGGGCTCTGG + Intronic
1129823699 15:78620796-78620818 GCTGGTGGCCGGGCTGGCCGCGG + Exonic
1129986366 15:79923114-79923136 GCCGGGCGCCGGGCGGGGCTGGG - Intronic
1130014248 15:80174930-80174952 GCTGGGGGCCTGGCTGGTATGGG + Intronic
1131058811 15:89391908-89391930 GCTGGGGGGCGGGCTGGCAGAGG + Intergenic
1132424907 15:101707687-101707709 GCTGGGGGCAGGGCGGGAATGGG + Intronic
1132462233 16:61351-61373 GCTGGGGGCGGGGCCGGCGGGGG - Intronic
1132498778 16:275740-275762 GCGCGGGGCGGGGCGGGCCTGGG - Intronic
1132555348 16:569739-569761 GCTGGGAGCCAGGCGGGGTCCGG + Intronic
1132659040 16:1053491-1053513 GGTGGGGGCCGGGCTGGCCTGGG - Intergenic
1132683445 16:1153016-1153038 GCCGGGGGCGGGGCGGGCGGGGG - Intergenic
1132683553 16:1153295-1153317 GCCGGGAGCCGGGCGGGCTGGGG + Exonic
1132789527 16:1678049-1678071 GCGGCGGGCCGGGCGGGCCCTGG - Intronic
1132875531 16:2135420-2135442 GCCGCGGGACGGGCGGGCGTGGG - Intronic
1133033405 16:3022131-3022153 CCTGGGGGCCAGGCTGACTTGGG + Exonic
1133784567 16:8964043-8964065 GCTGCGGGGCAGGCGGGCCTCGG - Intronic
1134070323 16:11256274-11256296 GCTGGGGGCGGGGCCGGCAGGGG - Intronic
1134519456 16:14911940-14911962 GCCGCGGGACGGGCGGGCGTGGG + Intronic
1134645089 16:15858755-15858777 GCTGGGGGCCGGGGGTGCGGGGG + Intergenic
1134707126 16:16310595-16310617 GCCGCGGGACGGGCGGGCGTGGG + Intergenic
1134960414 16:18401529-18401551 GCCGCGGGACGGGCGGGCGTGGG - Intergenic
1135555990 16:23437028-23437050 ACTGGGGGCCAAGGGGGCTTGGG + Intronic
1136984463 16:35085663-35085685 GCTGTGTGCCAGGTGGGCTTGGG - Intergenic
1137275337 16:46929683-46929705 TCTGTGCGCCCGGCGGGCTTTGG + Exonic
1137988504 16:53130590-53130612 GCTTGGGGCCGGGCGCCCTCTGG - Intronic
1138362345 16:56442003-56442025 GCTGGGGGCAGGGGAGGCTGAGG - Intronic
1138560479 16:57798109-57798131 GCGGGCGGCCGGGCTGGCTGGGG + Exonic
1139534487 16:67562918-67562940 GCGGGCGGGCGGGCGGGCGTGGG - Intronic
1140953536 16:79841494-79841516 GATGGGGGCCGGGGGAGCATGGG - Intergenic
1141972305 16:87492377-87492399 GCCGCGGGCCGGGCGGGCGCCGG + Intergenic
1142139618 16:88467025-88467047 GCTGCGGGCAGAGAGGGCTTTGG - Intronic
1142169234 16:88611920-88611942 TCTGGGGGCCAGGCATGCTTTGG - Intronic
1142247576 16:88976954-88976976 GTTGGTGGCCGGGAGGGCCTCGG - Exonic
1142292978 16:89201217-89201239 GCTGGGGGCGGGGAGGGCTGCGG + Exonic
1142359655 16:89620050-89620072 GCTGGAGACCAGGCTGGCTTTGG - Intronic
1142374903 16:89701734-89701756 GCTGGGGGCGGGGCGGGGCTTGG + Intergenic
1142448748 16:90161056-90161078 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
1203089959 16_KI270728v1_random:1207375-1207397 GCTGCGGGCTGGGCTGGCATGGG + Intergenic
1142458738 17:74233-74255 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
1142471404 17:165116-165138 TTTGGGGGCCTGGCTGGCTTGGG + Intronic
1142474504 17:181160-181182 GCTGGCGGCCGCGCGGGGCTGGG + Exonic
1142623755 17:1179988-1180010 GCGGGGGGCGGGGCGGGGGTGGG + Intronic
1142683318 17:1562585-1562607 GCGGGAGGCCGGGCGGGCCGCGG - Exonic
1142697731 17:1643184-1643206 GGTGGGGGCGGGGCGGGCACAGG - Intronic
1142709291 17:1714841-1714863 GCTGGGGGCGTGGCAGGCTCGGG + Intergenic
1142764673 17:2058497-2058519 GCCGGGGCGCTGGCGGGCTTGGG + Exonic
1143478646 17:7216855-7216877 TCGGGGGGCCTGGCGGGTTTGGG - Intronic
1143558308 17:7676310-7676332 GCTGGGGGGCTGGGGGGCTGAGG - Intronic
1143558317 17:7676326-7676348 GCTGGGGACCTGGAGGGCTGGGG - Intronic
1143558324 17:7676342-7676364 GCTGGGGACCTGGAGGGCTGGGG - Intronic
1143779141 17:9220300-9220322 GCTGGGGGCAGGGCAGACTGGGG + Intronic
1143984073 17:10895957-10895979 GCTGGGGGTAGGGAGGGCATAGG + Intergenic
1144724748 17:17496289-17496311 GCTGGGCGCGGCTCGGGCTTGGG + Exonic
1144784358 17:17823659-17823681 GCTGGGGGCGGGGCGGGGCGGGG - Intronic
1144809343 17:17988764-17988786 GCTGTGGGCCGTGGTGGCTTAGG + Intronic
1145055909 17:19703971-19703993 GCTGGAGGCAGGGCTGGCCTCGG - Intronic
1145915562 17:28571718-28571740 CCTAGGGGCCGTGCGGGTTTCGG + Exonic
1146008423 17:29176845-29176867 GCGGGGAGCCGGGCGGCCCTTGG + Intronic
1146009228 17:29180319-29180341 GCTGCCTGCCGGGCGGGCTCCGG - Exonic
1146054809 17:29575757-29575779 GCTGGGGGCCGTGTGGGCTAGGG - Intronic
1146672673 17:34752558-34752580 CCTGGAGGCCTGGCAGGCTTGGG - Intergenic
1146729500 17:35181871-35181893 GCTGGGGGCCTGGCAGCCATAGG + Intronic
1147123725 17:38352005-38352027 GCTGGGAGCCGGGCTGGGGTGGG - Intergenic
1147186878 17:38717753-38717775 GCAGGGGGCCGGGTGTGCTGGGG - Intronic
1147374465 17:40015669-40015691 GCTGGGGACAGAGCGGGCTCAGG - Exonic
1147422790 17:40331007-40331029 GCTGGGGGCCAGGTGGGTTGGGG - Exonic
1147617174 17:41836296-41836318 GCCGGGGGCGGGGCGGGGGTGGG + Intronic
1148110937 17:45144402-45144424 GCTGGGAGCGGGGCGCCCTTGGG + Intergenic
1148441140 17:47712079-47712101 GCTGGGGGCAGGGCGGGGGACGG + Intergenic
1148748677 17:49932230-49932252 GCTGGGGGCCAGGCCGGCTTTGG - Intergenic
1149294413 17:55249050-55249072 GCTGGGGGCTGGGCGAGATGAGG - Intergenic
1149430361 17:56592698-56592720 GCGCGGAGCCGGGCGGGCTAGGG + Intergenic
1149541662 17:57472313-57472335 GCAGGGGGCAGGGCGAGCTCAGG + Intronic
1149661641 17:58337280-58337302 CCTGGGGGCTGGGCAGGATTTGG - Intergenic
1149682884 17:58517969-58517991 GATGGGGGCAGGGCGGGACTTGG - Intergenic
1149993903 17:61397135-61397157 CCAGGGCGTCGGGCGGGCTTGGG - Intergenic
1149994772 17:61400600-61400622 GCGGGCGGGCGGGCGGGCTGGGG + Intronic
1150060602 17:62065411-62065433 GCTGGGTGCCGGCCGGGCGGCGG - Intergenic
1151393631 17:73804515-73804537 GCAGGGGCCAGGGAGGGCTTGGG - Intergenic
1151453559 17:74213504-74213526 GCCGGGGGCGGGGCGGGCACGGG + Exonic
1151559198 17:74861636-74861658 GCCGGGCGCCGTGCGAGCTTCGG - Intergenic
1151714581 17:75824956-75824978 GCTGGGGGCCAGGCCTGCTCTGG - Exonic
1152239854 17:79155584-79155606 GCTGGGGGCAGGGGGGTCTCAGG + Intronic
1152360775 17:79832191-79832213 GCTGGGGGCCTGGCGGGCGCGGG - Intergenic
1152527196 17:80895199-80895221 GCTGGGGGCCGGGTAGGCTGGGG - Intronic
1152566532 17:81102894-81102916 ACTGGGAGCCGGCCGGGCCTGGG - Intronic
1152587982 17:81197562-81197584 GCTGGGGGCCGGGTGGGGGCTGG + Intronic
1152650627 17:81490888-81490910 GCTGGGGGCCAGGTGGGGGTGGG + Intergenic
1152654318 17:81512948-81512970 GCTGGGGGCGGGGCGGGCCGGGG - Intronic
1152703133 17:81829321-81829343 GCAGGGGGCCGGGCTGGATGGGG - Intronic
1152798535 17:82320511-82320533 GCATGGGGCCGGGTGGGGTTGGG + Intergenic
1152911934 17:83010042-83010064 GCGGGGGGCTGGGGGGGCTGTGG + Intronic
1153229011 18:2919508-2919530 GTTGGGGGCGGGGCGGGGTTTGG + Exonic
1154173663 18:12067934-12067956 GCTGGGAGCCGGGGGGGCCCTGG + Intergenic
1155152911 18:23136269-23136291 CCTGGGCGCCGGCCGGGCGTCGG + Exonic
1155809997 18:30220245-30220267 GCTGGGGGTCTGGGGGGCTGGGG + Intergenic
1157618968 18:49004280-49004302 GCTGAGGGCAGGGCGTGTTTTGG - Intergenic
1160648456 19:206746-206768 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
1160731806 19:644623-644645 GCTGGGTGCAGGGCAGGCCTGGG + Intergenic
1160745408 19:709032-709054 GCGGGGGCCGGGGCGGGCTAAGG - Intergenic
1160779069 19:869842-869864 GCTGGGGGTCTGACGGGCCTGGG + Intronic
1160947798 19:1651805-1651827 GGTCGGGGCCGGGCGGGCCGGGG - Intronic
1160969811 19:1762576-1762598 GTTGGGGGCCGGGCGCGCTCTGG - Intronic
1160988985 19:1852935-1852957 GCTTGGGGACAGGGGGGCTTTGG - Exonic
1161064915 19:2232882-2232904 GCTGGGGCCTGGGCGGGCTTTGG - Intronic
1161118601 19:2512913-2512935 GCTGGGAGCCGGCAGGGTTTGGG - Exonic
1161142135 19:2654147-2654169 GGTGGGGGCGGGGCCGGCTGGGG + Intronic
1161513649 19:4684885-4684907 GCTGGGGACCGGGCCGGGCTGGG + Intronic
1161573234 19:5041592-5041614 GCAGGTGGCCTGGCGGGCTGAGG - Intronic
1161620012 19:5292876-5292898 GCTGGGGGCCAGGCGGGGGAGGG + Intronic
1161959596 19:7516293-7516315 GGTGGGGGGCGGGCGGGCGGGGG + Intronic
1162031811 19:7920750-7920772 CCTAGGGGCGGGGCGAGCTTGGG + Intronic
1162296619 19:9818516-9818538 GCAGCTGGCCGGGCGGGCCTGGG - Intronic
1162315632 19:9936557-9936579 GCTGGGGGCGGGGCGGGGGGCGG - Intergenic
1162426254 19:10598132-10598154 GCTGGGGACTGGGAAGGCTTTGG + Intergenic
1162479799 19:10921561-10921583 CCTGGGGGCTGGGCGGGCCAGGG + Intronic
1163034776 19:14564331-14564353 GGTGGGGGCGGGGCGGGGTGGGG - Intronic
1163125771 19:15243403-15243425 GCTGGGGGCCGGGCGGGCTTGGG + Exonic
1163304906 19:16471891-16471913 GGTACGGGCCGGGCGGGCCTGGG - Exonic
1163443517 19:17333664-17333686 GCGGGCGGGCGGGCGGGCTTGGG + Intronic
1163516479 19:17767029-17767051 GGTGGGGGGTGGGCGGGATTTGG - Intronic
1163535113 19:17872412-17872434 GCTGTGGGTCGGGCTGGCTCGGG + Exonic
1164594773 19:29525875-29525897 GGCGGGGGCGGGGCGGGCTGTGG + Intergenic
1165287347 19:34852992-34853014 CCTGGGGGCCAGGCGGGGTGAGG + Intergenic
1165325398 19:35111677-35111699 GGTGGGGGTGGGGAGGGCTTGGG - Intergenic
1165351526 19:35278529-35278551 GGTGGGGGCCGGCTGGGCTCAGG + Intronic
1165365029 19:35360015-35360037 GCTGGGGCCCGATGGGGCTTGGG + Exonic
1165366848 19:35372484-35372506 GCTGGGGCCCGATGGGGCTTGGG + Intronic
1165739836 19:38198547-38198569 GGTGGGGGCCTGGCGGGACTGGG - Intronic
1167211351 19:48135940-48135962 GCTGGGGAAGGGGCGGGCATGGG + Intronic
1167464303 19:49642190-49642212 GCGCGGGGCGGGGCGGGCTGGGG - Exonic
1167510038 19:49890991-49891013 GCTGTGGGCCCGGAGGGCCTCGG + Exonic
1167605722 19:50480505-50480527 GGTGGGGGCCGGGGGAGGTTAGG + Intronic
1167917526 19:52754236-52754258 GTTGGTGGCTGGGCTGGCTTAGG - Intergenic
1168255143 19:55160973-55160995 GCTGGGGGCGGGGCCTGCTGTGG + Intronic
1168350656 19:55674084-55674106 GGTGGGGGCAGGGCTGGCTGGGG + Exonic
1168468096 19:56620172-56620194 GCTGGGGTGCGGGAGGGCTGGGG + Intronic
1202687580 1_KI270712v1_random:59623-59645 GCTGGAGGCTTGGCTGGCTTGGG + Intergenic
924987893 2:288126-288148 GCTGGCGGGCGGGCGGGTTCCGG - Exonic
925743373 2:7024997-7025019 GCTGGGGGGCTGTTGGGCTTGGG + Intronic
926135153 2:10331162-10331184 GCAGAGGGCGGGGCGGGCTCTGG + Intronic
926683092 2:15678668-15678690 GCTGGGGGGCTGGAGGACTTGGG + Intergenic
926801827 2:16665896-16665918 GCTGGGGGCGGGGCGGGGCGGGG - Intronic
927103395 2:19805023-19805045 GCTGGGGGCAGCCCAGGCTTTGG + Intergenic
927596652 2:24403209-24403231 GCTGGGGGGAGGGCGGGCGGGGG - Intergenic
927709059 2:25314019-25314041 GCTGGGGGGCTGCTGGGCTTTGG + Exonic
927845985 2:26473145-26473167 GCTGGGGGCCGAGCGGTCTGGGG + Exonic
928453787 2:31401295-31401317 GATGGGGGCCAGGCAGGCATTGG + Exonic
929821890 2:45280869-45280891 GCTGGGTTCTGGGCGTGCTTTGG - Intergenic
929923930 2:46193766-46193788 GCTGGGAGCTTGGGGGGCTTGGG + Intergenic
930651744 2:53970818-53970840 GGTGGGGGCCGGGGAGGGTTCGG - Exonic
932191046 2:69741888-69741910 CCGGGGGACCGGGCGGGCCTGGG + Intronic
932433085 2:71686951-71686973 GTTGGGGGTGGGGTGGGCTTGGG + Intergenic
935237566 2:101151355-101151377 GCTGGGCACCGGCCGGGCTGTGG - Intronic
935918831 2:107986980-107987002 GCAGGGGGCCGGGAGAGCATCGG + Intronic
936025372 2:109027563-109027585 GCTGAGGCCCAGGAGGGCTTAGG - Intergenic
937221705 2:120345994-120346016 GGAGGGGGCCGGCCGGGCCTCGG - Intergenic
937999342 2:127719846-127719868 CCTGAGGGCCAGGCGGGCCTTGG + Exonic
938133892 2:128738163-128738185 GCAGTGGGACGGGAGGGCTTTGG - Intergenic
939912928 2:148005398-148005420 GCTGGGGGATGGGGGGGCTAAGG + Intronic
942748715 2:179264606-179264628 GCTGGGGGCGGAGCGGGCCCGGG + Exonic
943066547 2:183092397-183092419 ACTGGGGGCCTGTCGGGGTTAGG - Intronic
944659575 2:201910242-201910264 GATGGGGGCGGGGGGTGCTTTGG - Intergenic
945080760 2:206085231-206085253 GCGGGCGGCCTGGCGGGCGTGGG - Intronic
946020544 2:216636935-216636957 GCGGGCGGGCGGGCGGGCCTGGG + Intronic
946406765 2:219496041-219496063 GATGGGGCCCCGGGGGGCTTGGG + Intronic
947796726 2:232897686-232897708 ACTGGGGGCCGGGTGGGCCCTGG - Intronic
948116078 2:235494849-235494871 GGTGAGGGCCGGGCCGCCTTGGG + Exonic
948200151 2:236123968-236123990 GCTGGAGGCCTGCCGGGCGTAGG - Exonic
948438082 2:237967258-237967280 GCCGGGGGCCTGGCGGGCGCGGG + Intronic
948459783 2:238123594-238123616 TCAGGTGGCCAGGCGGGCTTGGG - Intronic
948625000 2:239263356-239263378 GCAGGGGACTGGGCGGGCTTCGG - Intronic
948850061 2:240701444-240701466 GCTGGGTGCCAGGGGGGCTGCGG - Intergenic
948874633 2:240820093-240820115 GCGGGAGGCCGGGCGGGCGGCGG + Intronic
1168766078 20:382031-382053 GCGGGGGGCGGGGCGGGGTGGGG + Intronic
1168769771 20:407980-408002 GCTGGGGGCGGGGCCGGGGTGGG - Intronic
1169119134 20:3084819-3084841 GCTGGGGACCTGGCGGCCGTGGG - Intergenic
1171121505 20:22572663-22572685 GCTGGGGCCAGGGCGTGCTGGGG + Intergenic
1171427580 20:25058233-25058255 GGTGGGACCCGGGCGGGCTCCGG - Intronic
1171810674 20:29742876-29742898 GGTGGGCGCCGGGAGGGTTTGGG - Intergenic
1171848204 20:30290586-30290608 GCCGGGGGCGGGGCCGGCCTGGG + Intergenic
1172408475 20:34705768-34705790 GCTGGGGGTAGGGGTGGCTTAGG + Intronic
1172702906 20:36863615-36863637 GCGGGGGCCCGGGCGCGCTCCGG - Exonic
1172904473 20:38358651-38358673 GCTGGGGGCTGGGAGGGCAAAGG - Intronic
1172962161 20:38806716-38806738 GCTGGAGGCCGGGCCGGGGTGGG - Intronic
1173827596 20:46057628-46057650 GCCGCGGGCCGGGCGCGCTCGGG - Exonic
1174420579 20:50396648-50396670 GCTGGGGGCCTGGCGGGCAGGGG + Intergenic
1174475667 20:50794427-50794449 GGTGGGGGGCGGGCGGCTTTGGG + Intergenic
1174777713 20:53361056-53361078 CCTGGGGGCTGGGCGGGCAGCGG - Intronic
1175390890 20:58626656-58626678 GCTGGGAGCCTGGGGGGCTCTGG - Intergenic
1175802165 20:61807110-61807132 GCTGGGGGCTGGCGGGGCTGCGG - Intronic
1175859873 20:62144155-62144177 GGTGGGGGCCGGGCGGACGCTGG + Intronic
1175965297 20:62657323-62657345 GCAGGGGGCGGGGCTGGCTCCGG - Intronic
1175994029 20:62804531-62804553 TCTGGGGGGCGGGCAGGCTTTGG + Intergenic
1175994238 20:62805163-62805185 GCTGGGGGTCGGCCGGTCTGGGG - Intronic
1175994350 20:62805422-62805444 GCTGGGGCCCGGGCCGGGTCTGG + Intronic
1176025907 20:62985562-62985584 GGCGGGGCCCGGGCGGGCTGGGG + Intergenic
1176040744 20:63064559-63064581 GCTGGAGGCCGCCCGGGCTCTGG + Intergenic
1176139365 20:63538286-63538308 GCTGGGGGGCAGGCGGCCGTCGG - Intergenic
1176177761 20:63736735-63736757 GCTGGGGTCTGGGAGGCCTTGGG + Intronic
1176194620 20:63831413-63831435 GCCGGCGGCCGGGCCGGCGTGGG - Intergenic
1176231828 20:64036862-64036884 GCTGGGGGCCTGGTGGGCGGTGG - Intronic
1176366110 21:6033911-6033933 GATGGAGGCCGGGCGAGCTCCGG + Intergenic
1178843326 21:36155962-36155984 GCAGGGGGCGCGGCGGGCTTGGG - Intergenic
1178950386 21:36980824-36980846 GCTGGGGCGCGGGCAGGATTTGG - Intronic
1179248683 21:39655429-39655451 GCTGGGTGCCGGGAGGACTTGGG + Intronic
1179495165 21:41766808-41766830 GCTGGGGCCCGGGCTGGGGTCGG - Intronic
1179655521 21:42842085-42842107 GCAGGTGACCGGGCGGGCTGTGG + Intergenic
1179757407 21:43504634-43504656 GATGGAGGCCGGGCGAGCTCCGG - Intergenic
1179985619 21:44919108-44919130 GCAGGTGACCGGGCGGGCTGTGG - Intronic
1180042528 21:45287657-45287679 GATGGGGGCGGGGCGGGGTCAGG - Intronic
1180064303 21:45405076-45405098 GCAGGGGGCGGGGCGGGCGCGGG - Intergenic
1180180294 21:46115940-46115962 GCTGCAGGCGGGGCGGGCGTGGG - Intronic
1180182873 21:46125647-46125669 GCGGGGGGCCGGGCGGGGCGTGG + Intronic
1180737000 22:18024556-18024578 GCTGCTGGCTGGGCGGGCTGCGG + Exonic
1181059927 22:20277400-20277422 GCTGGGGGCCGAGCGTGGTATGG + Intronic
1181277231 22:21694695-21694717 GCTGGGGGCCAGGCAGGCAGGGG + Intronic
1181464701 22:23104667-23104689 GCTGGGGGCCTTGCTGACTTGGG + Intronic
1181630181 22:24147075-24147097 GCTGGGGGCAGAGGGGGCTGTGG - Intronic
1181670608 22:24424033-24424055 GCTGGTGGCCGGGCGGCGTGGGG + Intronic
1182445401 22:30386887-30386909 GCTGGGGGCCTGGGGAGCCTGGG + Intronic
1183216136 22:36481470-36481492 GCTGGCGGCCGGGCGGGCGGGGG - Intronic
1183344189 22:37298078-37298100 GCTGGGGACCGGCCAGGCTCGGG + Intronic
1183490398 22:38112610-38112632 GGTGCGGGCCGGGCGGGGTGTGG - Intronic
1183731742 22:39622300-39622322 GCTGGGGGTCGGGAGGCCTCCGG + Intronic
1184719311 22:46300640-46300662 GCTAGGTGCCAGGCAGGCTTGGG - Intronic
1185046450 22:48530958-48530980 GCTGGGGTCGGGGCGGGCAGGGG - Intronic
1185290766 22:50026138-50026160 GCAGGGGACCAGGCGGGCTCTGG + Intronic
1185291594 22:50030319-50030341 GCGGGGCGCAGGGCAGGCTTCGG - Intronic
1185409380 22:50674287-50674309 GGCGGGGGCCGGGAGGGCTCAGG - Intergenic
950425322 3:12922098-12922120 GGTGGGGCCCGGGCTGGCTGGGG - Exonic
950434147 3:12968342-12968364 GTAGGGGGCTGGGTGGGCTTAGG - Intronic
950533599 3:13567108-13567130 GCTGGGGGCCTGGGGGGCCAAGG + Intronic
952354253 3:32570304-32570326 GCTGGGGGCCGGGCGGGGCGGGG + Intronic
953385898 3:42505488-42505510 GCTGGGGGCCAAGAGGGCCTGGG - Intronic
953405592 3:42658210-42658232 GCTGGGGGAAGGGCGGGCAGGGG + Intronic
953569035 3:44057166-44057188 TGTGGGGGCCGGGTGGGGTTAGG - Intergenic
953788602 3:45929503-45929525 GCTGGGGGCCTGGTGGGTCTGGG + Intronic
953909205 3:46883292-46883314 GCCGGAGGCCGGGCGGGCGGCGG - Intronic
954035781 3:47850302-47850324 GCTGGGGAACGGGCTGGCTGTGG + Intergenic
954361311 3:50124281-50124303 GCCGGGGCCAGGGCGGGGTTGGG - Intergenic
954611503 3:51946879-51946901 GCCGGGGGCAGGGTGGGCTAGGG + Intronic
954676803 3:52320388-52320410 GCTGGAGGCAGGTCGGCCTTTGG + Intronic
956747089 3:72318820-72318842 GCTGGGGGCCAGGCTGGGCTGGG - Intergenic
958798782 3:98733048-98733070 GCCGGGGTCCGGGCGGCCTGGGG + Intronic
959108351 3:102092104-102092126 GCAGGGTGCAGGGTGGGCTTTGG + Intergenic
960338325 3:116445418-116445440 GCTGGCGGGCGGGCGGGCGAGGG + Exonic
960702476 3:120451305-120451327 GCGGCGGCCCGGGCGGGCTGCGG + Intergenic
961823827 3:129588564-129588586 GCTGTGGGCTGGGTGGGCGTGGG - Intronic
962816592 3:139006137-139006159 GCTGGGCGCCACGCGGGGTTCGG + Exonic
962818091 3:139020530-139020552 GCTGGGTGCCGCGCGGGGTTCGG + Exonic
962820585 3:139044489-139044511 GCTGGGCGCCGCTCGGGATTCGG + Exonic
966182122 3:177197281-177197303 GATGGGCGCCGGGCGGGCGGGGG + Intronic
966912182 3:184565760-184565782 GCTGGGGGCCGGCAGGTATTTGG + Intronic
966914745 3:184578490-184578512 GCAGGGGGCTGGGAGAGCTTGGG - Intronic
968085049 3:195870475-195870497 GCTGGGGGCCTGGGGGGTTGTGG - Intronic
968156875 3:196388296-196388318 GCTGGGGGGCTGGGGGGCTGGGG + Intronic
968369392 3:198213369-198213391 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
968451443 4:677809-677831 GCTGGGGGCCTTGCGGGGTGAGG + Intronic
969114082 4:4860407-4860429 GGTGGGGGCCGGGTGGGGTGTGG + Intronic
969235939 4:5865096-5865118 CCTGGGGCCCGTGTGGGCTTTGG - Intronic
969245804 4:5932040-5932062 GGTGGGGGGCGGGGGGGCGTTGG - Intronic
970117737 4:12718302-12718324 GATGTGGGCAGGGTGGGCTTGGG + Intergenic
975992150 4:80268203-80268225 GCTGGGGGCAGGGACGGTTTGGG + Intronic
977949671 4:102955511-102955533 GCTGGGGGCAGGGGTGGATTTGG + Intronic
979257819 4:118623083-118623105 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
980562971 4:134501937-134501959 GCGGGGGGCTGGGCGGGGGTGGG - Intergenic
980969425 4:139555661-139555683 GCTGGCGGCCGGGAGGGGATCGG + Intronic
981128616 4:141133390-141133412 GCCGCGGGCGGGGCGGGCTTGGG + Intronic
981154080 4:141413463-141413485 GCTGGGTGCAGGGCTGGCCTTGG + Intergenic
982364481 4:154560118-154560140 GCTGGGGGCCGGGGAGACCTTGG - Intergenic
982974212 4:162032888-162032910 GCTTGGGGCCGGGATGCCTTTGG + Intronic
985489496 5:171155-171177 GCTGAGGGCCGGGCAGGCTGTGG - Intronic
985640791 5:1062672-1062694 GCTGGGGGGCTGGGGGGCTGGGG + Intronic
985696608 5:1344642-1344664 GCCGGGGGCCGGGCGGGTTGGGG - Intronic
985698447 5:1356444-1356466 GCTGGGGGCCGTGGGAGCCTGGG + Intergenic
985707035 5:1407396-1407418 TCTGGGGGCCGAGGGGCCTTGGG - Intronic
985936474 5:3101515-3101537 CCTGGGGGCCGGGCTGGGTTGGG - Intergenic
986171487 5:5318185-5318207 GCTGGGGGCCGGCCGGCCTCAGG + Exonic
987085136 5:14461095-14461117 GCTTGGGGCCCGGCGAGCTCTGG - Exonic
992528001 5:77630231-77630253 GCTGGGGGCGGAGCGGGCCGGGG + Exonic
992641732 5:78773650-78773672 GCTGGGGTCTGGCCGGGCTTGGG + Intergenic
994549551 5:101213336-101213358 GGTGGGGGCGGGGCGGGTCTCGG + Intergenic
995022376 5:107381038-107381060 GCTGGGGGTGGGGCGGGGTGGGG + Exonic
996874343 5:128224846-128224868 GTTGGGGGCAGGGTGGACTTTGG - Intergenic
997207733 5:132059865-132059887 GCTGGGGGAGGGGCTGGCCTGGG - Intergenic
997470492 5:134114658-134114680 GCCGGGGGCGGGGCGGGCACTGG - Intergenic
997521120 5:134525341-134525363 CCTGGGGACAGGGCGGGCTAGGG + Intronic
998230320 5:140357522-140357544 GCTGGGGGTAGGGCCGGCCTGGG + Intergenic
1000353373 5:160370416-160370438 GCTGCGGGCGGGGCGGGATGCGG - Intronic
1001106070 5:168855712-168855734 GCTGGGGGCAGGGAGGGAATGGG + Intronic
1001261452 5:170233121-170233143 GCGGTGGGCCGGGCTGGCCTCGG + Exonic
1001264879 5:170266938-170266960 GCTGGGGGTTGGGCGGGGCTAGG + Intronic
1001382684 5:171314699-171314721 GTGGGGGGCCGGTCTGGCTTCGG + Intergenic
1001838416 5:174852428-174852450 GCTGGGGGCTGGGAGAGCTGGGG + Intergenic
1002053376 5:176584525-176584547 GCTGGGGGCTGGGTGGGCTGAGG + Exonic
1002099763 5:176851600-176851622 GCTGGGGGCGGGGCTGGCCATGG + Intronic
1002497072 5:179622963-179622985 GCTGGCGGGCGGCCGGGCTGGGG - Intronic
1002728671 5:181318954-181318976 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
1003290737 6:4776486-4776508 CCGCGGGGCCGGGCGGGCTGGGG - Exonic
1003735755 6:8876100-8876122 GCTGGGGGCAGGGCGGTGGTGGG + Intergenic
1003874553 6:10424262-10424284 GCTGGGTGCCTGGCGGGGATGGG + Intergenic
1003948222 6:11094191-11094213 GCTGGGCGCCGGGGCGGCATGGG - Exonic
1004093739 6:12532055-12532077 GCTGGTGGCCACGCGGGCTTTGG + Intergenic
1004229021 6:13814375-13814397 GCTGGCGGCCGGGCAGGCGCTGG + Exonic
1004362128 6:14980521-14980543 GGTGGGGGGCGGGCAGGCATTGG - Intergenic
1006123474 6:31822056-31822078 CCTGAGGGCGGGGCTGGCTTCGG - Intergenic
1006187574 6:32189860-32189882 GGCGGGGGCCGGGGGGGCCTGGG - Exonic
1006369211 6:33633807-33633829 GCTGGGGGCGGGGCGGGCGCGGG + Intronic
1006511654 6:34524879-34524901 GCTGGGGGGCGGGCAGGAGTTGG - Intronic
1006606298 6:35259881-35259903 GCGGGAGGCCGGGCGGGCGCAGG + Intronic
1006910829 6:37562473-37562495 GCTGGGGGTCAGGCAGGCCTGGG + Intergenic
1007359172 6:41342833-41342855 GCTGGAGGAGGGGCAGGCTTGGG + Intronic
1007423906 6:41735044-41735066 GGGAGGGGCCGGGCGGGCATGGG - Intronic
1007450109 6:41935997-41936019 GCTGGAGCCCCGGGGGGCTTTGG + Exonic
1007591206 6:43021791-43021813 GCATGGGGCAGGGCGGGCTGGGG + Intronic
1013196512 6:107849092-107849114 GCTGGGGGACGGGCGGGGTGGGG - Intergenic
1014143086 6:117966140-117966162 GCTTGGGGCGGGGCGGGAGTGGG - Intronic
1017894563 6:158668140-158668162 CCTGGGGGCCGGGGGGACCTGGG - Intronic
1018840690 6:167514318-167514340 GCTGGGGGCTGGCAGGGCTGGGG + Intergenic
1018935978 6:168274285-168274307 GTTGGGGGCAGGGCGGGGCTGGG - Intergenic
1019494103 7:1329570-1329592 GCTGGGGGCCTGGGAGGCTGGGG + Intergenic
1019494592 7:1331947-1331969 GCTGGGGGCAGGGCCGGATCTGG - Intergenic
1019529082 7:1494744-1494766 GCGGGGTGCCGGGCCGGCTGCGG - Intronic
1019727801 7:2612575-2612597 GCTGTGGGCGGGGCGAGCTGTGG + Exonic
1020037718 7:4974655-4974677 GCTGGGGGCTGGCCCGGCTCGGG + Intergenic
1020094677 7:5361753-5361775 GCTGGGGGGCGGGCGGGGCGCGG + Intronic
1020162100 7:5780972-5780994 GCTGGGGGCTGGCCCGGCTCGGG - Intronic
1020261098 7:6531221-6531243 GCTGCGGGCCGGGACGGCTCGGG - Intronic
1021668674 7:23013700-23013722 GCTGGCGGGCGGGTGGGCTGCGG - Intronic
1022466961 7:30658427-30658449 GCTGGGGGCCTGGAGGGGTTGGG + Intronic
1023399806 7:39784369-39784391 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
1024072738 7:45800153-45800175 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
1024650599 7:51400028-51400050 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
1025054719 7:55755611-55755633 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
1025132789 7:56385836-56385858 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
1025184434 7:56846244-56846266 GCTGGGGACTGGGGAGGCTTAGG - Intergenic
1025687493 7:63730724-63730746 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
1025911205 7:65830231-65830253 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
1029734127 7:102456117-102456139 GCTGGGTGCGGGGCAGGCTGTGG - Exonic
1030675800 7:112384324-112384346 GCTGGGAGCATGGCTGGCTTGGG - Intergenic
1032020710 7:128405971-128405993 GCCGCGGGCCGGGCGGGCCGGGG + Intronic
1033595369 7:142855030-142855052 GGGGCGGGCCGGGCCGGCTTGGG + Intergenic
1034237302 7:149582400-149582422 GCTGGAGGGCTGGCGGGCTTGGG - Intergenic
1034240324 7:149605836-149605858 GCTGGAGGGCTGGCGGGCTTGGG - Intergenic
1034243910 7:149630282-149630304 GCTGGAGGGCTGGCGGGCTTGGG - Intergenic
1034275319 7:149821445-149821467 GCTGAGGGCAGGGCTGGCTCTGG - Intergenic
1034421652 7:150993909-150993931 GCTGGGGCCCGGCTGGGCTCAGG - Exonic
1035121646 7:156573246-156573268 GCTGGGTGCAGGGCCGGCGTTGG - Intergenic
1035285720 7:157805649-157805671 GGTGGGGGCAGGGCAGGCCTTGG + Intronic
1035392941 7:158517486-158517508 GCTGGGGGGCGGTGGGGCTGAGG - Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1036661673 8:10713352-10713374 GCTGGGGACCGGGCGTGGGTAGG + Intergenic
1036687987 8:10924491-10924513 ACTGGGGGCCGGGCGTCCTGGGG + Intronic
1036691554 8:10947821-10947843 TCTGGGAGCCAGGAGGGCTTTGG + Intronic
1037885461 8:22593906-22593928 GCTGAGGGCATGGCGGGCTCAGG - Exonic
1037935264 8:22911328-22911350 GCTGGGGGCTGGGCTGGCAGGGG - Intronic
1037987287 8:23297927-23297949 GGTGGGGGCCGGGCTGGGTGAGG + Exonic
1039476286 8:37841011-37841033 GCTGGGGGCCGGGGTGGTTGGGG - Intronic
1040981502 8:53250736-53250758 GCTGGGGGCTGGGCGGGGCAGGG - Intronic
1043884119 8:85579111-85579133 GCAGGGGCCCGGGAGGGATTGGG - Intergenic
1044611912 8:94099758-94099780 GTTGGGGGCAGGGGGGGCTCTGG + Intergenic
1045454804 8:102367443-102367465 GCTGGGGGCGGGGCTGGAGTGGG - Intronic
1045664058 8:104466974-104466996 TGGGCGGGCCGGGCGGGCTTGGG + Exonic
1047739395 8:127794570-127794592 CCCGCGGGCCGGGCGGGCTCGGG + Intergenic
1047753033 8:127896933-127896955 CCTGGGGGCTGGGCGGGCGGTGG + Intergenic
1048234350 8:132675340-132675362 GCGGAGGGCCGGGTGGGGTTAGG + Intronic
1048886525 8:138914090-138914112 GCTGGGGCGGGGGCGGGCCTAGG + Intergenic
1049217191 8:141413583-141413605 GCTGGGGGCAGGGAGGGTTAGGG + Intronic
1049418793 8:142507682-142507704 GCAGGGAGCCGGGCTGGCTGGGG - Intronic
1049427059 8:142542404-142542426 GCTGGCGGGAGGGCGGGCTGCGG - Exonic
1049569303 8:143360935-143360957 GCTGGGGGCGGGGGGGCGTTGGG + Intergenic
1049613681 8:143567315-143567337 GGTGGGGGCCGGGCGGGGCGCGG + Exonic
1049614041 8:143568645-143568667 GCCGGGGCCGGGGCGGGCTCCGG - Exonic
1049697158 8:143990017-143990039 GGGCGGGGCCGGGCGAGCTTCGG - Intronic
1049799153 8:144509765-144509787 GCTGGGGGCCGCGCTAGCTGGGG + Exonic
1049987205 9:962526-962548 GCTGTGGTCCAGGAGGGCTTGGG + Intronic
1050279920 9:4039651-4039673 GCTGGGAGCCAGGCAGGCTCTGG - Intronic
1051896476 9:21994484-21994506 GGTGGGGGGCGGGCGCGCTCAGG - Intronic
1053129829 9:35608614-35608636 GCTGGGGGTCGGGCTGGGGTAGG + Intronic
1053416778 9:37951823-37951845 TCTGGGGGCCGGGCCGGCACTGG + Intronic
1054781933 9:69173981-69174003 GCTGCGGGCCGCTCGGGCCTTGG + Intronic
1055863676 9:80786308-80786330 GTTGGGGGGTGGGAGGGCTTGGG + Intergenic
1056570993 9:87814565-87814587 GCTGGGGTCAGGGTGGCCTTAGG - Intergenic
1056702711 9:88924288-88924310 GGTGGGGGTCGGGGGGACTTGGG + Intergenic
1056767647 9:89454817-89454839 GCTGGGGGCTGGGAGTGCTGTGG - Intronic
1056780346 9:89544446-89544468 GCTGGGAGCCTGGCTGGCTTAGG - Intergenic
1057146972 9:92764947-92764969 GCCGGGGGCCGGGCGGGCGCCGG - Intergenic
1057205724 9:93171275-93171297 GCTGGGGGCTGGGCAGGGGTGGG - Intergenic
1057311694 9:93947341-93947363 GCTTGGGGCGGGGCGGGGTGGGG - Intergenic
1057516824 9:95729159-95729181 GCTTGGGGCGGGGCGGGCCCCGG - Intergenic
1058053430 9:100427644-100427666 GCTGGGAGCGGGGTGGGCTTTGG + Intronic
1058990881 9:110255150-110255172 GTTTGGTGCCGGGTGGGCTTCGG - Intronic
1059165083 9:112069682-112069704 GGTGGGGGCGGGGCGGGGTGGGG - Intronic
1059405882 9:114098234-114098256 GGTGGGGGCTGGGGGTGCTTCGG + Intronic
1060551386 9:124487063-124487085 GCCGGGAGCTGAGCGGGCTTGGG - Intronic
1060825110 9:126683297-126683319 GCCGCGGGCCGGGCGGGCGGCGG - Intronic
1061079439 9:128361240-128361262 TCTGGGGTCAGGGTGGGCTTGGG - Exonic
1061422133 9:130478225-130478247 CCTGGGGGCCCGGCTGCCTTTGG - Intronic
1061486565 9:130923445-130923467 GCAGGGGGTGGGGCGGGGTTTGG - Intronic
1061537383 9:131258484-131258506 GCTGGGGGCCGGGCATGCAGTGG + Exonic
1062174169 9:135151741-135151763 CCTGGGGGACGGGAGGTCTTTGG - Intergenic
1062214262 9:135380650-135380672 CCTGGGGGCGGCGGGGGCTTTGG - Intergenic
1062416123 9:136451209-136451231 CCTGGCGGCCGGGAGGGTTTGGG - Intronic
1062421365 9:136484119-136484141 GCTGGGGCCAGGGTGGGCCTGGG - Exonic
1062447304 9:136600313-136600335 GCTGGGGGCAGGGAGGGCCGGGG + Intergenic
1062447601 9:136602155-136602177 GCAGGTGGGCGGGCGGGGTTGGG + Intergenic
1062658096 9:137614486-137614508 GCTGGGGGCTGGGTGGTCTGAGG + Intronic
1062753733 9:138276053-138276075 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
1203576246 Un_KI270745v1:10832-10854 GCTGGGGACTGGGGAGGCTTAGG + Intergenic
1185839009 X:3371341-3371363 GCTGGAGGCTGGGCAGGCCTTGG - Intergenic
1187115722 X:16348280-16348302 TCTGGGGGCCTGGAGAGCTTTGG + Intergenic
1189381422 X:40505207-40505229 GGTGGGGGCCTGGAGGGCTGTGG + Intergenic
1191954886 X:66633619-66633641 GCTGAGTGCCGGTCTGGCTTGGG - Intronic
1198411377 X:136372965-136372987 GACGGTGGCCGGGCTGGCTTTGG + Exonic
1199744888 X:150766217-150766239 GCTGGGGGCGGGGCGGGGGGAGG + Intergenic
1199772628 X:150984123-150984145 GCGGGGCGCCCGGCGGGCTCCGG + Intronic
1200101118 X:153689407-153689429 GCGGGCGGGCGGGCGGGCATGGG - Intronic