ID: 1163126457

View in Genome Browser
Species Human (GRCh38)
Location 19:15246795-15246817
Sequence TGGGGGCCCCAGCACTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 205}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163126457_1163126471 14 Left 1163126457 19:15246795-15246817 CCTTGCAAGTGCTGGGGCCCCCA 0: 1
1: 0
2: 2
3: 30
4: 205
Right 1163126471 19:15246832-15246854 AAAAAGTGGGGGAGAGAAGGCGG 0: 1
1: 0
2: 13
3: 207
4: 1909
1163126457_1163126466 1 Left 1163126457 19:15246795-15246817 CCTTGCAAGTGCTGGGGCCCCCA 0: 1
1: 0
2: 2
3: 30
4: 205
Right 1163126466 19:15246819-15246841 GCAAGGCAGGCCTAAAAAGTGGG 0: 1
1: 0
2: 0
3: 6
4: 140
1163126457_1163126472 25 Left 1163126457 19:15246795-15246817 CCTTGCAAGTGCTGGGGCCCCCA 0: 1
1: 0
2: 2
3: 30
4: 205
Right 1163126472 19:15246843-15246865 GAGAGAAGGCGGCATGTGCACGG 0: 1
1: 0
2: 2
3: 30
4: 369
1163126457_1163126465 0 Left 1163126457 19:15246795-15246817 CCTTGCAAGTGCTGGGGCCCCCA 0: 1
1: 0
2: 2
3: 30
4: 205
Right 1163126465 19:15246818-15246840 GGCAAGGCAGGCCTAAAAAGTGG 0: 1
1: 0
2: 0
3: 14
4: 168
1163126457_1163126470 11 Left 1163126457 19:15246795-15246817 CCTTGCAAGTGCTGGGGCCCCCA 0: 1
1: 0
2: 2
3: 30
4: 205
Right 1163126470 19:15246829-15246851 CCTAAAAAGTGGGGGAGAGAAGG 0: 1
1: 0
2: 1
3: 40
4: 375
1163126457_1163126468 3 Left 1163126457 19:15246795-15246817 CCTTGCAAGTGCTGGGGCCCCCA 0: 1
1: 0
2: 2
3: 30
4: 205
Right 1163126468 19:15246821-15246843 AAGGCAGGCCTAAAAAGTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 145
1163126457_1163126467 2 Left 1163126457 19:15246795-15246817 CCTTGCAAGTGCTGGGGCCCCCA 0: 1
1: 0
2: 2
3: 30
4: 205
Right 1163126467 19:15246820-15246842 CAAGGCAGGCCTAAAAAGTGGGG 0: 1
1: 0
2: 1
3: 9
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163126457 Original CRISPR TGGGGGCCCCAGCACTTGCA AGG (reversed) Intronic
900203305 1:1420724-1420746 TGGGGGTCCCAGCACTGGGTGGG - Intronic
900319535 1:2075757-2075779 TGGGTGCCCCAGACCTTCCACGG + Intronic
900399621 1:2467618-2467640 TGGGGGCCCAGGCTCTTCCATGG - Intronic
900621833 1:3591076-3591098 GAGGGGCTCCAGCACCTGCAGGG + Intronic
900637144 1:3671538-3671560 TGGAGGCCCCGGCTCCTGCAGGG - Intronic
900932319 1:5745119-5745141 TGGGGGCCCCTCCTCCTGCACGG - Intergenic
901692402 1:10982011-10982033 GGGGGTCCCCAGCACTTGCCTGG - Exonic
902109672 1:14067755-14067777 TGGTTGCCCCAGAACTTTCAAGG - Intergenic
902399231 1:16148852-16148874 TGGTGGCGCCAGCTCCTGCAAGG - Exonic
903734858 1:25523634-25523656 TGGTGGATTCAGCACTTGCATGG + Intergenic
903766921 1:25740994-25741016 TGGGGGCCACAGCTCTTGGGAGG + Intronic
905171547 1:36112790-36112812 ATGGGGCCCCAGAACCTGCATGG - Intronic
905302358 1:36994057-36994079 TAGGGGACCCAGCCCATGCATGG + Intronic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
912753436 1:112304487-112304509 TGTGGGCCCCGGCCCTTGCTGGG - Intergenic
913488848 1:119359298-119359320 TTAGGGCCCCAGCACTTCCCAGG - Intergenic
918047115 1:180948184-180948206 CGGAGGCCCCAGCACTCGCCAGG - Exonic
924739151 1:246784763-246784785 TGGCAGCCCCAGCACCTGGAGGG + Intergenic
1062824631 10:558572-558594 GGTGGGCCCCCGCACTGGCATGG - Intronic
1063372551 10:5531298-5531320 CAGCGGCCCCAGCACCTGCATGG - Intergenic
1071524529 10:86350475-86350497 TGGGAGGCCCAGCACATACAAGG + Intronic
1072535462 10:96359447-96359469 TGGGGGCTCCAGCTGCTGCAAGG + Intergenic
1074085750 10:110208090-110208112 TGGGGGCCCCTGCTCTTCCTCGG + Intronic
1075277999 10:121112767-121112789 TTGGGGCCCCAGCATGTGCCTGG - Intergenic
1075517055 10:123117846-123117868 TGGGGGTCCCAGCACCTGGCTGG + Intergenic
1076183463 10:128428912-128428934 TGGGGGCTCTAGCTTTTGCAGGG + Intergenic
1076887209 10:133268295-133268317 TGGGGCCCCCAGGACATGGAGGG - Intronic
1077173313 11:1177949-1177971 TGGGGACCCCGGCAGATGCAAGG - Intronic
1078730066 11:13965415-13965437 TGGTGGCCCTAGCACTGGGAAGG + Intronic
1079082672 11:17424773-17424795 TGGGGGCCCCAGCAGTGACCAGG + Intronic
1079318802 11:19432661-19432683 TGGGGGCCCCAGCTCCTTCCTGG - Intronic
1082030643 11:47600977-47600999 TCGTGGCCCCACAACTTGCATGG - Intergenic
1083815896 11:65132355-65132377 TGGGGACCCCCACACATGCAGGG + Intronic
1084113375 11:67027663-67027685 CGGGGGCCCCATCACCTCCATGG - Intronic
1084547403 11:69821305-69821327 TGGGGCCCCCAGCAGTTCCCAGG + Intergenic
1085252534 11:75153037-75153059 TGGCTGCCCCAGCACTTGCAGGG - Intronic
1085869661 11:80334487-80334509 TGGGTGCCCAAGAACCTGCAAGG + Intergenic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1092961179 12:13598150-13598172 TGGGGAGCCCAGAACTTGCCTGG - Intronic
1093631430 12:21413918-21413940 TGAGGGCTCCAGTACTTTCAAGG - Intronic
1093931672 12:24960659-24960681 TGGTGGCACAAGCACTTGCTTGG - Intergenic
1095908992 12:47406494-47406516 AGGGTGTCCCAGCTCTTGCATGG - Intergenic
1096069786 12:48768587-48768609 TGGGGGCCCCAGCAGTTAACAGG - Exonic
1105209303 13:18248278-18248300 TGTGGGCTTCAGCACCTGCAGGG - Intergenic
1105645244 13:22311312-22311334 TGGTGGCCCCAGGCCTTGCTTGG - Intergenic
1106418207 13:29563730-29563752 TGGGTCTCCCAGCACATGCAGGG + Intronic
1109255525 13:60075975-60075997 TGGGGGTCACTGCACATGCAGGG + Intronic
1109886567 13:68552945-68552967 TGGGGGCCCCACCCCTTGCCAGG + Intergenic
1117074794 14:52091129-52091151 TGTGGGCACCAGCACTGGCGTGG - Intergenic
1121652080 14:95566145-95566167 AGGGGGTTCCAGCTCTTGCAGGG - Intergenic
1121711815 14:96044075-96044097 TGGCCCCCCCAGCTCTTGCAGGG - Intronic
1122182412 14:99965848-99965870 TGTGGGCCCCAGTACCTTCAAGG + Intergenic
1122413213 14:101536431-101536453 TGGATGCCCCAGCACTTGCCTGG - Intergenic
1122651618 14:103229798-103229820 TGGGGCCCCCAGGAGTTGGAGGG + Intergenic
1123055159 14:105566072-105566094 TGAGGGGCCCAGCAGGTGCACGG + Intergenic
1123079608 14:105685916-105685938 TGAGGGGCCCAGCAGGTGCACGG + Intergenic
1123203720 14:106692156-106692178 TGGGGCCCTCAGGACCTGCAGGG - Intergenic
1123437320 15:20264187-20264209 TGGGGGAGCCAGCACTTGTAGGG - Intergenic
1124383123 15:29184543-29184565 TGGAGGCCCCAGGATGTGCAGGG - Intronic
1124595562 15:31088960-31088982 TGGGGCTCCCAGCACTTTCTTGG + Intronic
1125685243 15:41559701-41559723 TGGGGTCCCCAGTACTGGGAAGG - Intronic
1128498501 15:68211366-68211388 TTGGGGCCCCAGCACCTCCCTGG - Intronic
1130944452 15:88540499-88540521 AGGGGGCTCCAACACTTGCAAGG - Intronic
1132865880 16:2092508-2092530 TGGGGGCCCCAGCTCTGGGCTGG + Exonic
1133127188 16:3654598-3654620 TGGGGGCCACCACACGTGCAAGG + Intronic
1133136587 16:3716888-3716910 TGGCGTCCCCAGAACCTGCACGG + Intronic
1133255049 16:4511611-4511633 TGAGGGGCCCGGCACTTACAGGG + Exonic
1133491487 16:6274036-6274058 TGGCAACCCCAGTACTTGCAAGG + Intronic
1134070015 16:11255216-11255238 TGGGGGCCCCTGAGCGTGCACGG - Exonic
1135928830 16:26719126-26719148 TGGGGGCACCAGCAAATGAATGG + Intergenic
1135993127 16:27229444-27229466 TGTGGGGCCCAGCACTTGGCAGG + Intronic
1136355829 16:29744476-29744498 TGGGGGCCCCAGCCCTGGGAGGG - Exonic
1136847252 16:33586645-33586667 TGGGGGAGCCAGCACTTGTAGGG + Intergenic
1138656120 16:58492423-58492445 TGGGGGCCCCAGGAGATGAAGGG - Intronic
1141655975 16:85416754-85416776 TGAAGGCCCAAGAACTTGCATGG + Intergenic
1142037642 16:87871533-87871555 TAAGGGCTCCAGCACTTGCCAGG - Intergenic
1203108960 16_KI270728v1_random:1435300-1435322 TGGGGGAGCCAGCACTTGTAGGG + Intergenic
1142697958 17:1643940-1643962 TCGGGGCCCCAGTACTGGCCCGG + Exonic
1143966763 17:10761122-10761144 TGGGGACCCCGGCACTCACACGG + Intergenic
1144437075 17:15251674-15251696 TGTGGCCCCCAGCACTGGCAGGG + Intronic
1146927000 17:36752095-36752117 TGGGGGACACAGCAAGTGCAGGG + Intergenic
1147139168 17:38451980-38452002 TGGGGGGTCCAGCTCTTGCACGG + Intronic
1147240859 17:39089711-39089733 TGGGGCACCCAGCAGTGGCACGG - Intronic
1148147899 17:45377551-45377573 GGGGGGCACCAGCACTGGCAGGG - Intergenic
1150125452 17:62631951-62631973 TGGGGGTCCCTGGACTTGGAAGG + Intronic
1150282037 17:63934425-63934447 CGGGGGCCCCACCGCCTGCAGGG + Intergenic
1150284645 17:63948065-63948087 TGGGGGCACCAGCACCACCAGGG + Intronic
1151391690 17:73791479-73791501 TGGGTGCACCTGCACATGCAGGG - Intergenic
1151568959 17:74916490-74916512 TGGGGGCCCCAGGAGATGCTGGG + Exonic
1152181645 17:78825802-78825824 CGGTGTCCCCAGCACCTGCAGGG - Intronic
1152529669 17:80910184-80910206 CGGGGAGCCCAGCACTTTCAGGG - Intronic
1152676898 17:81646000-81646022 TGCGGCCCCCAGAACGTGCAGGG + Intronic
1154325993 18:13390763-13390785 TGGGTGCGCCAGCACCTGCAGGG + Intronic
1154437960 18:14361069-14361091 TGGGGGCACCAGTGCCTGCACGG + Intergenic
1155506536 18:26538895-26538917 TGGGGCCCCCAGCCTTTGCTGGG - Intronic
1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG + Intronic
1160046596 18:75392299-75392321 TGGTGGCTCCAGCTCTTTCATGG + Intergenic
1161395929 19:4045001-4045023 TGGGGGCCACAGCCTCTGCATGG - Exonic
1161429440 19:4222909-4222931 TGGGGTCCACATCACATGCACGG + Intronic
1161774214 19:6249621-6249643 TGGGGGCTCCAGCTCTTCAAGGG - Intronic
1162013051 19:7829777-7829799 TGGCGCCCCCAGCAGTTGCCAGG + Intergenic
1163126457 19:15246795-15246817 TGGGGGCCCCAGCACTTGCAAGG - Intronic
1163772353 19:19198748-19198770 TGGGGGCCCCAGCACTCCAGCGG + Intronic
1165033305 19:33014094-33014116 TGGGGGAGCCAGCACTTGTAGGG - Intronic
1166047711 19:40239074-40239096 TGGGGGCCCCAGCCAGGGCAGGG - Intronic
1167049013 19:47067519-47067541 TGTGGGCCCCAGCAGTTCCAAGG - Exonic
1167166963 19:47804917-47804939 TCGGGGCCCCAGCCCTGGGAAGG - Intronic
1168266865 19:55228126-55228148 GAGAGGCCCCAGCACTTGGATGG - Intronic
1168288147 19:55344625-55344647 TGGGAGCCCCCGGCCTTGCAGGG + Intronic
1168339204 19:55614075-55614097 TCGGGGCACCAGCACTTGTTTGG + Exonic
925190426 2:1877857-1877879 GGGGGACCCCAGCACTTCCCTGG - Intronic
927431747 2:23031988-23032010 TGGAGCCCCCAGCGTTTGCAGGG - Intergenic
927718485 2:25367924-25367946 TGGGGACCCCTGCACTTGGCAGG + Intergenic
929453527 2:42051359-42051381 TGGGGCCCCCAGGCCTTGGATGG + Intronic
930658446 2:54030157-54030179 TGGGGGCCCCAGGACCTTCAAGG + Intronic
930658774 2:54033317-54033339 TGGGGTCCCAAGTACTTGGAAGG - Intronic
935179078 2:100674268-100674290 TGGCTGGCCCAGCAGTTGCAAGG - Intergenic
936797528 2:116224789-116224811 TGCCGGCCCCAGCACCTGGATGG + Intergenic
937218707 2:120329158-120329180 TGGGGGCCCCCTCAGTTTCATGG - Intergenic
938678952 2:133669489-133669511 TGGGTGCTCCACCACTTGCCAGG + Intergenic
940308673 2:152253694-152253716 TGTGGGCCACAGCACTTGGCAGG + Intergenic
941462768 2:165791373-165791395 TGAGGGCTCCAGCACTTTCGTGG + Intronic
942045746 2:172098395-172098417 TGCGGGCCCTAGCACTTTCAGGG + Intergenic
944466876 2:200010809-200010831 AGGTGGCCCCTGCACTTTCACGG + Intergenic
944666191 2:201961522-201961544 TGGAGGCCACAGCACTAGGAAGG - Intergenic
947015543 2:225615784-225615806 AGAAGGCCCCAGCACTTGCCTGG - Intronic
947461154 2:230306044-230306066 TGGTGGCTCCAGCCCTTGCCAGG - Intronic
948641682 2:239379273-239379295 CGCGGGAGCCAGCACTTGCAGGG - Intronic
948715381 2:239857618-239857640 TGGGGGAGCCATCACTTCCAGGG + Intergenic
949035708 2:241814899-241814921 TGCTGTCCCCAGCACGTGCAGGG - Exonic
1175598370 20:60253508-60253530 TTGGAGCCCCAGCACTGGCCGGG + Intergenic
1176083784 20:63286730-63286752 TGGGGAGCCCAGCTCCTGCAGGG - Intronic
1176188541 20:63795297-63795319 TTGTGCCCCCAGCACCTGCACGG - Intronic
1176622949 21:9071094-9071116 TGGGGTCCCCATCTCTTGGAAGG + Intergenic
1179929067 21:44555405-44555427 TGGGGACTCCCGCACTAGCAGGG + Intronic
1180125575 21:45788008-45788030 TGGGGGCACCTACAGTTGCAAGG + Intronic
1180151487 21:45950495-45950517 TGGGGGCACCAGCAAGTGAAGGG + Intergenic
1180766956 22:18351019-18351041 TGTGGGCTTCAGCACCTGCAGGG + Intergenic
1180812074 22:18768680-18768702 TGTGGGCTTCAGCACCTGCAGGG - Intergenic
1180939132 22:19645384-19645406 TGGGGGCCCCAGAACTTGTTTGG + Intergenic
1180963934 22:19776003-19776025 CTGGGGCCCGAGCACTTGGAGGG - Intronic
1181084113 22:20431510-20431532 TCGGGGCCCCAGAACTGGCGCGG + Exonic
1181085916 22:20439273-20439295 GAGGGGCCCCAGCACTGGGAGGG - Intronic
1181198229 22:21202924-21202946 TGTGGGCTTCAGCACCTGCAGGG - Intergenic
1181703476 22:24633977-24633999 TGTGGGCTTCAGCACCTGCAGGG + Intergenic
1182121254 22:27788323-27788345 TCGGGGCCCTAAAACTTGCAAGG + Intronic
1182344813 22:29654915-29654937 TGGGGTCACCAGGACTAGCATGG + Intronic
1183655049 22:39179754-39179776 TTTGGGCCCTAGCACTTGGAAGG + Intergenic
1183952548 22:41359692-41359714 TGGGGGCTCCAGCTCTGGCCAGG - Exonic
1184069819 22:42140902-42140924 TGGAGGACCCAGCGCCTGCAGGG - Intergenic
1184572493 22:45334884-45334906 TAGGAGCCCGAGCACATGCAGGG - Intronic
1185150516 22:49161266-49161288 TGGGGGCCACAGGTGTTGCAGGG - Intergenic
1203228578 22_KI270731v1_random:91913-91935 TGTGGGCTTCAGCACCTGCAGGG + Intergenic
950259861 3:11536008-11536030 TGGAGGCCCCAGCAGTTGGGGGG - Intronic
950859762 3:16137642-16137664 TGGTGCCCCCAGCACTTTCTAGG - Intergenic
951367998 3:21808548-21808570 AGGAGGCACAAGCACTTGCAAGG - Intronic
954249780 3:49358571-49358593 CGAGGGCCCCAGCCCTTGGAAGG - Exonic
954671586 3:52294009-52294031 TGGGGGTCCCAGCACTGGGATGG + Intergenic
954776087 3:53019881-53019903 TGGGGACACCAGATCTTGCAGGG - Intronic
955410676 3:58653538-58653560 TTGGGACCCCAGCAATTGCAGGG - Intronic
956931832 3:74052391-74052413 TGGGGTCCCATGCACGTGCATGG - Intergenic
960974001 3:123157975-123157997 TGGGGGCCCCACCTCTGCCATGG + Intronic
960993766 3:123328191-123328213 TGGGGGACACAGCATTTCCAAGG - Intronic
961356284 3:126341970-126341992 TGGGGGCCCAAGCACAAGGAGGG - Intergenic
963960617 3:151305142-151305164 TGCATGTCCCAGCACTTGCAGGG + Intronic
965104390 3:164339426-164339448 AGGGGGCTCCAACCCTTGCAAGG + Intergenic
967123706 3:186406332-186406354 AGGGAGGCCCAGCACTGGCAGGG - Intergenic
968055511 3:195688586-195688608 TGGGGGCCTCAGCACTAGGAAGG + Intergenic
968100282 3:195960011-195960033 TGGGGGCCTCAGCACTAGGAAGG - Intergenic
968427519 4:533549-533571 AGGGGGCCCCAGCTTCTGCACGG + Intronic
969466724 4:7361692-7361714 TGGGGTCCCCAGCCCTTCCCCGG - Intronic
969888701 4:10239892-10239914 TGAGGGCCCCAGTACCTTCAAGG + Intergenic
974848173 4:67376588-67376610 TAGGGGCCCCCACACTTTCATGG + Intergenic
981128551 4:141133149-141133171 CGGGGGCCCACGAACTTGCAGGG + Intronic
985503425 5:263362-263384 TGGGGGCCTCAGCACTAGGAAGG + Intergenic
985734268 5:1568923-1568945 TGGGGGCCTCAGCACTAGGAAGG - Intergenic
985773170 5:1825532-1825554 TGGAGCGCCCAGCACTGGCAGGG - Intergenic
986856803 5:11878832-11878854 TTGGGGCACCATCATTTGCAAGG + Intronic
991978409 5:72205977-72205999 TGGGGCCCAAACCACTTGCATGG - Exonic
994081456 5:95712047-95712069 AGGGGGCTCCAACCCTTGCAAGG + Intergenic
995799544 5:115979131-115979153 TAGGGGACACAGCTCTTGCAAGG + Intronic
996234511 5:121108937-121108959 AGGCGGCCCCTGCCCTTGCAAGG - Intergenic
999247261 5:150161799-150161821 TGGCGGCCCCAGCCCCTGGAGGG + Intergenic
1002026652 5:176400486-176400508 TTGGGTCCCCAGCTCTGGCAAGG - Intronic
1002087140 5:176783113-176783135 TGGGAGGCCCAGCAGTTGGATGG - Intergenic
1004839711 6:19569132-19569154 TGGAGTCCCCAGCACTTGGAAGG - Intergenic
1005332305 6:24761666-24761688 TGGGGCTCCCACCAGTTGCATGG + Intergenic
1006108098 6:31728704-31728726 TCGGAGCCCCAGGTCTTGCAGGG + Exonic
1006178734 6:32140485-32140507 TGAGGGCCCCAGTACCTTCAAGG + Intergenic
1011359782 6:86511130-86511152 TGGGGGCCTCAGGACTTGCCTGG + Intergenic
1013095303 6:106939586-106939608 TGGGGCCCCCAACACTTCCTTGG - Intergenic
1013432118 6:110064586-110064608 TGGGTGCCCCAGCCCCAGCAGGG + Intergenic
1017782543 6:157727431-157727453 TGAGGGCCCCAGTACCTTCAAGG + Intronic
1017892359 6:158649414-158649436 TGGTGGCCCCAGTACTGGCTCGG + Intergenic
1018174457 6:161166904-161166926 CAGGAGCCCCAGCACCTGCAGGG + Intronic
1018211525 6:161487294-161487316 TGGGACTCCCAGCACTTGCCTGG + Intronic
1018812620 6:167308607-167308629 TAGGGGCCCCAGCCCCAGCAAGG - Intronic
1018847596 6:167566329-167566351 TGGTGGCTCCAGCAATTCCAGGG - Intergenic
1019171199 6:170134216-170134238 TGGGAGCCCCATCACATGCAGGG + Intergenic
1019428369 7:987745-987767 AGGGGACCCCAGGACATGCAGGG - Intronic
1022092306 7:27115624-27115646 AGGGCGCCCCAGCCCTTGCTCGG - Intronic
1023050406 7:36246213-36246235 TGGGAGCGGCAGCACTGGCAAGG - Intronic
1029328545 7:99831506-99831528 TTGTGGCACCAGCAGTTGCATGG + Intronic
1029489064 7:100860545-100860567 GGGGTGCCCCAGCACTTTGAGGG + Intronic
1029491461 7:100872748-100872770 AGGGGCCCCCAGCACGTGCAAGG + Intronic
1032364603 7:131287411-131287433 TGGGGGCCCCAGGCCTTCCTTGG + Intronic
1032489124 7:132310794-132310816 CTGGGGCACCAGCACTTTCAAGG + Intronic
1034944567 7:155253626-155253648 TGGGGACCACAGCACTTCCCTGG + Intergenic
1035038954 7:155913815-155913837 TGGGAGCCCCAACACTTGCAGGG + Intergenic
1035657195 8:1319154-1319176 TGGGGGCCCCAGGCACTGCAGGG - Intergenic
1037513138 8:19603721-19603743 TGGAGGCTCCATCACTGGCATGG + Intronic
1037621091 8:20564063-20564085 TGGGGGCTGAAGCACTTCCATGG + Intergenic
1037684828 8:21129826-21129848 TGGGTGCCCCCGCTCTTCCAGGG - Intergenic
1037750482 8:21678988-21679010 TGGGAGCTCCAGCACTTGGCTGG - Intergenic
1044082585 8:87903899-87903921 TTGGGGCCCCAACCCCTGCATGG - Intergenic
1045020824 8:98042955-98042977 TGGTTGCCCCTTCACTTGCAAGG - Intronic
1045570069 8:103359674-103359696 TCCAGGCCCCAGCAATTGCAGGG - Intergenic
1049471719 8:142777663-142777685 TCGGGGTCCCAGCGCTTGCCCGG - Intronic
1049618695 8:143588213-143588235 TGGGGGCCTCAGCAGCTGCTTGG + Intronic
1049784439 8:144443867-144443889 TGAGGGCGCCCGCACCTGCAAGG + Exonic
1053177500 9:35938645-35938667 TGGAGGGCCCAGCACTTTCCAGG + Intergenic
1053391607 9:37740238-37740260 GAGGGGCCCCAGCACCTGCGGGG + Exonic
1055185953 9:73454407-73454429 TGGAGGCCCCAGCAGTAGAAGGG - Intergenic
1056812701 9:89776690-89776712 ATGTGGCACCAGCACTTGCAGGG + Intergenic
1060008848 9:120025607-120025629 TGGGGTCCCCAGCACACGTAAGG + Intergenic
1060191797 9:121598567-121598589 TGGAGGCCCCAGCAGGGGCAGGG - Intronic
1060302615 9:122384115-122384137 TGTGGTCCCCAGCACGTGCAGGG + Intronic
1061223004 9:129263127-129263149 TGGGGGCTCCAGCAGATGCCAGG + Intergenic
1061440860 9:130602543-130602565 TGGTGGCCTCAGCACCTGCCTGG - Intronic
1061605258 9:131705282-131705304 TTTTGTCCCCAGCACTTGCACGG - Intronic
1061708200 9:132469124-132469146 GGGGGGACCCAGCACTTGCCAGG + Intronic
1062048347 9:134434686-134434708 AGGGAGCCCCAGCCCTTCCAGGG - Intronic
1062076557 9:134593027-134593049 TGGGGGACTCAGCACTGGGAGGG + Intergenic
1203746136 Un_GL000218v1:41521-41543 TGGGGCCCCCATCTCTTGGAAGG + Intergenic
1186801160 X:13093438-13093460 TGGGGGCCCCAGGAGTCTCAGGG - Intergenic
1189888801 X:45577433-45577455 TGTGGGCACCAGCAGTAGCAAGG + Intergenic
1195111734 X:101657105-101657127 TGGGAGCCCCTGCCATTGCAGGG + Exonic
1198225892 X:134645649-134645671 TCGTGGGCCCAGCTCTTGCAGGG - Intronic