ID: 1163128717

View in Genome Browser
Species Human (GRCh38)
Location 19:15258755-15258777
Sequence GTCTGCACAAAAATTTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1176
Summary {0: 1, 1: 0, 2: 11, 3: 194, 4: 970}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163128717_1163128727 26 Left 1163128717 19:15258755-15258777 CCCAGCTAAATTTTTGTGCAGAC 0: 1
1: 0
2: 11
3: 194
4: 970
Right 1163128727 19:15258804-15258826 GTCTCCAACTCCTGGGATCAAGG 0: 3
1: 83
2: 1141
3: 3973
4: 8137
1163128717_1163128726 19 Left 1163128717 19:15258755-15258777 CCCAGCTAAATTTTTGTGCAGAC 0: 1
1: 0
2: 11
3: 194
4: 970
Right 1163128726 19:15258797-15258819 CAGGCTGGTCTCCAACTCCTGGG 0: 1017
1: 15850
2: 32135
3: 31996
4: 20908
1163128717_1163128725 18 Left 1163128717 19:15258755-15258777 CCCAGCTAAATTTTTGTGCAGAC 0: 1
1: 0
2: 11
3: 194
4: 970
Right 1163128725 19:15258796-15258818 CCAGGCTGGTCTCCAACTCCTGG 0: 1798
1: 32147
2: 62371
3: 60640
4: 39602
1163128717_1163128728 27 Left 1163128717 19:15258755-15258777 CCCAGCTAAATTTTTGTGCAGAC 0: 1
1: 0
2: 11
3: 194
4: 970
Right 1163128728 19:15258805-15258827 TCTCCAACTCCTGGGATCAAGGG 0: 3
1: 82
2: 1157
3: 4126
4: 8811
1163128717_1163128721 0 Left 1163128717 19:15258755-15258777 CCCAGCTAAATTTTTGTGCAGAC 0: 1
1: 0
2: 11
3: 194
4: 970
Right 1163128721 19:15258778-15258800 AGGGTTTTGACATGTTGCCCAGG 0: 10
1: 2196
2: 13419
3: 41247
4: 110589
1163128717_1163128722 4 Left 1163128717 19:15258755-15258777 CCCAGCTAAATTTTTGTGCAGAC 0: 1
1: 0
2: 11
3: 194
4: 970
Right 1163128722 19:15258782-15258804 TTTTGACATGTTGCCCAGGCTGG 0: 53
1: 6634
2: 29786
3: 69506
4: 222109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163128717 Original CRISPR GTCTGCACAAAAATTTAGCT GGG (reversed) Intronic
900283396 1:1886864-1886886 TTCTCTACAAAAAATTAGCTGGG - Intronic
901114594 1:6832244-6832266 GTCTCTACAAAAAATTAGCCAGG - Intronic
901553464 1:10013511-10013533 GTCTCTACAAAAAATTGGCTGGG + Intronic
901561571 1:10075881-10075903 GTCTCTACAAAAAATTAGCGGGG + Intronic
901883252 1:12206217-12206239 GTCTCTACAAAAAATTAGCAGGG + Intronic
901921166 1:12538794-12538816 GTCTCTACAAAAAATTAGCCAGG - Intergenic
901944610 1:12691482-12691504 GTCTGCTCAAAAGGATAGCTGGG + Intergenic
902028509 1:13403054-13403076 GTCTGTACAAAAAATTAGCCAGG + Intergenic
902161095 1:14530910-14530932 GTCTCTACAAAAAATTAGCCAGG + Intergenic
902281463 1:15377668-15377690 GTCTCTACAAAAAATTAGCCAGG + Intronic
902342183 1:15791167-15791189 GTCTCTACAAAAAATTAGCCAGG + Intergenic
902447280 1:16475488-16475510 ATCTCTACAAAAAATTAGCTGGG - Intergenic
902467136 1:16625439-16625461 ATCTCTACAAAAAATTAGCTGGG - Intergenic
902507452 1:16947306-16947328 ATCTCTACAAAAAATTAGCTGGG + Intronic
902519533 1:17008300-17008322 CTCTACAAAAAAAATTAGCTGGG - Intronic
902523416 1:17036472-17036494 CTCTACAAAAAAAGTTAGCTGGG - Intronic
902674387 1:17998560-17998582 GTCTCTACAGAAAATTAGCTGGG - Intergenic
903067555 1:20709220-20709242 GTCTCTACAAAAAATTAGCCAGG + Intronic
903091782 1:20926508-20926530 ATCTCTACAAAAAGTTAGCTGGG + Intronic
903436066 1:23350141-23350163 GTCTCTACAAAAAATTAGCTGGG + Intergenic
903854646 1:26329638-26329660 GTCTCTACAAAAAATTAGCTGGG - Intronic
904551940 1:31325867-31325889 ATCTTTACAAAAAGTTAGCTGGG + Intronic
904656060 1:32048336-32048358 GTCTCTACAAAAAGTTAGCTGGG + Intronic
904743133 1:32694066-32694088 GTCTCTACAAAAAATTAGCCAGG + Intronic
904867557 1:33592786-33592808 GAATGTACAAAAAATTAGCTGGG + Intronic
905435601 1:37953195-37953217 TTCTCTACAAAAAATTAGCTGGG + Intergenic
905728752 1:40278978-40279000 GTCTCTACAAAAAATTAGCCGGG + Intronic
905826962 1:41033121-41033143 GTCTCTGCAAAAAATTAGCTAGG + Intronic
906287865 1:44599502-44599524 ATCTCTACAAAAAGTTAGCTGGG + Intronic
906423698 1:45691380-45691402 ATCTCTACAAAAAATTAGCTGGG + Intronic
906570238 1:46831656-46831678 GTCTCTACAAAAAATTAGCTGGG - Intergenic
906628334 1:47343905-47343927 ATCTCTACAAAAAATTAGCTGGG + Intronic
907161412 1:52372969-52372991 GTCTCTACAAAAAATCAGCTGGG + Exonic
907227348 1:52960337-52960359 GTCTCTGCAAAAAATTAGCTGGG - Intronic
907343302 1:53752817-53752839 ATCTCTACAAAAAATTAGCTGGG + Intergenic
907458010 1:54588041-54588063 GTCTCTACCAAAAATTAGCTAGG + Intronic
907477851 1:54718210-54718232 GTCTCTCCAAAAATTTAGCTGGG + Intronic
908237395 1:62159712-62159734 GTCTCTACAAAAAATTAGCCAGG - Intronic
908565955 1:65356401-65356423 GTCTCTACAAAAAATTAACTGGG + Intronic
908663973 1:66468518-66468540 GTCCTCACAAAGAATTAGCTTGG - Intergenic
908735476 1:67271944-67271966 GTCTCTACAAAAAATTAGCCAGG - Intergenic
908760259 1:67505269-67505291 ATCTCTACAAAAAATTAGCTGGG + Intergenic
910196618 1:84647875-84647897 GTCTCTACAAAAAATTAGCTGGG + Intronic
910900210 1:92112241-92112263 CTCTACAAAAAAATTTAGCTGGG + Intronic
910959391 1:92745645-92745667 CTCTACAAAAAAAATTAGCTGGG + Intronic
911004162 1:93200143-93200165 GTCTCTACAAAAAGTTAACTGGG - Intronic
911207310 1:95104857-95104879 ATCTCTACAAAAAATTAGCTGGG + Intergenic
911637701 1:100253671-100253693 ATCTCTACAAAAAATTAGCTGGG + Intergenic
911990621 1:104692611-104692633 GTCTGCATTAAAACTTAGGTAGG - Intergenic
912367214 1:109144218-109144240 GTCTCTACAAAAAATTAGCCGGG - Intronic
912675354 1:111675309-111675331 GTCTCTACAAAAAATTAGCCAGG + Intronic
912756251 1:112326853-112326875 ATCTCTACAAAAAATTAGCTGGG - Intergenic
912917636 1:113832346-113832368 GTCTCTACTAAAAATTAGCTGGG - Intronic
914338359 1:146737593-146737615 GTCTCTACAAAAAATTAGCTGGG - Intergenic
914725515 1:150323935-150323957 AACTACAAAAAAATTTAGCTGGG - Intronic
914792344 1:150889237-150889259 GTCTCTACAAAAACTTAGCCGGG + Intergenic
915097852 1:153476366-153476388 GTCTCTACAAAAAATTAGCCGGG + Intergenic
915421529 1:155786367-155786389 CTCTACAAAAAAATTTAGCTGGG + Intronic
917049508 1:170903922-170903944 GTCTGTACAAATGTGTAGCTTGG + Intergenic
917389753 1:174522406-174522428 ATCTCTACAAAAACTTAGCTGGG + Intronic
917574115 1:176302388-176302410 CTCTGCACAAAAAGCTATCTAGG - Intergenic
917943710 1:179948244-179948266 GTCTCTACAAAAAATTAGCTGGG - Intergenic
918053925 1:181002007-181002029 GTCTCTACAAAAAATTAGCCTGG + Intronic
918082155 1:181215988-181216010 GTCTCTACAAAAAATTTGCTGGG - Intergenic
918149649 1:181787278-181787300 GTCTCTACTAAAAATTAGCTGGG - Intronic
918804789 1:189025202-189025224 AAATGCAGAAAAATTTAGCTTGG + Intergenic
918921471 1:190716655-190716677 GTCTCTACAAAAAATTAGCCAGG + Intergenic
919083448 1:192892367-192892389 GTCTCTACAAAAAATTAGCCAGG + Intergenic
919733253 1:200928117-200928139 GGCTATACAAAAAATTAGCTGGG - Intergenic
919904164 1:202066465-202066487 ATCTCTACAAAAAATTAGCTGGG - Intergenic
919911826 1:202115955-202115977 GTCTCCACTAAAATTTAGCTGGG - Intergenic
920148367 1:203882744-203882766 GTCTCTACTAAAAATTAGCTGGG + Intergenic
920327988 1:205181840-205181862 GTCTCTACAAAAAATTAGCCAGG - Intronic
920552489 1:206874486-206874508 ATCTCTACAAAAAGTTAGCTAGG + Intergenic
920958564 1:210643291-210643313 TTCTACAAAAAAATTTAACTTGG + Intronic
921125511 1:212174288-212174310 GTCTCTACAAAAAATTAGCCAGG - Intergenic
921157324 1:212448904-212448926 GTCTGTACAAAAAATTGGCCAGG + Intergenic
921294869 1:213692232-213692254 GTCTCTACTAAAAATTAGCTGGG + Intergenic
921310120 1:213834191-213834213 ATCTCTACAAAAAATTAGCTGGG - Intergenic
921726715 1:218532731-218532753 GTCTCTACAAAAAATTAGCCAGG - Intergenic
921802020 1:219412194-219412216 GTCTCTACAAAAAATTAGCTGGG - Intergenic
922031451 1:221803855-221803877 GTGTCTACAAAAAATTAGCTGGG - Intergenic
922286604 1:224176130-224176152 GGCTTTACAAAAAATTAGCTGGG - Intronic
922309842 1:224378211-224378233 GTCTCTACAAAAAATTCGCTGGG - Exonic
922315949 1:224442177-224442199 GTCTCTACAAAAAGTTAGCCAGG - Intronic
922663951 1:227453220-227453242 GTCTCAACAAAAAATTAGCCAGG + Intergenic
922688514 1:227667202-227667224 GTCTCTACAAAAAATTAGCTGGG - Intronic
922920143 1:229295118-229295140 GTCTCTACAAAAAATTAGCCAGG - Intronic
923121504 1:230996603-230996625 GTCTCTACAAAAATTTAGCAGGG - Intronic
923574536 1:235146120-235146142 ATCTCTACAAAAAATTAGCTGGG - Intronic
923600058 1:235394871-235394893 GTCTCAACAAAAAATTAGCAAGG - Intronic
923708336 1:236363993-236364015 GTCTCTACAAAAAATTAGCTGGG + Intronic
923856849 1:237854454-237854476 GTCTCTACTAAAAATTAGCTGGG - Intergenic
924114474 1:240731520-240731542 GTCTCTACAAAATATTAGCTAGG + Intergenic
924361808 1:243249255-243249277 ATCTCTACAAAAAATTAGCTGGG + Intronic
1063016227 10:2080466-2080488 GTCTGTACAAGAATTTAGAAGGG + Intergenic
1063632385 10:7746212-7746234 GTCTCTACAAAAAATTAGCCAGG + Intronic
1063702828 10:8402118-8402140 GTCTCTACAAAAAATTAGCCTGG + Intergenic
1063923136 10:10951302-10951324 GTCTCTACAAAAATATAGCTGGG - Intergenic
1064026247 10:11851053-11851075 GTCTCTACAAAAAATAAGCTGGG + Intronic
1064453557 10:15465755-15465777 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1064463090 10:15553830-15553852 GTCTTTACAAAAAATTAGCCAGG + Intronic
1065114293 10:22469450-22469472 GTCTGTACAAAAAATTAGCTGGG + Intergenic
1065185827 10:23170582-23170604 GTCTCTACCAAAAATTAGCTGGG + Intergenic
1065319659 10:24497562-24497584 GTCTCCACAAAAAATGAGCGTGG + Intronic
1065333692 10:24631887-24631909 GTCTCTACAAAAAATTAGCTGGG - Intronic
1065511374 10:26481643-26481665 CTCTGCCAAAAAAATTAGCTGGG - Intronic
1066076031 10:31877921-31877943 GTCTCTACAAAAAATTAACTGGG + Intronic
1066100944 10:32117966-32117988 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1066207946 10:33208219-33208241 GTCTCCACAAAAAATTAGCTCGG - Intronic
1066252351 10:33646782-33646804 AAATGCACAAAAAATTAGCTGGG + Intergenic
1066373808 10:34839458-34839480 ATCTCCACAAAAAATTAACTAGG - Intergenic
1067379338 10:45758766-45758788 GTCTCCACAAAAAATTAGCCGGG - Intronic
1067403206 10:45996802-45996824 GTCTATACAAAAAATTAGCCGGG + Intronic
1067424940 10:46201084-46201106 GTCTCTACAAAAAATTAGCCTGG + Intergenic
1067887038 10:50099428-50099450 GTCTCCACAAAAAATTAGCCGGG - Intronic
1067975713 10:51022834-51022856 CTCTGTACAAAAAATTAGCTGGG + Intronic
1068755613 10:60649069-60649091 TTCTGCACAGAAAATTAGCCAGG - Intronic
1069051935 10:63804098-63804120 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1069128563 10:64669630-64669652 GTCTTTACAAAAAATTAGCCAGG - Intergenic
1069494299 10:68889139-68889161 ATCTCTACAAAAAATTAGCTGGG - Intronic
1069523521 10:69146253-69146275 GTCTGTACTAAAAATTAGCTGGG - Intronic
1069662718 10:70134176-70134198 GTCTCTACAAAAAATTAGCCTGG + Intergenic
1069999128 10:72363243-72363265 GTCTGTACTAAAAATTAGCCAGG - Intergenic
1070208387 10:74287819-74287841 ATCTCTACAAAAAATTAGCTGGG + Intronic
1070286895 10:75090127-75090149 GTCTCTACAAAAAGTCAGCTGGG + Intergenic
1070914304 10:80143197-80143219 GTAAGTACAAAAAATTAGCTGGG - Intronic
1071341606 10:84653855-84653877 ATCTCCACAAAATATTAGCTGGG - Intergenic
1071697445 10:87891643-87891665 GTCTTTACAAAAAATTAGCTGGG + Intronic
1072070498 10:91910565-91910587 TTCTCCACTAAAAATTAGCTGGG - Intergenic
1072301240 10:94064380-94064402 GTCTCTACAAAAAATTAGCTGGG + Intronic
1072518647 10:96211030-96211052 ATCTGGACAAAAAATTAGCCAGG - Intronic
1072634995 10:97172201-97172223 AAATGCAAAAAAATTTAGCTGGG - Intronic
1072639696 10:97202531-97202553 ATCTCTACAAAAAATTAGCTGGG - Intronic
1072640637 10:97208587-97208609 ATCTCTACAAAAAATTAGCTAGG + Intronic
1072918990 10:99559650-99559672 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1073010451 10:100355089-100355111 GTCCCCACAAAAAATTAGCCAGG - Intronic
1073114002 10:101080764-101080786 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1073164766 10:101436474-101436496 GTCTCTACAAAAAATTAGCTGGG + Intronic
1073216006 10:101836659-101836681 GTCTCTACAAAAAATTAGCCTGG + Intronic
1073277095 10:102321728-102321750 GTCTCTACAAAAAATTAGCCAGG - Intronic
1073496870 10:103899524-103899546 ATCTCTACAAAAAATTAGCTGGG + Intronic
1073978119 10:109123357-109123379 ATATATACAAAAATTTAGCTGGG + Intergenic
1074173615 10:110972674-110972696 GTCTCTACAAAAAATTAGCTGGG + Intronic
1074456721 10:113602044-113602066 GTCTCTACAAAAAATTAGCTGGG - Intronic
1075252366 10:120891610-120891632 GTGTGCACCAAAGTTTTGCTGGG - Intronic
1075368662 10:121916064-121916086 GTCTCTACAAAAAATTAGCCGGG + Intronic
1075988679 10:126813702-126813724 GTCTCTACAAAAAGTAAGCTGGG - Intergenic
1076573497 10:131448692-131448714 GTCTCTACCAAAAATTAGCTGGG + Intergenic
1077448053 11:2611378-2611400 GTCTCTACTAAAAATTAGCTGGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078243667 11:9553130-9553152 CTCTACACAAAAAGTTAGCTGGG + Intergenic
1078375341 11:10788775-10788797 GTCTCTACAAAAAATTAGCCGGG + Intergenic
1078503416 11:11907925-11907947 GTCTCTACTAAAAATTAGCTGGG + Intronic
1079192003 11:18286374-18286396 ATCTGTACAAAAAATTAGCCGGG + Intronic
1079424015 11:20323300-20323322 ATCTCCACAAAAAATTAGCTAGG + Intergenic
1080499481 11:32855262-32855284 ATATGCACACAAATTTATCTGGG + Exonic
1080554233 11:33401720-33401742 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1080617013 11:33953362-33953384 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1080829522 11:35878378-35878400 GTCTCTGCAAAAAATTAGCTGGG + Intergenic
1080859448 11:36140587-36140609 ATCTCTACAAAAAATTAGCTGGG - Intronic
1081116093 11:39203391-39203413 GTCTCCACTAAAAATTAGCTGGG + Intergenic
1081756274 11:45546989-45547011 GGCTCTACAAAAAATTAGCTGGG + Intergenic
1081916982 11:46738632-46738654 CTCTCTACAAAAAATTAGCTGGG - Intronic
1082074424 11:47965235-47965257 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1082077690 11:47987045-47987067 GTCTATACAAAAAATTAGCTGGG + Intronic
1082105781 11:48219822-48219844 GTCTGTACTAAAAATTAGCCAGG + Intergenic
1082839874 11:57680214-57680236 GTCTCTACAAAAAATTAGCCGGG + Intronic
1082868777 11:57924100-57924122 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1083294757 11:61709402-61709424 GTCTCTACAAAAAATTAGCGGGG - Intronic
1083573928 11:63775714-63775736 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1083755882 11:64791537-64791559 GACTCTACAAAAAATTAGCTGGG - Intronic
1083818548 11:65151997-65152019 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1083836412 11:65271677-65271699 CTCTACTCAAAAAATTAGCTGGG + Intronic
1084141288 11:67231728-67231750 GTCTGAAGAAAACTTTGGCTGGG + Exonic
1084637746 11:70404039-70404061 CTCTGCCTAAAAATTTAGCCAGG - Intronic
1085442442 11:76577173-76577195 GTTTGGACAAAAATCTAGCCAGG + Intergenic
1085590392 11:77754571-77754593 GTCTCTACAAAAAATTAGCCAGG + Intronic
1085691098 11:78664392-78664414 ATCTCTACAAAAAATTAGCTAGG - Intronic
1085711853 11:78836187-78836209 GTTTCTACAAAAAATTAGCTGGG + Intronic
1086099883 11:83088190-83088212 GTCTCTACAAAAACTTAGCCAGG - Intergenic
1086215257 11:84371414-84371436 GTCTATACAAAAAATTAGCCAGG - Intronic
1086380635 11:86248848-86248870 GTCTCTACCAAAAATTAGCTGGG + Intronic
1086736597 11:90314367-90314389 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1087178127 11:95114275-95114297 GTCTCTACAAAAAATTAGCTAGG - Intronic
1087375089 11:97329737-97329759 CTCTATACAAAAAGTTAGCTGGG + Intergenic
1087466238 11:98510123-98510145 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1087941211 11:104099469-104099491 GTCTCTACAAAAAATTAGCCAGG + Intronic
1088314135 11:108490045-108490067 ATCTCTACAAAAAATTAGCTGGG - Intronic
1088484701 11:110329313-110329335 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1088529265 11:110790891-110790913 ATTTGCACAAAAAATTAGCTGGG + Intergenic
1088645933 11:111916389-111916411 GTCTCTACAAAAAATTAGCCAGG - Intronic
1089568945 11:119389625-119389647 GTCTTTACAAAAAATTAGCCAGG + Intergenic
1090730238 11:129567155-129567177 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1090778477 11:129985621-129985643 GTCTCTACAAAAAGTTAGCCAGG + Intronic
1090833052 11:130432872-130432894 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1091499818 12:1005309-1005331 ATCTCTACAAAAAATTAGCTGGG - Intronic
1092374926 12:7947493-7947515 GTCTCTGCAAAAAATTAGCTGGG - Intergenic
1092888591 12:12947723-12947745 GTCTCTACAAAAAATTAGCTGGG - Intronic
1092929701 12:13304368-13304390 GTCTACACAAACTTTTAGCTGGG + Intergenic
1093949410 12:25147485-25147507 ATCTCTACAAAAAATTAGCTGGG + Intronic
1094012415 12:25823365-25823387 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1094646466 12:32329263-32329285 GTCTCCACAAAAAGTTAGCCAGG - Intronic
1095304797 12:40626517-40626539 GTCTCTACAAAAAATTTGCTGGG + Intergenic
1095420404 12:42018670-42018692 AACTACAAAAAAATTTAGCTGGG + Intergenic
1095770869 12:45955315-45955337 ATCTCTACAAAAAATTAGCTGGG - Intronic
1096046973 12:48570814-48570836 CTCTACAAAAAAAATTAGCTGGG + Intergenic
1096163918 12:49404445-49404467 GTCTTTACAAAAAATTAGCTGGG - Intronic
1096170942 12:49469227-49469249 GTCTCTACCAAAAATTAGCTGGG + Intronic
1096315320 12:50559570-50559592 GTCTCCACAAAAAATTAGCCAGG + Intronic
1096645918 12:53035672-53035694 ATCTCTACAAAATTTTAGCTGGG - Intronic
1096647387 12:53046321-53046343 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1096762940 12:53858498-53858520 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1096811945 12:54176349-54176371 GTCTCTACAAAAAATTAGCCAGG + Intronic
1096830449 12:54309785-54309807 GTCTCTACAAAAAATTAGCCTGG - Intronic
1096855845 12:54482011-54482033 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1097658052 12:62393748-62393770 GTCTGTACTAAAAATTAGCCGGG - Intronic
1097819945 12:64118428-64118450 ATCTCTACAAAAAATTAGCTGGG - Intronic
1097880464 12:64681842-64681864 ATCTGTACAAAAAATTAGCTAGG + Intronic
1097978958 12:65717575-65717597 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1098257235 12:68629145-68629167 GTCTCTACAAAAAATTACCTGGG - Intronic
1098354156 12:69594684-69594706 GTCTCTACAAAAAATTAGCTGGG + Intronic
1098428883 12:70397187-70397209 TTCTCTACAAAAAATTAGCTGGG + Intronic
1098942074 12:76549569-76549591 GTCTCTACTAAAAATTAGCTGGG - Intronic
1099697942 12:86044789-86044811 GTCTGCAGTAAAACATAGCTAGG - Intronic
1099768536 12:87021690-87021712 GTCTGCAAAAAATTATAGATAGG - Intergenic
1099864387 12:88260723-88260745 GTCTGTACTAAAAATTAGCCAGG - Intergenic
1099945781 12:89242626-89242648 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1099959087 12:89379701-89379723 GTCTTCAGAAAAATTGAGCTTGG - Intergenic
1101955437 12:109208374-109208396 GTCTCTACAAAAAATTAGCTGGG - Intronic
1102642667 12:114380667-114380689 GTCGCTACAAAAAATTAGCTGGG + Intronic
1102689592 12:114750035-114750057 ATCTCTACAAAAACTTAGCTGGG + Intergenic
1102834482 12:116041672-116041694 GTCTCTACCAAAAATTAGCTGGG + Intronic
1102954492 12:117050762-117050784 GTCTCTACAAAAAATTAGATGGG + Intronic
1102981407 12:117244405-117244427 GTCTCTACTAAAAATTAGCTGGG - Intronic
1103030774 12:117610577-117610599 GTCTCTACAAAAATTTAGCCTGG + Intronic
1103112501 12:118293303-118293325 GTCTGCATATTAATTAAGCTTGG - Intronic
1103526607 12:121573441-121573463 CTCTCTACAAAAAATTAGCTGGG - Intronic
1103689708 12:122761649-122761671 GTCTCTACAAAAAATTAGCTGGG + Intronic
1103692927 12:122790495-122790517 GTCTCTACAAAAAATTAGCCAGG + Intronic
1104012927 12:124944759-124944781 GTCTCTACCAAAAATTAGCTGGG + Intergenic
1104632249 12:130413470-130413492 AAATGCAAAAAAATTTAGCTGGG + Intronic
1104691197 12:130827743-130827765 GTCTCTACAAAAAATTAGCTGGG + Intronic
1104824225 12:131696968-131696990 GCCTCTACAAAAAATTAGCTGGG + Intergenic
1105266311 13:18820481-18820503 GTCTGCACAAAGATTTTTATGGG + Intergenic
1105327053 13:19380302-19380324 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1105374420 13:19830692-19830714 GTCTCTACAAAAAATTAGCCAGG - Intronic
1105479620 13:20762345-20762367 AAATGCAAAAAAATTTAGCTGGG - Intronic
1105493009 13:20905750-20905772 GTCTCCACTAAAAATTAGCCAGG + Intergenic
1105864593 13:24448034-24448056 GTCTCTACAGAAAATTAGCTGGG + Intronic
1106029860 13:25990373-25990395 GTCTGCACCCACATCTAGCTTGG - Intronic
1106268820 13:28134789-28134811 CTCTACAAAAAAATTTAGCTGGG - Intergenic
1106746226 13:32711151-32711173 GTCTCTACAAAAAATTAGCCGGG - Intronic
1106807511 13:33325822-33325844 GTCTCTACAAAAAATTAGCCGGG + Intronic
1107321405 13:39192603-39192625 GTCTCTACAAAAAATCAGCTGGG + Intergenic
1107355909 13:39566570-39566592 GTCTCTACAAAAAATTAGCTGGG + Intronic
1107475413 13:40731091-40731113 GTCTCTACAAAAAATTAGCCAGG + Intronic
1107748767 13:43542300-43542322 GTCTCTACAAAAAATTAGCCGGG - Intronic
1108604069 13:52019770-52019792 GTCTCTACAAAAAATTATCTGGG + Intronic
1109668168 13:65566544-65566566 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1110215769 13:73023287-73023309 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1111061397 13:83023456-83023478 AAATGCAAAAAAATTTAGCTGGG + Intergenic
1111968534 13:94885796-94885818 GTCTACAAAAAAAATTAGCCAGG - Intergenic
1112016200 13:95333386-95333408 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1112123792 13:96442180-96442202 GTCTTTACAAAAAATTAGTTGGG - Intronic
1112242886 13:97699671-97699693 ATCTCTACAAAAACTTAGCTGGG + Intergenic
1112287673 13:98118445-98118467 GTCTCCACTAAAAATTAGCTGGG - Intergenic
1112319153 13:98391437-98391459 ATCTCTACAAAAATTTAGCTGGG - Intronic
1112327669 13:98453677-98453699 GTCTGCACAAAGATGTCTCTCGG + Intronic
1112488433 13:99840587-99840609 GTCTCTACAAAAAATTAGCCAGG + Intronic
1112493536 13:99887590-99887612 CTCTACATAAAAAATTAGCTGGG + Intronic
1113626271 13:111850182-111850204 ATCTCCACAAAAAATTAGCCAGG + Intergenic
1113846022 13:113392206-113392228 ATCTCTACAAAAAGTTAGCTGGG - Intergenic
1114040506 14:18673985-18674007 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1114045543 14:18872498-18872520 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1114118669 14:19646970-19646992 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1114302209 14:21388650-21388672 ATCTCTACAAAAAATTAGCTGGG - Intronic
1114461478 14:22888684-22888706 GTCTTTACAAAAAATTAGCTGGG + Intergenic
1114590246 14:23857945-23857967 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1115006824 14:28496192-28496214 GTCTCTACAAAAAAATAGCTTGG - Intergenic
1115138875 14:30144809-30144831 GTCTCTACAAAAAATTAGCCAGG + Intronic
1115375953 14:32675545-32675567 GTCTGCAGAAAGATTTAGACTGG + Intronic
1115549300 14:34490823-34490845 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1116025268 14:39506987-39507009 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1116315815 14:43390439-43390461 GTCTCTACAAAAAATTAGCGGGG + Intergenic
1116716174 14:48430254-48430276 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1117154124 14:52920782-52920804 ATCTCTACAAAAAATTAGCTGGG + Intronic
1117362955 14:54996437-54996459 ATCTCCACAAAAAATTAGCCAGG + Intronic
1117375337 14:55113826-55113848 GTCTCTACAAAAAATTAGCCGGG - Intergenic
1117388271 14:55238388-55238410 GTCTCTACAAAAAATTAGTTGGG - Intergenic
1117433721 14:55696805-55696827 GTCTGCCCTAAAATGGAGCTGGG + Intronic
1117777970 14:59201452-59201474 GTCTCTACTAAAAATTAGCTGGG + Intronic
1118574682 14:67230409-67230431 GTCTCCACAAAAAATAAGCTGGG + Intergenic
1118632772 14:67721412-67721434 GTCTCTACAAAAAATTATCTGGG - Intronic
1118997814 14:70853189-70853211 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1119047983 14:71337783-71337805 GTCTCTACAAAAAATAAGCTAGG + Intronic
1119128921 14:72153913-72153935 GTCTGACCAAAAATTTACCAGGG + Intronic
1119249287 14:73137905-73137927 GGCTCTACAAAAAATTAGCTGGG + Intronic
1119437464 14:74606676-74606698 GTCTCTACTAAAAATTAGCTGGG + Intronic
1119551482 14:75517123-75517145 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1119563148 14:75606781-75606803 GTCTTTACAAAAAATTAGCCAGG + Intronic
1119581760 14:75790631-75790653 TTCTCTACAAAAACTTAGCTGGG - Intronic
1119737354 14:76991736-76991758 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1119797462 14:77411932-77411954 AAATGCAAAAAAATTTAGCTGGG + Intronic
1120028003 14:79607837-79607859 GTCTTGACAAAAAATTAGCCGGG - Intronic
1120167526 14:81217629-81217651 ATCTCCACAAAAAATTAGCCAGG + Intronic
1120372126 14:83649767-83649789 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1120977844 14:90265383-90265405 GTCTCTATAAAAAATTAGCTGGG + Intronic
1121361321 14:93263156-93263178 CAATGCACAAAAATTAAGCTTGG + Intronic
1122176595 14:99925418-99925440 GTCTCTAAAAAAAATTAGCTGGG - Intronic
1122557059 14:102586302-102586324 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1122674995 14:103405509-103405531 GTCTCTACAAAAAATTAGCTGGG - Intronic
1122701266 14:103590697-103590719 GTCTCTACAAAAAATTAGCTGGG + Exonic
1202832216 14_GL000009v2_random:47602-47624 GTCTGCACAAAGATTTTTATGGG - Intergenic
1123409944 15:20049913-20049935 TTCAGCACAAAAATTTAGGAGGG - Intergenic
1123519276 15:21056620-21056642 TTCAGCACAAAAATTTAGGAGGG - Intergenic
1125495857 15:40193143-40193165 GTCTGCACCAAAACCTGGCTGGG - Intronic
1125569385 15:40704232-40704254 GTCTCTACTAAAAATTAGCTGGG - Intronic
1125739857 15:41954796-41954818 GTTTCTACAAAAAATTAGCTAGG - Intronic
1125851281 15:42905424-42905446 GTATCTCCAAAAATTTAGCTAGG - Intronic
1125963374 15:43851899-43851921 GTCTCTAAAAAAAATTAGCTTGG + Intronic
1126042279 15:44603259-44603281 GTCTCTACAAAAAATTAGCCGGG - Intronic
1126567499 15:50115174-50115196 GTCTTTACAAAAAATTAGCCAGG + Intronic
1126575669 15:50193988-50194010 ATCTCTACAAAAAGTTAGCTGGG + Intronic
1126586945 15:50298250-50298272 CTCTACAGAAAAAATTAGCTGGG - Intronic
1126796725 15:52265697-52265719 ATCTCTACAAAAAATTAGCTGGG - Intronic
1127150904 15:56074302-56074324 GTCTCTACAGAAAATTAGCTGGG + Intergenic
1127156460 15:56131425-56131447 GTCTCTACAAAAAATTAGCTGGG - Intronic
1127253442 15:57266866-57266888 GTCTCTACAAAAAATTAGCGGGG + Intronic
1127297221 15:57619536-57619558 GTCTCTACAAAAAATTATCTGGG - Intronic
1127440608 15:59003271-59003293 GTCTCTACAAAAACTTAGCTGGG - Intronic
1127800180 15:62471174-62471196 GCCTCTACAAAAAATTAGCTGGG + Intronic
1128137748 15:65276532-65276554 GTCTGTACAAAAAATTAGCTGGG - Intronic
1128142321 15:65310861-65310883 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1128189844 15:65681734-65681756 GTCTCTACAAAAAATTAGCTGGG - Intronic
1128192087 15:65711331-65711353 GTCTCAACAAAAAATTAGCCAGG + Intronic
1128303208 15:66580404-66580426 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1128307172 15:66606386-66606408 ATCTCTACAAAAAATTAGCTGGG + Intronic
1128332422 15:66764382-66764404 ATGTGCACAATAATTTATCTTGG + Intronic
1128620133 15:69141768-69141790 GTATGCACAAATAGCTAGCTTGG - Intergenic
1128826564 15:70723322-70723344 GTCTTCACAAAAAATTAGCCAGG + Intronic
1128833494 15:70790426-70790448 AAATGCAAAAAAATTTAGCTGGG + Intergenic
1129130636 15:73490538-73490560 ATCTGTACAAAAAATTAGCCAGG + Intronic
1129599023 15:76987385-76987407 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1129753783 15:78083708-78083730 ATCTCTACAAAAAATTAGCTGGG + Intronic
1129854829 15:78815945-78815967 GTCTCTACAAAAAATTAGCTGGG + Intronic
1129863618 15:78884341-78884363 GTCTCTACTAAAAATTAGCTGGG + Intronic
1130231099 15:82097568-82097590 GTCTATACAAAAAATTAGCAGGG - Intergenic
1130244759 15:82236282-82236304 ATCTGCAAAAACATTTTGCTAGG - Intronic
1130246754 15:82258388-82258410 GTCTCTACAAAAAATTAGCCAGG + Intronic
1130351640 15:83097581-83097603 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1130570861 15:85042333-85042355 GTCTCTACAAAAAATTAGCTGGG - Intronic
1131042920 15:89289100-89289122 GTCTGAACAAATGGTTAGCTTGG - Intronic
1131157969 15:90086564-90086586 AAATGCAAAAAAATTTAGCTGGG - Intronic
1131641198 15:94295752-94295774 ATCTGTACAAAAAAATAGCTGGG + Intronic
1132104372 15:99052028-99052050 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1133046488 16:3091149-3091171 CTCTCTACAAAAAGTTAGCTGGG + Intronic
1133070785 16:3245471-3245493 GTCTACCAAAAAAATTAGCTGGG + Intronic
1133157794 16:3887982-3888004 GACTCCAAAAAAAATTAGCTGGG - Intergenic
1133163834 16:3932313-3932335 GTTTCTACAAAAAATTAGCTGGG + Intergenic
1133183015 16:4073253-4073275 GTCTCTACCAAAAATTAGCTGGG - Intronic
1133217516 16:4302157-4302179 ATCTGCACAAAAATTTGCATGGG - Intergenic
1133484923 16:6210559-6210581 GTCTCTACAAAAAATTAGCTGGG + Intronic
1133653761 16:7838873-7838895 GTCTGTATTAAAAATTAGCTGGG + Intergenic
1133733705 16:8597538-8597560 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1133774654 16:8887193-8887215 GTCTTCACTAAAATGTGGCTGGG + Intergenic
1134079264 16:11313896-11313918 GTCTCTACAAAAAATTAGCTGGG - Intronic
1134257846 16:12626334-12626356 GTCTCTACTAAAAATTAGCTAGG + Intergenic
1134446758 16:14336940-14336962 GTCTCTACCAAAAATTAGCTGGG - Intergenic
1134660193 16:15978201-15978223 CTCTTAAAAAAAATTTAGCTAGG + Intronic
1134661851 16:15990213-15990235 GTCTCTACTAAAAATTAGCTGGG - Intronic
1134762888 16:16729685-16729707 CTCTACAAAAAAAGTTAGCTGGG - Intergenic
1134983164 16:18629464-18629486 CTCTACAAAAAAAGTTAGCTGGG + Intergenic
1135164664 16:20128541-20128563 TTCTCTACAAAAAATTAGCTGGG - Intergenic
1135292165 16:21249313-21249335 GTCTCTACAAAAAATTAGCTAGG + Intronic
1135344992 16:21681420-21681442 ATCTCTACAAAAAATTAGCTGGG + Intronic
1135415996 16:22268337-22268359 GTCTCTACTAAAAATTAGCTGGG - Intronic
1135645694 16:24159823-24159845 ATCTCTACAAAAAATTAGCTAGG + Intronic
1135730878 16:24894244-24894266 ATCTGCACAGAAATGCAGCTGGG - Intronic
1135982689 16:27160651-27160673 GTCTCTATAAAAAATTAGCTGGG - Intergenic
1136129316 16:28209966-28209988 ATCTCCACAAAAAATTAGCCAGG + Intronic
1136162423 16:28429132-28429154 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1136183230 16:28569489-28569511 GTCTCTACAAAAAATTAGCCGGG + Intronic
1136200543 16:28685857-28685879 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1136216888 16:28800050-28800072 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1136368154 16:29819154-29819176 GCCAACACAAAAAATTAGCTGGG - Intronic
1137659541 16:50192911-50192933 GTCTCTACAAAAAATTAGCTGGG + Intronic
1138147419 16:54625053-54625075 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1138407138 16:56805216-56805238 CTCTCTACAAAAAGTTAGCTGGG - Intronic
1138476838 16:57275945-57275967 GTCTCTACCAAAAATTAGCTGGG + Intronic
1138915330 16:61456227-61456249 GGCTGCAGTAAAATTTTGCTGGG - Intergenic
1139121363 16:64022602-64022624 ATACGCACAAAAAATTAGCTGGG - Intergenic
1139273412 16:65704545-65704567 GTATGCACAAAAATAAGGCTGGG + Intergenic
1139290885 16:65856783-65856805 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1139542362 16:67627776-67627798 GTCTGTACAAAAAATCAGCTGGG + Intronic
1139565848 16:67775642-67775664 GTCTCTACAAAAAATTAGGTGGG + Intronic
1139995919 16:70979761-70979783 GTCTCTACAAAAAATTAGCTGGG + Intronic
1140357354 16:74317989-74318011 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1140415377 16:74770537-74770559 GTCTCTACAAAAAATTAGCTGGG - Intronic
1140879773 16:79187573-79187595 GTCTCCACTAAAAATCAGCTGGG - Intronic
1141056938 16:80826271-80826293 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1141223900 16:82097187-82097209 ATATACACAGAAATTTAGCTGGG - Intronic
1142384065 16:89751329-89751351 GTCTCTACAAAAAATCAGCTGGG + Intronic
1142580480 17:938889-938911 GTCTCTACTAAAAATTAGCTGGG + Intronic
1142661765 17:1435218-1435240 ATCTCTACAAAAAATTAGCTGGG - Intronic
1142800136 17:2339551-2339573 CTCTCTACAAAAAATTAGCTGGG + Intronic
1142891105 17:2943502-2943524 GTCTCTACTAAAAATTAGCTGGG + Intronic
1143231167 17:5356809-5356831 GTCTCTACAAAAAATTAGCTGGG - Intronic
1143237219 17:5413136-5413158 CTCTGCAAAAAAAATTAGCTGGG - Intronic
1143301447 17:5913597-5913619 GTCTGCATCAAATTCTAGCTTGG - Intronic
1143657384 17:8303555-8303577 GTCTCTACAAAAAGTTAGCCAGG + Intergenic
1143819904 17:9552179-9552201 ATCTCTACAAAAAATTAGCTGGG + Intronic
1144396445 17:14848440-14848462 ATCTCTACAAAAAATTAGCTAGG - Intergenic
1144814261 17:18022440-18022462 CTCTACAAAAAAAATTAGCTAGG - Intronic
1144868468 17:18352657-18352679 GTCTCTACAAAAAATTAGCTGGG + Intronic
1145036869 17:19547210-19547232 ATCTCTACAAAAAATTAGCTGGG - Intronic
1145201664 17:20951052-20951074 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1145876675 17:28323835-28323857 GTCTCTACAGAAAATTAGCTGGG + Intronic
1145911004 17:28543107-28543129 ATCTCTACAAAAAATTAGCTGGG + Intronic
1145985033 17:29040114-29040136 GTCTCTACAAAAAATAAGCTGGG + Intronic
1146078370 17:29754825-29754847 GTCTTTACAAAAAATTAGCTGGG - Intronic
1146120387 17:30188821-30188843 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1146325663 17:31883835-31883857 GTCTCTACAAAAAATAAGCTAGG - Intronic
1146388167 17:32396264-32396286 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1146396272 17:32470171-32470193 ATCTCTACAAAAAGTTAGCTTGG - Intronic
1146522476 17:33536836-33536858 GTCTCTACAAAAAATTAGCCAGG + Intronic
1146734703 17:35228442-35228464 GTCTCCACAAAAATTTAGCCAGG - Intergenic
1147016737 17:37497883-37497905 GTCTCTACAAAAAATTAGCCAGG + Intronic
1147188069 17:38723329-38723351 GTCTCTACAAAAAATTAGCTGGG + Intronic
1147207066 17:38845055-38845077 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1147416222 17:40292195-40292217 GTCTCTACAAAAAATTAGCTGGG - Intronic
1147794995 17:43035963-43035985 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1147818307 17:43226178-43226200 GTCTTTACAAAAAATTAGCTAGG + Intergenic
1147998166 17:44372787-44372809 GTCTCTACTAAAAATTAGCTGGG - Intronic
1148033497 17:44639648-44639670 ATCTCTACAAAAATTTAGCTGGG - Intergenic
1148404582 17:47399081-47399103 GTCTCTACAAAAAATTAGCCAGG - Intronic
1149662665 17:58343372-58343394 ATCTCTACAAAAAATTAGCTAGG - Intergenic
1149820383 17:59771331-59771353 GCCTCTACAAAAAATTAGCTTGG - Intronic
1149988218 17:61364545-61364567 ATCTTGACAAAAAATTAGCTGGG + Intronic
1150029896 17:61721856-61721878 ATATACACAAAAAATTAGCTGGG - Intronic
1150052060 17:61974241-61974263 GTCTCTACAAAAAGTTAGCTGGG + Intronic
1150192771 17:63260614-63260636 GTCTCTACAAAAAATTAGCCAGG + Intronic
1150703594 17:67468560-67468582 AACTACAAAAAAATTTAGCTGGG - Intronic
1150761009 17:67961676-67961698 GTCTGTACAAAAAATTGGCCAGG + Intronic
1151500673 17:74486358-74486380 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1151626703 17:75280778-75280800 ATCTGAAAAAAAAATTAGCTGGG + Intronic
1151650061 17:75461751-75461773 GTCTCTACTAAAAATTAGCTGGG + Intronic
1151931540 17:77235118-77235140 CTCTCTACAAAAAATTAGCTGGG + Intergenic
1152105866 17:78328579-78328601 GTCTCAAAAAAAAATTAGCTTGG + Intergenic
1152125975 17:78447097-78447119 ATCTCCACAAAAAAATAGCTAGG - Intronic
1152131856 17:78482211-78482233 GTCTCTACAAAAACTTAGCCGGG - Intronic
1152150834 17:78600036-78600058 GTCTCTACAAAAAATTAACTGGG - Intergenic
1152219783 17:79056980-79057002 ATCTCTACAAAAAGTTAGCTGGG + Intergenic
1152475609 17:80516165-80516187 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1153170588 18:2311594-2311616 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1154040886 18:10854872-10854894 TTCTACAAAAAAAATTAGCTGGG - Intronic
1154089288 18:11342596-11342618 GTCTGACCAAAAATTTACCAGGG + Intergenic
1154222965 18:12473088-12473110 ATCTCTACAAAAATTTGGCTGGG - Intronic
1154422106 18:14240993-14241015 GTCTGCACAAAGATTTTTATGGG - Intergenic
1155135685 18:22989831-22989853 CTCTACAAAAAAAATTAGCTAGG - Intronic
1155206586 18:23563580-23563602 ATCTCTACAAAAACTTAGCTGGG - Intronic
1155271479 18:24145576-24145598 GTTTGCACAAAAATTTCCCTTGG + Intronic
1155421482 18:25661301-25661323 GTCTCCACAAAAAGTTAGCCTGG + Intergenic
1155550173 18:26956149-26956171 GTCTCTACTAAAAATTAGCTGGG + Intronic
1155574941 18:27234403-27234425 CTCTCCACAAAAAATTAGCTGGG - Intergenic
1156013190 18:32517397-32517419 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1156686266 18:39650768-39650790 GTCTCTACTAAAAATTAGCTAGG - Intergenic
1157235150 18:45958292-45958314 TTCTGCAAAAAAAGGTAGCTAGG - Intronic
1157258747 18:46160829-46160851 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1157665203 18:49480155-49480177 GTCTCTACAAAAAATTAGCCAGG + Intronic
1157994835 18:52542676-52542698 AACTACAAAAAAATTTAGCTGGG + Intronic
1158105103 18:53876469-53876491 GTCTGGAAAAAACTTTAGATAGG - Intergenic
1158107121 18:53898593-53898615 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1158525831 18:58212637-58212659 GTCTCCACAAAAAATTGGCTAGG - Intronic
1158733965 18:60058287-60058309 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1159522561 18:69544958-69544980 ATCTCTACAAAAAATTAGCTGGG + Intronic
1159956901 18:74525098-74525120 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1160204153 18:76819780-76819802 ATCTCTACAAAAAATTAGCTGGG - Intronic
1160204200 18:76820307-76820329 ATGTCCACAAAAAATTAGCTAGG + Intronic
1160924290 19:1535712-1535734 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1161032247 19:2062966-2062988 GTCTCCAAAACAAATTAGCTGGG - Intergenic
1161369650 19:3903524-3903546 GTCTCCAAAAAAATTTTGTTTGG - Intronic
1161392267 19:4027718-4027740 GTCTCCACAAAAAATTACCCAGG - Intronic
1161750314 19:6091320-6091342 GTCTCTACAAAAAATTAGCCAGG + Intronic
1161792183 19:6366797-6366819 GTCTCTACAAAAAATTAGCCAGG - Intronic
1161823044 19:6542845-6542867 GTCTCTGCAAAAAATTAGCTGGG + Intergenic
1162337073 19:10068346-10068368 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1162574604 19:11491745-11491767 GTCTCTACTAAAAATTAGCTGGG - Intronic
1162671954 19:12265235-12265257 CTCTCTACAAAAAATTAGCTGGG + Intronic
1162719657 19:12654832-12654854 GTCTCTACAAAAAATTAGCTGGG - Intronic
1162863769 19:13528129-13528151 ATCTCTACAAAAAGTTAGCTGGG - Intronic
1162883156 19:13675526-13675548 GTCTGTACTAAAAATTAGCCAGG - Intergenic
1162916917 19:13879565-13879587 GTGTCTACAAAAAATTAGCTGGG + Intronic
1163128717 19:15258755-15258777 GTCTGCACAAAAATTTAGCTGGG - Intronic
1163244378 19:16083927-16083949 GTCTCAAAAAAAAATTAGCTGGG - Intronic
1163308540 19:16497944-16497966 GTTTCTACAAAAAGTTAGCTAGG + Intronic
1163640451 19:18459046-18459068 ATCTATACAAAAAATTAGCTGGG - Intronic
1163866711 19:19779230-19779252 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1163873660 19:19847116-19847138 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1163941639 19:20500612-20500634 GTCTGACCAAAAATTTACCAGGG + Intergenic
1163942632 19:20509109-20509131 GTCTGACCAAAAATTTACCAGGG + Intergenic
1164403828 19:27924109-27924131 GTTTCTACAAAAAATTAGCTGGG - Intergenic
1164407222 19:27961294-27961316 GTCTCTACTAAAATTTAGCCGGG - Intergenic
1164943439 19:32269509-32269531 GTCTGTAAAAAAAATTAGCCAGG - Intergenic
1165010178 19:32840331-32840353 GTCTCTACAAAAAGATAGCTGGG - Intronic
1165370111 19:35399972-35399994 GTCTCTACTAAAATTTAGCCAGG - Intergenic
1165430961 19:35772456-35772478 GTCTCCACTAAAAATTAGCTGGG + Intergenic
1165863854 19:38923969-38923991 GTCTCAAAAAAAAATTAGCTGGG + Intronic
1166040821 19:40201649-40201671 GTCTCTACAAAAAATTAGCCTGG - Intronic
1166178835 19:41093042-41093064 GTCTGTACAAAAAAATGGCTAGG + Intronic
1166192563 19:41184794-41184816 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1166666220 19:44682087-44682109 ATCTCTACAAAAATTTAGCTAGG + Intronic
1166667650 19:44690640-44690662 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1166717170 19:44976021-44976043 ATCTCTACAAAAAATTAGCTGGG - Intronic
1166809137 19:45505442-45505464 GTCTCTACAAAAAATTAGCCTGG + Intergenic
1166967345 19:46537262-46537284 GTCTAGACAAAAAGTTAGCCAGG - Intronic
1167450631 19:49566467-49566489 GCCTGGATAAAAAATTAGCTGGG - Intronic
1168088330 19:54064628-54064650 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1168532688 19:57142308-57142330 GTCTCTACAAAAAATTAGCTGGG - Intronic
1168671615 19:58245106-58245128 ATCTCTACAAAAAATTAGCTGGG - Intronic
1202640470 1_KI270706v1_random:80169-80191 GTCTGCACAAAGATTTTTATGGG + Intergenic
925008717 2:466543-466565 ATCAGTACAAAAAATTAGCTGGG - Intergenic
925890819 2:8433280-8433302 AACTACAAAAAAATTTAGCTGGG - Intergenic
925989232 2:9240412-9240434 ATCTCTACAAAAAATTAGCTTGG - Intronic
926126403 2:10274864-10274886 GTCTCTACTAAAAATTAGCTAGG + Intergenic
926678387 2:15645746-15645768 ATCTCTACAAAAAATTAGCTGGG + Intergenic
927471116 2:23377875-23377897 GTCTGTACTAAAAATTAGCTGGG + Intergenic
927828164 2:26324088-26324110 ATCTCTACAAAAAGTTAGCTGGG + Intronic
927899266 2:26807407-26807429 GTCTCTACAAAAACTTAGTTGGG + Intergenic
927906949 2:26865479-26865501 CTCTACACAAAAAATTAGCTGGG - Intronic
927970150 2:27300705-27300727 GTCTCTACAAAAAATTAGCTGGG + Intronic
928162987 2:28946165-28946187 GTCTATACCAAAAATTAGCTGGG + Intronic
928519587 2:32075708-32075730 AACTACACAAAAAATTAGCTGGG - Intronic
928690647 2:33794964-33794986 GTCTCTACAAAAACTTAGCTGGG + Intergenic
928706767 2:33957914-33957936 GTCTCTACTAAAAATTAGCTGGG - Intergenic
929140373 2:38661805-38661827 GTCTCAAAAAAAAATTAGCTGGG - Intergenic
929149418 2:38734228-38734250 CTCTACATAAAAAATTAGCTGGG + Exonic
929508620 2:42548640-42548662 ATCTCCACAAAAATTAAGCCAGG + Intronic
929645252 2:43619696-43619718 GTCTCTACAAAAAATTTGCTAGG - Intergenic
929855328 2:45632905-45632927 GTCTGTACAAAAAATTATCCGGG + Intergenic
930060009 2:47280429-47280451 ATCTCTACAAAAAATTAGCTGGG - Intergenic
930608288 2:53514717-53514739 ATCTCTACAAAAAATTAGCTGGG + Intergenic
930808430 2:55516514-55516536 GTCTCTACTAAAAATTAGCTTGG - Intergenic
931345088 2:61439241-61439263 GTCTCTACAAAAAATTAGCCAGG + Intronic
931375133 2:61700318-61700340 TTCTGCAAAAAAAAATAGCTGGG + Intergenic
931375428 2:61703467-61703489 ATCTCTACAAAAAATTAGCTGGG + Intergenic
931400810 2:61929761-61929783 GTCTTTACAAAAAATTAGTTGGG + Intronic
931422695 2:62142904-62142926 GTCTCTACAAAAAATTAGCGAGG + Intronic
931607036 2:64062903-64062925 ATCTCTACAAAAAATTAGCTAGG - Intergenic
931702478 2:64920125-64920147 GTTTGTACAAAAAATTAGCCAGG - Intergenic
931798903 2:65739622-65739644 GTCTGCAGAAAAATTTGACCTGG + Intergenic
931859394 2:66338520-66338542 GTATGCCCAAAAAATTAGCCAGG - Intergenic
933536167 2:83577786-83577808 TTCTTCACAAATATTTATCTTGG - Intergenic
933693643 2:85198698-85198720 GTCTCTACAAAAAATTAGCTGGG + Intronic
933745293 2:85566325-85566347 ATCTGTACAAAAAATTAGCTAGG - Intronic
933894865 2:86801510-86801532 ATCTCTACAAAAATTTAGCCAGG - Exonic
934073604 2:88408582-88408604 GTCTCTACAAAAAATTAGCCAGG - Intergenic
934687216 2:96330081-96330103 GTCTCTACAAAAAATTAGCTGGG + Exonic
934876463 2:97925038-97925060 GTCTCTACAAAAAATTAGCCAGG - Intronic
935029528 2:99308870-99308892 GTCTCCACTAAAAATTAGCCAGG - Intronic
935080553 2:99789263-99789285 GTCTCTACAAAAAATTATCTGGG + Intronic
935139828 2:100343267-100343289 GTATTCACAAAAATATGGCTTGG + Intergenic
935164291 2:100556159-100556181 ATCTCTACAAAAAATTAGCTGGG + Intergenic
935257512 2:101324643-101324665 GTCTACTAAAAAAATTAGCTGGG - Intergenic
935797789 2:106662358-106662380 GTCTCTACTAAAAATTAGCTGGG - Intergenic
936408970 2:112236893-112236915 GTCTCTACAAAAACATAGCTGGG + Intronic
936411876 2:112266240-112266262 GTCTTTACCAAAAATTAGCTGGG + Intergenic
937034412 2:118769069-118769091 AAATGCAAAAAAATTTAGCTGGG + Intergenic
937122504 2:119450799-119450821 ATCTCTACAAAAAATTAGCTAGG + Intronic
937184914 2:120031035-120031057 GTCTCTACTAAAAATTAGCTGGG - Intronic
937386686 2:121440529-121440551 ATCTCCACAAAAAATTAGCAGGG + Intronic
937606356 2:123806196-123806218 GTCTGACCAAAAATTTACCAGGG + Intergenic
937690475 2:124749582-124749604 GTCTGTACTAAACCTTAGCTAGG - Intronic
937864555 2:126739188-126739210 CTCTGAACAAAAATACAGCTTGG + Intergenic
938269681 2:129958551-129958573 GTCTCTACAAAAAATTAGCCAGG - Intergenic
938339408 2:130525473-130525495 GTCTCTACAAAAAATTAGCCAGG + Intronic
938350430 2:130595279-130595301 GTCTCTACAAAAAATTAGCCAGG - Intronic
938485598 2:131704336-131704358 TTCTACACAAAAATTAAGTTGGG - Intergenic
938569639 2:132550806-132550828 GTCTGGACAGAAATACAGCTAGG - Intronic
938665955 2:133537335-133537357 GTCTGCAAAAAAATCCAACTGGG + Intronic
938811415 2:134856383-134856405 TTCTGCACAACCATTTAGTTTGG + Intronic
938924708 2:136028565-136028587 GTCTGAAAAAAAAATTAGCCAGG - Intergenic
939528114 2:143321847-143321869 GTCTCCACAAAAATGTAGCAGGG - Intronic
939944331 2:148390731-148390753 ATCTCTACAAAAATTTAGCTGGG - Intronic
940335064 2:152518082-152518104 ACCTGCTCAAACATTTAGCTTGG + Intronic
940581916 2:155591236-155591258 GTCTCCACAAAAAGTTTACTTGG + Intergenic
941055340 2:160781503-160781525 GTCTTCACAAAATTTTTGCCAGG - Intergenic
941390486 2:164907432-164907454 GTCTCTACAAAAAATTAGCCGGG - Intronic
941482940 2:166040255-166040277 GTCTGGACAAAAAGGTAGTTTGG - Intronic
941812121 2:169765622-169765644 GTCTCTACAAAAAATTAGCCAGG - Intronic
941990472 2:171551115-171551137 ATCTCTACAAAAAATTAGCTGGG - Intronic
941998280 2:171622176-171622198 GTCTCTATAAAAAATTAGCTGGG + Intergenic
942006306 2:171703394-171703416 GTCTCTACAAAAAATCAGCTGGG - Intronic
942040557 2:172057913-172057935 GTCTGCACAAAAAATAAAATGGG - Intronic
942064236 2:172255101-172255123 GTTTCTACAAAAAATTAGCTGGG + Intergenic
942113854 2:172708131-172708153 GTCTCTACAAAAAATTAGCTGGG + Intergenic
942135528 2:172921255-172921277 GTCTCCACAAAAAACTAGCTGGG - Intronic
942465366 2:176202372-176202394 ATCTCTACAAAAAATTAGCTGGG - Intergenic
942719279 2:178931995-178932017 GTCTCTACTAAAAATTAGCTGGG + Intronic
942771478 2:179526195-179526217 GTCTCTACAAAAAATTAGCTGGG - Intronic
942930887 2:181491131-181491153 GTATGGAAAAAAATTTATCTGGG + Intronic
943625849 2:190198470-190198492 GTCTCTACAAAAACTTAGGTAGG + Intronic
944181880 2:196904565-196904587 GTCTCTACTAAAAATTAGCTGGG + Intronic
944568438 2:201016447-201016469 GTCTCTATAAAAAATTAGCTGGG - Intronic
944618518 2:201487036-201487058 GTCTCTACAAAAAATCAGCTGGG - Intergenic
944703314 2:202264769-202264791 GTCTCTACAAAAAATTAGCTGGG + Intergenic
944742236 2:202623839-202623861 GTCTCCACTAAAAATTAGCCGGG + Intergenic
944777980 2:202988780-202988802 GTCTCTACAAAAAATTAGCCAGG - Intronic
944793159 2:203154073-203154095 GTCTCTACAAAAAATTAGCCGGG + Intronic
944796127 2:203187224-203187246 CTCTCTACAAAAAATTAGCTGGG - Intronic
944951991 2:204762280-204762302 ATCTCTACAAAAAATTAGCTGGG - Intronic
945226442 2:207535979-207536001 GTCTCTACAAAAAATTAGCCGGG - Intronic
945253483 2:207784264-207784286 GTCTCTACAAAAACTTAGCCAGG + Intergenic
945646543 2:212502929-212502951 GTCTGTACGAAAAATTAGCTGGG - Intronic
945979825 2:216300502-216300524 ATATACAAAAAAATTTAGCTGGG - Intronic
946841977 2:223828455-223828477 GCCTTGACAAAAAATTAGCTGGG - Intronic
947159881 2:227202572-227202594 GTCTCTACAAAAAATTAGCCGGG + Intronic
947214447 2:227737157-227737179 ATCTCTACAAAAAATTAGCTAGG - Intergenic
947257014 2:228177749-228177771 GTCTGCATTAAACTTTAGATTGG + Intronic
947881341 2:233516525-233516547 GTCTCCACTAAAAATTAGCCGGG + Intronic
947960713 2:234234587-234234609 ATGTGCACAAGGATTTAGCTGGG + Intergenic
948202279 2:236137870-236137892 GTCTCTACTAAAAATTAGCTGGG - Intergenic
949016461 2:241714762-241714784 GTCTCTACAAAAAATTAGCCAGG - Intronic
1168770807 20:415205-415227 GTCTCTACAAAACATTAGCTAGG + Intronic
1169223287 20:3839719-3839741 ATCTATACAAAAAATTAGCTGGG + Intergenic
1169362822 20:4965601-4965623 GTCTCTACAAAAAATTAGCCAGG + Intronic
1170068135 20:12337439-12337461 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1170322475 20:15115388-15115410 CTCTACAAAAAAAATTAGCTGGG - Intronic
1170448973 20:16462078-16462100 GTCTCTACTAAAAATTAGCTGGG + Intronic
1170587825 20:17748676-17748698 AAATGCAAAAAAATTTAGCTGGG + Intergenic
1170695410 20:18653231-18653253 GTCTCTATAAAAAATTAGCTGGG + Intronic
1171019547 20:21572944-21572966 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1171210628 20:23314159-23314181 GTCTCTAAAAAAAATTAGCTGGG - Intergenic
1171546414 20:26005414-26005436 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1171887349 20:30666888-30666910 GTCTGCACAAAGATTTTTATGGG + Intergenic
1171944064 20:31360319-31360341 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1172055935 20:32154307-32154329 GTCTTTACAAAAAATTAGCCAGG - Intronic
1172065016 20:32213293-32213315 CTCTGCTAAAAAAGTTAGCTGGG + Intronic
1172243350 20:33428246-33428268 AAAAGCACAAAAATTTAGCTGGG + Intronic
1172244498 20:33436665-33436687 GTCTCTACAAAAAATTGGCTAGG + Intronic
1172341869 20:34164383-34164405 GTCTCTACAAAAAATTAGCTAGG - Intergenic
1172384173 20:34521875-34521897 ATCTCTACAAAAAATTAGCTGGG + Intronic
1172411922 20:34730873-34730895 GTCTATACAAAAAATTAGCTGGG - Intronic
1172486478 20:35301092-35301114 GTCTCTACAAAAAGTTAGCTGGG - Intergenic
1172742025 20:37176475-37176497 ATCTCTACAAAAAATTAGCTGGG + Intronic
1172802039 20:37582491-37582513 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1172912424 20:38419895-38419917 GTCTCCACAAAAAATTAGCCAGG - Intergenic
1173396410 20:42684182-42684204 GTCTCTACTAAAAATTAGCTGGG + Intronic
1173559637 20:43993772-43993794 ATCTGCAGAAAAAGTTTGCTGGG + Intronic
1173608096 20:44346280-44346302 GTCTCTACAAAAAATTAGCGAGG - Intronic
1173769298 20:45644507-45644529 CTCTACAAAAAAAATTAGCTGGG - Intergenic
1173843049 20:46171382-46171404 ATCTCTACAAAAAATTAGCTAGG + Intergenic
1174005690 20:47408938-47408960 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1174235550 20:49087804-49087826 GTTGGCAACAAAATTTAGCTGGG - Intronic
1174452146 20:50626851-50626873 GTCTCTACTAAAAATTAGCTGGG + Intronic
1174466495 20:50721655-50721677 AAAAGCACAAAAATTTAGCTGGG + Intergenic
1174471693 20:50766335-50766357 CTCTACAAAAAAAGTTAGCTGGG - Intergenic
1174630215 20:51950386-51950408 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1174641366 20:52047286-52047308 GTCTCCACCAAAAATTAGCTGGG - Intergenic
1174842386 20:53912332-53912354 GCCTGCACAAAAATTTAAGAAGG + Intergenic
1174867361 20:54150492-54150514 ATCTGTACTAAAAATTAGCTGGG - Intergenic
1176210239 20:63916633-63916655 GTCTGACCAAAAATTTACCAGGG + Intronic
1176851378 21:13918964-13918986 GTCTGCACAAAGATTTTTATGGG + Intergenic
1176874368 21:14114015-14114037 GTCTCTACAAAAAATTAGCCAGG + Intronic
1177564613 21:22803263-22803285 GTATGAACAAAAATATAGATAGG + Intergenic
1178406008 21:32323802-32323824 GTCTCTACAAAAAATTAGCCAGG + Intronic
1178573010 21:33758281-33758303 GTTTCTACAAAAAATTAGCTGGG - Intronic
1178774053 21:35532187-35532209 GTCTCTACAAAAATTTAGCCGGG + Intronic
1178909598 21:36663926-36663948 GTCATCACAAAAATTTAGCTGGG - Intergenic
1179841880 21:44081716-44081738 GTCTCTACAAAAAATTAGCCAGG + Intronic
1179897792 21:44372333-44372355 GTCTCTACAAAAAATTAGCCGGG + Intronic
1180361474 22:11901711-11901733 GTCTGCACAAAGATTTTTATGGG - Intergenic
1180464074 22:15595115-15595137 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1180729500 22:17971013-17971035 CTCTGCCAAAAAAATTAGCTGGG + Intronic
1180729964 22:17973758-17973780 GTCTCTACAAAAAATTAGCCAGG + Intronic
1180923011 22:19531747-19531769 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1180925629 22:19552491-19552513 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1181347749 22:22232440-22232462 GTCTCCACAAAAAGTTAGCTGGG + Intergenic
1181588687 22:23869179-23869201 ATCTCTACAAAAAATTAGCTAGG + Intronic
1181970782 22:26688261-26688283 GTCTCTACAAAAAATTAGCCGGG + Intergenic
1182274765 22:29180518-29180540 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1182283125 22:29229171-29229193 ATCTCTACAAAAAATTAGCTAGG + Intronic
1182316496 22:29450836-29450858 ATCTTTACAAAAAATTAGCTGGG + Intergenic
1182329409 22:29540109-29540131 GTCTCTACTAAAAATTAGCTGGG + Intronic
1182365220 22:29774269-29774291 GTCTCTGCAAAAAATTAGCTGGG - Intergenic
1182384187 22:29922185-29922207 GTCTCTACTAAAAATTAGCTGGG - Intronic
1182536103 22:31004203-31004225 GTCTCTGCAAAAAATTAGCTGGG + Intergenic
1182760222 22:32716689-32716711 GTCTCCACAAAAAATTAGCCGGG - Intronic
1183190824 22:36321111-36321133 GTCTCTACTAAAAATTAGCTGGG - Intronic
1183578007 22:38704464-38704486 GTCTCTACCAAAAATTAGCTGGG - Intergenic
1183737543 22:39652162-39652184 GTCTCTACTAAAAATTAGCTGGG - Intronic
1183804365 22:40195618-40195640 CTCTACAGAAAAATTTAGCCAGG - Intronic
1183894514 22:40957475-40957497 GTCTCTACAAAAAATTAGCCAGG + Intronic
1184056578 22:42055177-42055199 GTCTCAAAAAAAAATTAGCTGGG - Intronic
1184423224 22:44393847-44393869 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1184722180 22:46321241-46321263 TTCTACAAAAACATTTAGCTGGG + Intronic
949170708 3:992887-992909 GTCTGGACCAAAATTTTGTTAGG - Intergenic
949208697 3:1472278-1472300 GTCTCCAAAGAAATTTATCTTGG - Intergenic
950240829 3:11368621-11368643 GTCTCTACAAAAAATTAGCCAGG + Intronic
950288486 3:11764162-11764184 GTCTCTACAAAAAATTAGCCGGG - Intergenic
950368262 3:12504838-12504860 GTCTGTACAAAAAATTAGCCAGG + Intronic
951687924 3:25365278-25365300 ACCTTCACAAAAAATTAGCTGGG - Intronic
952065426 3:29563854-29563876 GTCTCTACAAAAAATTAGCCAGG + Intronic
952272881 3:31849867-31849889 TTCTCTACAAAAATTTAGCCAGG + Intronic
952373489 3:32745828-32745850 GTCTGTACAAAAAATTGGCCAGG + Intronic
952509309 3:34037687-34037709 TTCTCTACAAAAAATTAGCTGGG - Intergenic
952529733 3:34251132-34251154 GTCTCTACAAAAAATTAGCCAGG - Intergenic
952779974 3:37087020-37087042 GTCTCTACAAAAAATTAGCCAGG - Intronic
952788511 3:37178623-37178645 GTCTCTACAGAAAATTAGCTGGG + Intronic
953165698 3:40463076-40463098 CTCTACAAAAAAAATTAGCTGGG - Intergenic
953306817 3:41839177-41839199 GTCTCTACTAAAAATTAGCTGGG + Intronic
953514855 3:43579982-43580004 GTCTTTACAAAAAATTAGCTGGG + Intronic
953594593 3:44298293-44298315 ATCTCTACAAAAAATTAGCTGGG + Intronic
954090567 3:48280471-48280493 GTCTCTACTAAAAATTAGCTGGG + Intronic
954204184 3:49045758-49045780 ATCTCTACAAAAAATTAGCTGGG - Intronic
954306795 3:49730875-49730897 GTCTGTACACAAAATTAGCCAGG - Intronic
954318749 3:49816286-49816308 ATCTCTACAAAAAATTAGCTAGG - Intergenic
954372999 3:50178990-50179012 GTCTCTACTAAAAATTAGCTGGG - Intronic
954669842 3:52284324-52284346 GTCTCCACAAAAAATTAGCCAGG + Intronic
954835840 3:53467220-53467242 ATCTCCATAAAAAATTAGCTGGG + Intergenic
954937868 3:54343450-54343472 ATCTCTACAAAAAATTAGCTGGG - Intronic
955641617 3:61091777-61091799 GTCTCTACAAAAATTTAGCTGGG + Intronic
955667109 3:61361963-61361985 TTCTGCTAAAAAATCTAGCTAGG - Intergenic
956096383 3:65720908-65720930 GTCTCTACAAAAAATTAGCCAGG - Intronic
956445489 3:69321873-69321895 ATCTGTACAAAAAATTAGCCAGG - Intronic
956445849 3:69324924-69324946 GTCTCTACAAAAAATTAGCCAGG + Intronic
956462846 3:69488730-69488752 ATCTCCACTAAAAATTAGCTGGG + Intronic
956636545 3:71370960-71370982 GTCTACTAAAAAAATTAGCTGGG - Intronic
957229235 3:77490258-77490280 GTCTCTACTAAAAATTAGCTGGG - Intronic
957382145 3:79445820-79445842 GTCTGTACTAAAAATTAGCCGGG - Intronic
958984723 3:100767106-100767128 GTCTCTACAAAAAATTAGCTGGG - Intronic
959048174 3:101497961-101497983 ATCTACAAAAAAAATTAGCTGGG - Intronic
959072107 3:101712237-101712259 GTCTCTACAAAAAATTAGCCGGG + Intergenic
959736291 3:109662752-109662774 ATCTGCAAAAAAAATTACCTGGG - Intergenic
960293158 3:115911510-115911532 GTCTCTACAAAAAATTAGCCAGG - Intronic
960670657 3:120152711-120152733 GTATCTACAAAAAATTAGCTGGG - Intergenic
961132861 3:124484933-124484955 GTCTCTACAAAAAATTAGCTGGG + Intronic
961161584 3:124731059-124731081 GTCTCTACAAAAAATTAGCTGGG + Intronic
961317196 3:126047651-126047673 GTCTTCAAAAAAATGGAGCTGGG + Intronic
961465867 3:127081258-127081280 GTCAGCCCAAAAATTTGGGTTGG + Intergenic
961726042 3:128931334-128931356 GTCTCTACAGAAAATTAGCTGGG - Intronic
961746169 3:129064758-129064780 GTCTCTACCAAAAATTAGCTGGG - Intergenic
961831304 3:129624293-129624315 ATCTCTACAAAAAGTTAGCTGGG + Intergenic
961845880 3:129762619-129762641 CTCTCCAAAAAAAATTAGCTGGG + Intronic
961861970 3:129924524-129924546 GTCTCTATAAAAAATTAGCTGGG - Intergenic
961866865 3:129959759-129959781 GTCTCTACAAAAAATTAGCTGGG - Intergenic
962230417 3:133661199-133661221 GTCTGCACAGAAAAATAGGTAGG - Intronic
962578723 3:136778079-136778101 ATCTCCACAAAAAATTAGCTGGG + Intergenic
963014728 3:140811363-140811385 GCCTCTACAAAAAATTAGCTGGG + Intergenic
963153177 3:142068725-142068747 GTCTCTACGAAAAATTAGCTGGG - Intronic
963155581 3:142092485-142092507 GTCTTTACAAAAACTTAGCCGGG - Intronic
963796573 3:149636804-149636826 TTATGCACAAAAAATTAGCTGGG + Intronic
963894788 3:150673747-150673769 GTCTCCACAAAGTGTTAGCTGGG - Intronic
964219978 3:154331979-154332001 GTCTCTACCAAAAATTAGCTGGG + Intergenic
964341761 3:155715771-155715793 GTTTCCACAAAAAATTAGCTGGG - Intronic
964488418 3:157209275-157209297 GTCTCTACAAAAAATTAGCCAGG - Intergenic
964571237 3:158109321-158109343 GTCTGCGGAAAACTGTAGCTTGG + Intronic
964797597 3:160516609-160516631 GTCTCTACAAAATATTAGCTGGG + Intronic
965204184 3:165699696-165699718 GTCTTTACTAAAAATTAGCTGGG + Intergenic
966716144 3:183014872-183014894 GTCTCCACAAAAAATAAGCTGGG - Intergenic
968082495 3:195856377-195856399 GTCTCTACAAAAAATTAGCCGGG + Intergenic
968143929 3:196281856-196281878 ATCTCTACAAAAAATTAGCTGGG - Intronic
968168301 3:196486898-196486920 GTCTCCACAAAAAAGTAGCCAGG + Intronic
1202738085 3_GL000221v1_random:27232-27254 GTCTGCACAAAGATTTTTATGGG - Intergenic
968528265 4:1075829-1075851 ATCTCTACAAAAAATTAGCTGGG - Intronic
968543714 4:1184135-1184157 GTCTCTACGAAAAATTAGCTGGG - Intronic
968806493 4:2776406-2776428 GTCTTTACAAAAAATTAGCCGGG - Intergenic
969286801 4:6207611-6207633 GTCTCTACAAAAAATTAGCCAGG - Intergenic
969815726 4:9685982-9686004 GTCTCTACAAAAAATTAGCTGGG + Intergenic
969885736 4:10213725-10213747 GTCTGACCAAAAATTTACCAGGG + Intergenic
970149618 4:13075384-13075406 GTCTCTACAAAAAATTAGCTGGG - Intergenic
970890284 4:21036227-21036249 ATCTGCACAAAAATTCTGCTAGG + Intronic
971090897 4:23344383-23344405 GTGTGCACAAAAATTCAGAAAGG + Intergenic
971308323 4:25502986-25503008 ATCTCTACAAAAAATTAGCTAGG + Intergenic
971699742 4:29955832-29955854 GTCTGTACAGAAATTTAGCCAGG + Intergenic
972352421 4:38248472-38248494 ATCTCTACAAAAAGTTAGCTGGG + Intergenic
972553576 4:40158627-40158649 GTCTCTACAAAAAATTAGCCAGG + Intergenic
972598344 4:40549681-40549703 GTCTCAAAAAAAAATTAGCTGGG - Intronic
973383985 4:49490680-49490702 GTCTGCACAAAGATTTTTATGGG + Intergenic
973622539 4:52741961-52741983 GTCTCTACAAAAAATTAGCCAGG - Intronic
973793719 4:54402325-54402347 GTCTCTACAAAAAATTAGCCGGG + Intergenic
973979435 4:56295331-56295353 GTGTCCAATAAAATTTAGCTAGG + Intronic
974071016 4:57123716-57123738 GTCTCTACAAAAAATTAGCTGGG - Intergenic
975540051 4:75499978-75500000 AACTCCACAAAAAATTAGCTGGG + Intronic
975644158 4:76529475-76529497 ATATACACAAAAAATTAGCTGGG - Intronic
976227871 4:82810838-82810860 GTCTCAAAAAAAAATTAGCTGGG - Intergenic
976420180 4:84833506-84833528 ATCTCTACAAAAAATTAGCTAGG + Intronic
976607197 4:86995070-86995092 GTCTTTACAAAAAATTAGCCAGG + Intronic
976775537 4:88701961-88701983 GTCTCCACAAAAAATTAGCCAGG - Intronic
977047455 4:92085216-92085238 GCTTGCAAAAAAATTCAGCTAGG - Intergenic
977586100 4:98777234-98777256 ATCTCTACAAAAAATTAGCTGGG + Intergenic
978029475 4:103921891-103921913 ATCTCTACAAAAAATTAGCTGGG + Intergenic
978100212 4:104829586-104829608 TTCTGCATAAAAATCTAGCCAGG + Intergenic
978118251 4:105048407-105048429 CTCTACAAAAAAAATTAGCTGGG + Intergenic
978613035 4:110565621-110565643 GTCTCTACAAAAAATTAGCCTGG - Intergenic
978635822 4:110804753-110804775 GACTACACATAAATTTTGCTTGG + Intergenic
979456766 4:120934664-120934686 GTCTCTACAAAAAATTAGCCAGG + Intergenic
979538940 4:121857282-121857304 CTCTTAAAAAAAATTTAGCTGGG - Intronic
980114065 4:128662609-128662631 GTCTCTACAAAAAATTAGCCAGG - Intergenic
980839354 4:138238758-138238780 AAATACACAAAAATTTAGCTGGG - Intronic
981143674 4:141300547-141300569 CTCTACACAAAAAATTAGCTGGG + Intergenic
981166501 4:141565195-141565217 GTCTCTACCAAAAATTAGCTGGG + Intergenic
981173548 4:141653495-141653517 GTCTGCACAAAACATTTGCAAGG - Intronic
981701884 4:147616585-147616607 TTCTGCACAAAAATTTTGAGAGG - Intergenic
981756270 4:148144363-148144385 GTCTCTACAAATAATTAGCTAGG - Intronic
982053202 4:151524139-151524161 GTCTCTACAAAAAATTAGCTGGG + Intronic
982185867 4:152798087-152798109 GTCTCTACAAAAAATTAGCTGGG + Intronic
982457900 4:155631923-155631945 GTCTCTACTAAAAATTAGCTGGG - Intergenic
983094005 4:163540851-163540873 GTCCCTACAAAAAATTAGCTGGG + Intronic
983178507 4:164619768-164619790 CTCTGCAGAAAATTTTATCTAGG + Intergenic
983246175 4:165290301-165290323 ATCTCTACAAAAAATTAGCTGGG - Intronic
983443347 4:167816010-167816032 GTCTCTACAAAAAATTAGCTGGG + Intergenic
983559426 4:169086123-169086145 GTCTCTACAAAAAGTTACCTGGG + Intergenic
983966924 4:173823811-173823833 GTTTCCACAATAATTCAGCTCGG - Intergenic
984020430 4:174478462-174478484 GTCTCTACTAAAAATTAGCTGGG + Intergenic
984231676 4:177108207-177108229 TTCTGCAGCCAAATTTAGCTAGG - Intergenic
984313964 4:178102364-178102386 ATCTCTACAAAAAATTAGCTGGG + Intergenic
984358475 4:178696375-178696397 ATCTCTACAAAAAATTAGCTGGG + Intergenic
984973830 4:185212547-185212569 GTCTCTACAAAAACTTAGCCAGG - Intronic
1202767835 4_GL000008v2_random:166013-166035 GTCTGCACAAAGATTTTTATGGG + Intergenic
986049532 5:4076116-4076138 ATCTCTACAAAAAATTAGCTGGG + Intergenic
986104400 5:4645913-4645935 GTCTCTCCAAAAAATTAGCTGGG - Intergenic
986763007 5:10897144-10897166 GTCTCTACCAAAAATTAGCTGGG + Intergenic
986822320 5:11481440-11481462 GTCTCTACAAAAAATTAGCCGGG + Intronic
987010497 5:13758332-13758354 GTCTCTACAAAAAATTAGCCAGG + Intronic
987985668 5:25142289-25142311 GTCTCCACTAAAAATTAGCTGGG - Intergenic
988448320 5:31312528-31312550 GTCTCTACAAAAAATTAGCAGGG + Intronic
988570369 5:32359024-32359046 GTCTCTACAAATAATTAGCTGGG + Intronic
989018307 5:36967934-36967956 CTCTCCACAAAAAATTAGCCAGG + Intronic
989235812 5:39147427-39147449 ATATGTACAAAAGTTTAGCTGGG - Intronic
989611405 5:43296774-43296796 CTCTGCAAAAATATTTAGGTCGG - Intronic
990087775 5:51999954-51999976 GTCTCTACAAAAAATTAGCCGGG + Intergenic
990438308 5:55817626-55817648 GTCTCTACTAAAAATTAGCTGGG - Intergenic
990547162 5:56834546-56834568 TACTGTACAAAAAATTAGCTGGG + Intronic
991684684 5:69170784-69170806 ATCTCTACAAAAAATTAGCTGGG - Intronic
992103355 5:73428768-73428790 ATCTCTACAAAAAATTAGCTAGG - Intergenic
992314696 5:75540465-75540487 GTCTACACAAAAAAATAGCCAGG - Intronic
992385144 5:76277603-76277625 GTCTCTACAAAAAGTTAGCCGGG + Intronic
992444859 5:76824241-76824263 GTCTAAAAAAAAAATTAGCTGGG - Intronic
992510916 5:77434160-77434182 GTCTATACTAAAAATTAGCTGGG + Intronic
992517337 5:77508279-77508301 GTCGCTACAAAAAATTAGCTGGG - Intronic
992666787 5:79018206-79018228 ATCTCCACAAAAAATTAGCCGGG - Intronic
992799483 5:80282602-80282624 CTCTCTACAAAAAATTAGCTGGG + Intergenic
992805614 5:80334527-80334549 ATCTCTACAAAAAATTAGCTGGG + Intergenic
992841320 5:80698066-80698088 CTCTACAAAAAAAATTAGCTGGG - Intronic
992858528 5:80889164-80889186 GTTTCTACAAAAAATTAGCTGGG + Intergenic
993062906 5:83061561-83061583 GTCTCTACTAAAAGTTAGCTGGG - Intronic
993807289 5:92426770-92426792 GTCTCTACAAAAAATTAGCTGGG - Intergenic
993809919 5:92463533-92463555 CTCTCCAGAAACATTTAGCTGGG + Intergenic
994086715 5:95767048-95767070 GTCTCTACAAAAAATCAGCTGGG + Intronic
994210042 5:97077439-97077461 GTCTCTACAAAAAGTTAGCCAGG + Intergenic
994580976 5:101641427-101641449 ACATGCACAAAAAATTAGCTAGG + Intergenic
994621494 5:102168532-102168554 ATCTCTACAAAAAATTAGCTGGG + Intergenic
995093143 5:108204349-108204371 ATCTCTACAAAAAATTAGCTGGG - Intronic
995504768 5:112848752-112848774 GTCTCTACAAAAAATTAGCTGGG + Intronic
995873888 5:116770167-116770189 ATCTCTACAAAAAATTAGCTGGG + Intergenic
996153163 5:120064727-120064749 GTCTCTACTAAAAATTAGCTGGG - Intergenic
996314063 5:122141606-122141628 ATCTCTACAAAAAATTAGCTAGG - Intronic
996375952 5:122807115-122807137 GTCTCTACAAAAAATTAGCTGGG + Intronic
996812382 5:127531781-127531803 GTCTCTACCAAAAATTAGCTGGG - Intronic
997024272 5:130039644-130039666 GTCTCTACAAAAAATTAGCCTGG - Intronic
997144795 5:131421218-131421240 ATCTCTACAAAAAATTAGCTGGG - Intergenic
997262018 5:132472565-132472587 GTCTCTACAAAAAATTAGCTGGG + Intronic
997948824 5:138225549-138225571 GTCTCCTCAAAAAATTATCTGGG - Intergenic
997994132 5:138572115-138572137 GTCTCTACAAAAAATTAGCCGGG - Intronic
998032203 5:138880304-138880326 GTCTCCACAAAAAATTAGCCAGG - Intronic
998459989 5:142302766-142302788 GTCTCTACTAAAAATTAGCTGGG + Intergenic
998854684 5:146382932-146382954 GTCTCTACTAAAAATTAGCTGGG + Intergenic
999061328 5:148638884-148638906 ATCTCCACAAAAAATTAGATGGG + Intronic
999464366 5:151788082-151788104 GTCTCTACAAAAAATTAGCTGGG - Intronic
999785954 5:154890922-154890944 GTCTCTACTAAAAATTAGCTGGG - Intronic
999870185 5:155741851-155741873 GTCTCTACCAAAAATTAGCTGGG - Intergenic
999900739 5:156084120-156084142 GTGTCTACAAAAATTTTGCTTGG + Intronic
999985104 5:156996030-156996052 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1000187182 5:158870513-158870535 ATCTCTACAAAAAATTAGCTGGG + Intronic
1001079628 5:168657843-168657865 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1001463776 5:171943617-171943639 GTCTTTACTAAAAATTAGCTGGG - Intronic
1001618942 5:173065801-173065823 CTCTACAAAAAAAATTAGCTGGG - Intronic
1001915807 5:175558950-175558972 GTCTCTACAAAAAATTAGCCTGG + Intergenic
1001972235 5:175966020-175966042 GTCTCTACAAAAAATTAGCCAGG + Intronic
1002138891 5:177126563-177126585 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1002166941 5:177353688-177353710 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1002245205 5:177877757-177877779 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1003066809 6:2910755-2910777 CTCTACACAAAAAATTAGGTAGG + Intergenic
1003204545 6:3995069-3995091 GCCTCTACAAAAAATTAGCTGGG + Intergenic
1003836587 6:10077871-10077893 GTCTCCACTAAAAATTAGCCAGG + Intronic
1003859422 6:10308545-10308567 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1003944164 6:11058356-11058378 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1004173902 6:13322078-13322100 GTCTCTACAAAAAATTAGCCAGG + Intronic
1004420756 6:15467673-15467695 CTCCCCACAAAAAATTAGCTGGG + Intronic
1004986694 6:21090963-21090985 GTCTCTACAAAAAATTAGCTAGG - Intronic
1005299593 6:24457710-24457732 GTCTCTACTAAAAATTAGCTGGG + Intronic
1005346801 6:24898400-24898422 GTCTGCAGAAAATATTAGCAGGG - Intronic
1005432753 6:25775594-25775616 ATCTCCACAAAAAATTAGCCAGG - Intronic
1006095613 6:31654518-31654540 GTGTCTACAAAAAATTAGCTAGG + Intronic
1006330227 6:33385091-33385113 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1007095534 6:39210437-39210459 GGAGGCACAAAAATGTAGCTGGG + Intronic
1007515659 6:42409116-42409138 GTCTCTACAAAAAATTAGCTGGG + Intronic
1007574661 6:42917147-42917169 CTCTTCACAACAATTTTGCTGGG + Intronic
1007602632 6:43092332-43092354 ATCCCTACAAAAATTTAGCTGGG - Intronic
1007654226 6:43442567-43442589 GTCTCCAAAAAAATTTAGCTGGG + Intronic
1007676268 6:43598042-43598064 GTCTCTACAAAAAATTAGCCAGG + Intronic
1007779520 6:44244896-44244918 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1008658418 6:53640654-53640676 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1008699169 6:54078421-54078443 GTCTCTACAAAAAATTAGCCAGG + Intronic
1009004389 6:57764997-57765019 GTCTCTACAAAAAATTAGCGGGG + Intergenic
1009244642 6:61221486-61221508 ATCTGTACAAAAAATTAGCCAGG - Intergenic
1009473478 6:64057990-64058012 GTCTCTACGAAAAATTAGCTGGG - Intronic
1009919410 6:70038894-70038916 GTCTCTACTAAAAATTAGCTGGG + Intronic
1009970377 6:70618982-70619004 GTCTGTACTAAAAATTAGCTGGG - Intergenic
1009989679 6:70826593-70826615 ATCTCTACAAAAAATTAGCTGGG + Intronic
1010687911 6:78873637-78873659 GTCTCTATAAAAAATTAGCTGGG - Intronic
1010692761 6:78930094-78930116 GTCTCTACAAAAAATTAGCTGGG - Intronic
1011040671 6:83026850-83026872 GTCTCTACAAAAAATTAACTGGG - Intronic
1011566132 6:88674377-88674399 ATCTCCACAAAAAATTAGCCAGG + Intronic
1011609061 6:89132675-89132697 GTCTCTACCAAAAATTAGCTGGG + Intergenic
1011726436 6:90214921-90214943 GTCTCTACAAAAAATTATCTGGG - Intronic
1011981427 6:93383854-93383876 GTCTGTACAAAAAATTAACCAGG - Intronic
1012440475 6:99257588-99257610 GTGTCTACAAAAATTTAGCCAGG - Intergenic
1012453319 6:99376800-99376822 GTCTCTACTAAAAATTAGCTGGG + Intronic
1012455972 6:99405723-99405745 GTCTCTACAAAAAATTAGCCGGG - Intronic
1012909024 6:105099023-105099045 CTCTACAAAAAAAATTAGCTGGG - Exonic
1012927302 6:105280729-105280751 GTCTCTACAAATAATTAGCTGGG - Intronic
1013532020 6:111029038-111029060 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1013996004 6:116308836-116308858 CCCAGCACAAAAAATTAGCTGGG - Intronic
1014228126 6:118871744-118871766 GTCTCTACAAAAAATTAGCCAGG + Intronic
1014541160 6:122678066-122678088 GTCTCTACAAAAAATTAGCCGGG - Intronic
1014617078 6:123616182-123616204 CTCTACAAAAAAAATTAGCTGGG + Intronic
1015115818 6:129648330-129648352 GTCTCTACAAAAAGTTAGCCAGG - Intronic
1015446472 6:133311484-133311506 ATCTCCACAAAAAATTAGCCAGG - Intronic
1015505448 6:133981397-133981419 GTCTGCTCAAAAGTTTAGAGAGG + Intronic
1015598630 6:134890952-134890974 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1015781337 6:136869404-136869426 GTCTACCCAAAAAATTAGCCAGG - Intronic
1016318664 6:142818506-142818528 GTCTCCACAAAAAATTAGCCAGG + Intronic
1016324876 6:142889300-142889322 GTCTCTACAAAATATTAGCTGGG + Intronic
1016504319 6:144761484-144761506 ATCTCTACAAAAAATTAGCTGGG + Intronic
1016637826 6:146315179-146315201 GTCTCTCCAAAAAGTTAGCTGGG + Intronic
1017179206 6:151534223-151534245 ATCTCTACAAAAAATTAGCTGGG - Intronic
1017366964 6:153654574-153654596 CTCTGTACAAAAAATTAGCTGGG + Intergenic
1017831358 6:158133136-158133158 ATCTCTACAAAAAATTAGCTGGG + Intronic
1018210320 6:161475063-161475085 GTCTCTACTAAAAATTAGCTGGG - Intronic
1018627758 6:165796254-165796276 ATCTCTACAAAAAATTAGCTGGG - Intronic
1019070802 6:169343174-169343196 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1019508890 7:1407385-1407407 GTCTTTAGAAAAAATTAGCTGGG - Intergenic
1019556975 7:1636933-1636955 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1019663175 7:2237165-2237187 GTCTCTACAAAAAATTAGCCAGG - Intronic
1019692005 7:2420636-2420658 ATCTCTACAAAAAATTAGCTGGG + Intronic
1019726232 7:2604277-2604299 GTCTCTACAGAAAATTAGCTGGG - Intronic
1019761040 7:2813085-2813107 GTCTACAAATAAAATTAGCTGGG - Intronic
1020061940 7:5159247-5159269 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1020126856 7:5537860-5537882 GTCTCTACAAAACATTAGCTGGG - Intronic
1020148978 7:5666973-5666995 GTCTGTACAAAAAATTAGCCAGG - Intronic
1020166207 7:5809433-5809455 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1020170543 7:5841382-5841404 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1020187118 7:5967847-5967869 GTCTCTACAAAAAATTAGCCAGG - Intronic
1020207751 7:6132091-6132113 GTCTCTACAAAAAATTAGCCAGG - Intronic
1020227119 7:6289079-6289101 CTCTACACAAAAATTTTGTTAGG - Intergenic
1020266449 7:6563519-6563541 ATCTCTACAAAAAATTAGCTAGG + Intergenic
1020295799 7:6756925-6756947 GTCTCTACAAAAAATTAGCCAGG + Intronic
1021095825 7:16535026-16535048 GTCTCTACAAAAAATTAGCTAGG + Intronic
1021469325 7:20983452-20983474 GTCTTCACAAAAAATTAGCCGGG - Intergenic
1022602183 7:31771883-31771905 GTCTCTACAAAAAATTAGCTGGG + Intronic
1022682848 7:32566335-32566357 ATCTCCACAAAAAATTAGCTGGG - Intronic
1022710983 7:32849945-32849967 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1022728472 7:33001372-33001394 GTCTCTACAAAAAATTAGCTGGG + Intronic
1022729981 7:33013289-33013311 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1023235209 7:38078897-38078919 TTCTCTACAAAAAATTAGCTGGG - Intergenic
1023816163 7:43951689-43951711 GTCTCTACAAAAAATTAGCCAGG - Intronic
1024157820 7:46643337-46643359 ATCTCCACAAAAAATTAGCTGGG - Intergenic
1024302250 7:47896166-47896188 GTCTCTACAAAAAATTAGCCAGG + Intronic
1024801545 7:53085989-53086011 GTCTGACCACAAATTTACCTAGG + Intergenic
1024867955 7:53925524-53925546 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1025191976 7:56902684-56902706 GTGTCCATAAAAATATAGCTTGG + Intergenic
1025679976 7:63674247-63674269 GTGTCCATAAAAATATAGCTTGG - Intergenic
1025937534 7:66049218-66049240 GTCTCTACCAAAAATTAGCTGGG - Intergenic
1025937834 7:66051267-66051289 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1025999968 7:66552938-66552960 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1026061549 7:67031030-67031052 GTCTCGACTAAAAATTAGCTGGG + Intronic
1026067133 7:67084681-67084703 ATCTTCACAAAAAATTAGCCAGG - Intronic
1026498886 7:70926046-70926068 GTCTCTACAACAATTTAGCTGGG + Intergenic
1026709799 7:72727646-72727668 ATCTTCACAAAAAATTAGCCAGG + Intronic
1026716801 7:72796402-72796424 GTCTCGACTAAAAATTAGCTGGG - Intronic
1026775587 7:73229201-73229223 GTCTTTACAAAAAATTAGCCGGG + Intergenic
1026866254 7:73825838-73825860 GTCTATACTAAAAATTAGCTGGG - Intronic
1026902322 7:74044078-74044100 CTCTACAAAAAAATTTAGCCAGG + Intronic
1026989825 7:74578344-74578366 GTCTCTACAAAAAATTAGCTGGG - Intronic
1026993148 7:74599124-74599146 GTCTCTACAAAAAATTAGCCAGG + Intronic
1027016444 7:74782573-74782595 GTCTTTACAAAAAATTAGCCGGG + Intronic
1027071584 7:75163363-75163385 GTCTTTACAAAAAATTAGCCGGG - Intergenic
1027253773 7:76416636-76416658 GTCTCTACAAAAAAATAGCTGGG + Intronic
1027779623 7:82505826-82505848 ATCTCTACAAAAATTTAGCTAGG - Intergenic
1028104316 7:86859124-86859146 ATCTCTAAAAAAATTTAGCTGGG - Intronic
1028545385 7:91993347-91993369 GTCTCTACAAAAAATTAGCTGGG - Intronic
1028696256 7:93716602-93716624 GTCTTTACTAAAAATTAGCTAGG + Intronic
1029257273 7:99278109-99278131 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1029318783 7:99738802-99738824 ATCTGTACTAAAAATTAGCTGGG - Intergenic
1029323713 7:99787782-99787804 ATCTGTACTAAAAATTAGCTGGG - Intergenic
1029336791 7:99907276-99907298 GTCTCTACTAAAAATTAGCTGGG - Intronic
1029390085 7:100269245-100269267 GTCTCCACACAAAATTAGCCAGG + Intronic
1029568029 7:101351947-101351969 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1029603566 7:101584472-101584494 ATCTCAACAAAAAATTAGCTAGG - Intergenic
1029657743 7:101938271-101938293 GTCTCTGCAAAAAATTAGCTGGG - Intronic
1029936011 7:104424819-104424841 GTCTCTACAAAAAATTAGCCGGG + Intronic
1030006925 7:105129120-105129142 GTCTCTACAAAAAATTAGCCGGG - Intronic
1030481208 7:110106149-110106171 ATCACCAAAAAAATTTAGCTGGG + Intergenic
1030959232 7:115893692-115893714 CTCTGTACAAAAATTTATTTGGG - Intergenic
1031104477 7:117523909-117523931 TTCTGTGCTAAAATTTAGCTTGG + Intronic
1031430755 7:121665713-121665735 AACTACAAAAAAATTTAGCTGGG - Intergenic
1032097148 7:128945271-128945293 GTCTTTACAAAAAATTAGCTGGG - Intronic
1032412464 7:131706998-131707020 GTCTCTACAAAAACTTAGCTGGG - Intergenic
1032719630 7:134540055-134540077 GTCTCTACCAAAAATTAGCTGGG + Intronic
1033105710 7:138520527-138520549 ATCCCCACAAAAAATTAGCTGGG + Intronic
1033381191 7:140821150-140821172 GTCTCTACAAAAAATTAGCCAGG - Intronic
1033714379 7:143984642-143984664 GTCTCCACTAAAAATTAGCTGGG + Intergenic
1033735722 7:144219636-144219658 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1033747329 7:144331317-144331339 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1033928087 7:146488787-146488809 GTCTCCACAAAAAACTAGCCAGG - Intronic
1034458205 7:151183239-151183261 ATCTCCACAAAAAATTAGCTGGG + Intronic
1034512198 7:151545094-151545116 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1034622524 7:152467315-152467337 ATCTATACAAAAAATTAGCTGGG + Intergenic
1035001225 7:155613644-155613666 GTCTCTACAAAAAATTAGTTGGG + Intronic
1035690535 8:1556817-1556839 GTCCCTACAACAATTTAGCTTGG - Intronic
1035870894 8:3135082-3135104 GTCTCTACAAAAAATTAGCTGGG - Intronic
1036144618 8:6243512-6243534 GTCTCCACAGAAAATTAGCTGGG + Intergenic
1036615550 8:10384839-10384861 GTCTCCAAAAAAAATTAGCTGGG + Intronic
1036717140 8:11136341-11136363 GTCTCTACTAAAAATTAGCTGGG + Intronic
1037358034 8:18043386-18043408 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1037944344 8:22977409-22977431 GTCTCTACAAAACATTAGCTGGG + Intronic
1037945374 8:22986425-22986447 GTCTCTACAAAAAATTAGCCAGG - Intronic
1038183713 8:25252990-25253012 GTCTCTACTAAAAATTAGCTGGG - Intronic
1038386982 8:27157616-27157638 GTGTGCACAAAAATTTACACTGG + Intergenic
1038768890 8:30457744-30457766 GTCTCTACTAAAAATTAGCTGGG - Intronic
1038987452 8:32827947-32827969 TTCTTTACAAAAAATTAGCTGGG - Intergenic
1039580398 8:38661482-38661504 GTCTGACCAAAAATTTACCAGGG - Intergenic
1039624772 8:39037584-39037606 GTCTCTACAAAAAATAAGCTGGG - Intronic
1040413352 8:47177035-47177057 ATATGCACAAAAAATTAGCCAGG + Intergenic
1040931458 8:52739296-52739318 GTCTCTACTAAAAATTAGCTGGG + Intronic
1041032158 8:53747995-53748017 GTCTCTACTAAAAATTAGCTGGG + Intronic
1041087531 8:54270723-54270745 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1041619446 8:59949313-59949335 GTCTCTACAAAAAATTAGCTAGG + Intergenic
1042129282 8:65571118-65571140 GTCTCTACAAAAAATTAGCCAGG - Intergenic
1042207411 8:66343278-66343300 GTCTCTACAAAAACCTAGCTGGG + Intergenic
1042532383 8:69829515-69829537 ATCTCCACAAAAAATTAGCTGGG + Intronic
1042706849 8:71672523-71672545 GTCTGCACAATAATAGAGATGGG + Intergenic
1042857321 8:73280529-73280551 AAATGCAAAAAAATTTAGCTGGG - Intergenic
1043929484 8:86074679-86074701 GTCTACACAAAAAATTATCCTGG + Intronic
1043952023 8:86320105-86320127 GTCTCTACAAAAAATTAGCCAGG - Intronic
1044040517 8:87362442-87362464 ATCTACAAAAAAATTTAGCAAGG + Intronic
1044075342 8:87815183-87815205 GTCTGTTCAAAAATTTATATTGG + Intergenic
1044255583 8:90056725-90056747 GTCTCTACAAAAAGTTAGCTAGG - Intergenic
1044689849 8:94866451-94866473 ATCTCTACAAAAAATTAGCTGGG - Intronic
1044747583 8:95385624-95385646 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1044888016 8:96800486-96800508 GTCTGTACAATAATTTCTCTGGG - Intronic
1044939541 8:97326859-97326881 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1044974893 8:97654929-97654951 GTCTCTACAAAAAATTAACTAGG + Intronic
1044976100 8:97667151-97667173 GTCTCTACAAAAAATTAGCTGGG - Intronic
1045018067 8:98016210-98016232 GTCTCCACAAAAAATTAGCCTGG + Intronic
1045087753 8:98705250-98705272 GTCTCTACAAAAAATTAGTTGGG + Intronic
1045204782 8:100027058-100027080 GTCTCTACAAAACATTAGCTGGG + Intronic
1045516884 8:102867426-102867448 GTCTTCACAAAAAATTAGCCAGG - Intronic
1046452377 8:114411106-114411128 GACTGTACAAAAAATTAGCTGGG - Intergenic
1046793709 8:118348235-118348257 GTCTCTACAAAAATTTAGCCAGG - Intronic
1047414431 8:124652332-124652354 GTCTCTACAAAAAATTAGCCAGG - Intronic
1047501432 8:125444870-125444892 GTCTATACAAAAAATTAGCCTGG - Intergenic
1047701734 8:127455897-127455919 GTCTGCAGAAATATTTAACCAGG - Intergenic
1049141340 8:140957265-140957287 CTCTACAGAAAAAATTAGCTGGG + Intronic
1049970492 9:817846-817868 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1049977197 9:871194-871216 GTCTCTACAAAAAATTAGCCGGG - Intronic
1050347020 9:4700314-4700336 GTCTCTACAAAAAATTAGCTGGG - Intronic
1050516665 9:6451639-6451661 GTCTGAACTAAAAATTAGCCGGG - Intronic
1051295453 9:15590370-15590392 ATCTTCACAAAAACTTAACTAGG + Intronic
1051423707 9:16913999-16914021 ATCTCCACAAAAAATTAGCCTGG - Intergenic
1051424388 9:16918892-16918914 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1051464827 9:17365783-17365805 GATTGTACAAAAAATTAGCTGGG + Intronic
1052798402 9:32945394-32945416 GTCTTTAAAAAAAATTAGCTGGG + Intergenic
1052817970 9:33116390-33116412 GTCTCTACTAAAAATTAGCTGGG - Intronic
1052876037 9:33565074-33565096 GTCTGCACAAAGATTTGTATAGG - Intronic
1053499973 9:38579274-38579296 GTCTGCACAAAGATTTGTATAGG + Intergenic
1053661113 9:40280244-40280266 GTCTGCACAAAGATTTTTATGGG - Intronic
1054362100 9:64133143-64133165 GTCTGCACAAAGATTTTTATGGG - Intergenic
1054373231 9:64426459-64426481 GTCTGCACAAAGATTTTTATGGG - Intergenic
1054523497 9:66096040-66096062 GTCTGCACAAAGATTTTTATGGG + Intergenic
1054680864 9:67916237-67916259 GTCTGCACAAAGATTTTTATGGG - Intergenic
1054776169 9:69125465-69125487 GTCTCTACTAAAAATTAGCTGGG - Intronic
1055323859 9:75108062-75108084 GTCTCTACAAAAAATGAGCTGGG + Intronic
1055593022 9:77838016-77838038 GTCTCTACTAAAAATTAGCTGGG - Intronic
1055891316 9:81127012-81127034 GTCTCCACAAAAATGGAACTGGG - Intergenic
1056130609 9:83583187-83583209 TTCTGCACAAAAATTTGTCCTGG + Intergenic
1056648024 9:88431878-88431900 TTCTCTACAAAAAATTAGCTGGG + Intronic
1057133657 9:92671653-92671675 GTCTCTACAAAAAATTAGCAGGG + Intergenic
1057390333 9:94637557-94637579 GTCTCTACCAAAAATTAGCTGGG - Intronic
1057679396 9:97163968-97163990 GTCTGCACAAAGATTTGTATAGG + Intergenic
1057808520 9:98239217-98239239 ATCTCTACAAAAAATTAGCTGGG - Intronic
1057980966 9:99662770-99662792 GCCTCCCCCAAAATTTAGCTGGG + Intergenic
1058138433 9:101333617-101333639 CTCTCCAAAAAAAATTAGCTGGG + Intergenic
1058398247 9:104581237-104581259 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1058403535 9:104644472-104644494 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1058485344 9:105438619-105438641 GCCTGAACAAGAATTTCGCTGGG - Intronic
1058660801 9:107266794-107266816 GTCTCCACAAAAAATAAGCCAGG - Intergenic
1058855591 9:109058772-109058794 ATCTCTACAAAAAATTAGCTGGG - Intronic
1059233649 9:112743964-112743986 GTTTCTACAAAAACTTAGCTGGG - Intergenic
1059511767 9:114855050-114855072 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1059566569 9:115388404-115388426 ATCTCTACAAAAACTTAGCTGGG - Intronic
1060038398 9:120278791-120278813 GGCTCTACAAAAAATTAGCTGGG + Intergenic
1060693900 9:125689576-125689598 ATCTCTACAAAAAATTAGCTGGG + Intronic
1061315238 9:129791455-129791477 GTCTCTACTAAAAATTAGCTGGG + Intergenic
1061562313 9:131413534-131413556 GTCTCCACTAAAAATTAGCTGGG - Intronic
1061616943 9:131786624-131786646 ATCTCCACAAAAAATTAGCTAGG - Intergenic
1061691837 9:132339312-132339334 ATCTCTACAAAAAATTAGCTGGG + Intronic
1203692246 Un_GL000214v1:54934-54956 GTCTGCACAAAGATTTTTATGGG + Intergenic
1203706814 Un_KI270742v1:57676-57698 GTCTGCACAAAGATTTTTATGGG - Intergenic
1203556432 Un_KI270744v1:1826-1848 GTCTGCACAAAGATTTTTATGGG + Intergenic
1203644049 Un_KI270751v1:49257-49279 GTCTGCACAAAGATTTTTATGGG - Intergenic
1185662949 X:1741524-1741546 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1185952080 X:4448639-4448661 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1186371780 X:8954417-8954439 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1186405112 X:9294998-9295020 ATCTCTACAAAAAATTAGCTGGG + Intergenic
1186494708 X:10002907-10002929 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1187071920 X:15897007-15897029 GTCTCTACAAAAAATTAGTTGGG + Intergenic
1187244408 X:17540909-17540931 GTCTCTACAAAAAATTAGCTGGG + Intronic
1187359580 X:18612497-18612519 GTCTCTACAAAAAATTAGCCAGG + Intronic
1187408403 X:19024941-19024963 GTCTCTACAAAAAATTAGCCAGG - Intronic
1187540849 X:20192759-20192781 ATCTCTACAAAAAATTAGCTGGG - Intronic
1187545580 X:20248641-20248663 GTTTATACAAAAAATTAGCTGGG - Intronic
1187861829 X:23690343-23690365 GTAAGTACAAAAAATTAGCTTGG + Intergenic
1187905642 X:24063609-24063631 GTCAATACAAAAAATTAGCTGGG + Intronic
1188275867 X:28199531-28199553 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1188320875 X:28735609-28735631 GTCTTAAAAAAAAATTAGCTGGG + Intronic
1188386480 X:29566107-29566129 GTCTCTACAAAAAATTAGCCGGG - Intronic
1188536462 X:31202022-31202044 GTCTCCACAAAAAATTAGCCAGG + Intronic
1188914175 X:35889814-35889836 ATCTCTACAAAAAATTAGCTGGG - Intergenic
1189807811 X:44752849-44752871 GTCTCTACAAAAAGTTAGCTGGG + Intergenic
1189943103 X:46147598-46147620 ATGTGCACAAAAAATTTGCTGGG + Intergenic
1189964710 X:46360948-46360970 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1190051276 X:47151197-47151219 GTCTCTACAAAAAATTAGCTGGG - Intronic
1190070685 X:47276736-47276758 GACTTCCCAAAAATGTAGCTGGG + Intergenic
1190091407 X:47440669-47440691 GTCTCTACTAAAAATTAGCTGGG - Intergenic
1190164619 X:48062777-48062799 GTCTCTACAAAAAATTAGCCGGG + Intronic
1190191160 X:48278341-48278363 GTGTCTACAAAAAATTAGCTGGG + Intergenic
1190307318 X:49091958-49091980 GTCTCTACAAAAAATTAGCCAGG + Intronic
1190777942 X:53569185-53569207 GTCTCTACAGAAAATTAGCTGGG - Intronic
1190806117 X:53838867-53838889 AACTACAAAAAAATTTAGCTGGG - Intergenic
1190822083 X:53983023-53983045 ATCTGTACAAAAAATAAGCTGGG + Intronic
1190863423 X:54364427-54364449 CTCTACAAAAAAAGTTAGCTGGG + Intergenic
1192159806 X:68776008-68776030 GTCTTTACAAAAAATTAGCAGGG + Intergenic
1192470782 X:71396862-71396884 GTCTCTACAAAAATTTAGCTGGG + Intronic
1192541566 X:71977579-71977601 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1192595357 X:72401393-72401415 CTCTACAAAAAAAATTAGCTGGG - Intronic
1192815536 X:74586923-74586945 ATCTCCACAAAAAATTAGCCAGG + Exonic
1192860148 X:75059307-75059329 ATCTCTACAAAAAATTAGCTAGG + Intronic
1193095725 X:77546650-77546672 GTCTCTACAAAAAATTAGCCAGG - Intronic
1193107895 X:77699292-77699314 ATCTCCACAAAAAATTAGCCAGG - Intronic
1193266285 X:79473759-79473781 TTCTGAAAAAAAATTTTGCTGGG - Intergenic
1193495776 X:82210827-82210849 TTCTTCAGGAAAATTTAGCTAGG + Intergenic
1193834612 X:86326304-86326326 ATCTCTACAAAAAATTAGCTGGG + Intronic
1193842615 X:86426151-86426173 GTGTACACATAAAGTTAGCTAGG + Intronic
1194697425 X:97071519-97071541 GACTGCACATAACTTTAGATTGG + Intronic
1195196402 X:102501539-102501561 GTCTCCACAAAAAATTAGCTGGG - Intergenic
1195279480 X:103317251-103317273 GTCTCTACAAAAAATTAGCCAGG + Intergenic
1196086853 X:111692947-111692969 GTCTCTACAAAAAATTAGCCAGG - Intronic
1196362919 X:114887851-114887873 GTCTACTAAAAAAATTAGCTGGG + Intronic
1196821895 X:119708173-119708195 GTCTACACAAAAAACTAGCTGGG - Intergenic
1197235520 X:124058316-124058338 GTCTGTACTAAAAATTAGCTGGG - Intronic
1197247204 X:124178429-124178451 GTCTTTACTAAAAATTAGCTGGG + Intronic
1198119689 X:133579702-133579724 GTCTCTACAAAAAATTAGCTGGG - Intronic
1198477473 X:137009403-137009425 GTCTCTACAAAAAATTAGCTGGG + Intergenic
1198652203 X:138875069-138875091 GTCTCTACTAAAAATTAGCTGGG + Intronic
1199447251 X:147939735-147939757 GAAAGTACAAAAATTTAGCTGGG + Intronic
1200325204 X:155230842-155230864 CTCTACCAAAAAATTTAGCTGGG - Intronic
1200641566 Y:5725104-5725126 GTCTCTACTAAAAATTAGCTGGG + Intronic
1201380985 Y:13378853-13378875 GTCTCTACAAAAAATTAACTGGG - Intronic
1201718807 Y:17075245-17075267 GTCTGTACACAATATTAGCTGGG - Intergenic
1201738770 Y:17301162-17301184 GTCTCTACAAAAAATTAGCTGGG - Intergenic
1201854307 Y:18524187-18524209 GTCTCTACAAAAATGTAGCCGGG + Intergenic
1201879014 Y:18796198-18796220 GTCTCTACAAAAATGTAGCCGGG - Intronic
1202604757 Y:26629295-26629317 GTCTCTACAAAAAATTAGCTGGG + Intergenic