ID: 1163129996

View in Genome Browser
Species Human (GRCh38)
Location 19:15266378-15266400
Sequence CTTGAGATGCACAGGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163129996_1163130002 24 Left 1163129996 19:15266378-15266400 CCATGTTCCCTGTGCATCTCAAG 0: 1
1: 0
2: 0
3: 15
4: 207
Right 1163130002 19:15266425-15266447 TTTCCCAATTCTCCTTCCTCAGG 0: 1
1: 0
2: 2
3: 41
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163129996 Original CRISPR CTTGAGATGCACAGGGAACA TGG (reversed) Intronic
900880072 1:5374501-5374523 CATGACAGGCACTGGGAACATGG + Intergenic
901468991 1:9442559-9442581 TTTGAGATGCACAGGCAGAATGG + Intergenic
901675100 1:10878676-10878698 CTTCAGGGGCACTGGGAACAGGG + Intergenic
903912911 1:26741409-26741431 CTTGAAATGCACTGAGAAAAAGG + Intronic
905791324 1:40791303-40791325 CTTGAAATGCATAGGGTACCAGG + Intronic
905791798 1:40793546-40793568 TTTGAGATGCCCAGGGAATGAGG - Intronic
906581702 1:46940536-46940558 TTTGAGTTGCACATTGAACAGGG - Intronic
906602014 1:47138362-47138384 TTTGAGTTGCACATTGAACAGGG + Intronic
907327882 1:53652700-53652722 CTTGTGTTGCACAGGGACCGAGG - Intronic
911439282 1:97905243-97905265 CTAAAGATGCAAAGGGAGCAAGG + Intronic
912418208 1:109525537-109525559 GTTGAGATGAACTGAGAACATGG + Intergenic
912507314 1:110165233-110165255 CTTGTGTAGCACAGGCAACACGG + Intronic
912711922 1:111956244-111956266 CTCCAGATGCACAGGGGTCAGGG - Intronic
913434268 1:118830926-118830948 TTTGAGATGCACACTGAAGAAGG + Intergenic
916951623 1:169785811-169785833 ATTGATATGCACAGGAGACAGGG - Intronic
917288179 1:173443051-173443073 CTTGAGATGGGCAGGAAAGAAGG + Intergenic
918370092 1:183852376-183852398 GTTGAGAAGCACAGGAAACAGGG - Intronic
918899078 1:190389348-190389370 CTTGAGATTCACATGCCACATGG - Intronic
920432261 1:205926595-205926617 CTTGAGATTGACAGCGATCAGGG + Exonic
921140803 1:212304668-212304690 CTTGAGAGGCTTAGGCAACAAGG - Intronic
921420391 1:214940641-214940663 CTTAGTATGTACAGGGAACATGG + Intergenic
922542874 1:226432613-226432635 CTGGAATTGCACAGGGATCATGG + Intergenic
924318696 1:242825271-242825293 ATTGAGATGCATAGAGAAAAAGG + Intergenic
924635957 1:245788088-245788110 CTAGATTAGCACAGGGAACAGGG + Intronic
1062850748 10:740649-740671 CGTGAGATGCACAGAGAAAATGG - Intergenic
1063173555 10:3531385-3531407 CCTGAGATGCACAGGATATAAGG + Intergenic
1064534291 10:16342831-16342853 CTAGAGTTGCACAGAGAAGAGGG + Intergenic
1064832348 10:19484251-19484273 TTTTAGATTCACAGGGCACATGG - Intronic
1065494838 10:26317479-26317501 CTTGAGAAGGGCAGGGATCAGGG + Intergenic
1065988622 10:30983322-30983344 CTCGAGCTGCACAGGAAGCATGG + Intronic
1067724646 10:48760832-48760854 CATGAGCTGCACAGAGCACAGGG - Intronic
1069737541 10:70667029-70667051 ACTGAGTTTCACAGGGAACAGGG - Intergenic
1070398295 10:76031902-76031924 CATGAGATGGGCAGCGAACATGG - Intronic
1070774021 10:79099526-79099548 CCTGTGCTGCACTGGGAACAGGG + Intronic
1071597321 10:86937763-86937785 CTTGAGATACTCAGGGGAGAGGG + Intronic
1073449668 10:103602035-103602057 CTTGGGGCGCACAGGGGACACGG + Exonic
1074473955 10:113752829-113752851 TTTGACATCCACAGGGCACAGGG + Intronic
1074910037 10:117900080-117900102 CTTCAGAAGCACAGGGACTAAGG + Intergenic
1075681704 10:124338035-124338057 CTTGGGCTGTACAGGAAACATGG - Intergenic
1076474893 10:130744988-130745010 CTTGGGATCCACAGAGCACAGGG - Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1080738220 11:35038442-35038464 CTTGAGATGCACAAGAAAATTGG + Intergenic
1080817552 11:35772891-35772913 CTTGAGATTTAAAGGGGACAAGG + Intronic
1085795114 11:79532341-79532363 TTTGAGAAGCACAGTGACCAAGG + Intergenic
1088503821 11:110510061-110510083 TTTGAGATGCAAAGAGAAGATGG - Intergenic
1088694245 11:112353094-112353116 CTTGTTATGCACAGGGAAGTTGG - Intergenic
1088714369 11:112535935-112535957 CTTGAGAGGCGCAGTGATCAAGG - Intergenic
1089132795 11:116225319-116225341 CCTGAGATCCCCAGGGGACAGGG - Intergenic
1089279953 11:117366972-117366994 CTTGAGATGCTCAAGGACCTGGG + Intronic
1090671738 11:128952226-128952248 CTTAAGAAGCACAGGGAAATCGG + Intergenic
1090854510 11:130599579-130599601 CCTGAGATGCACAGGGAAATGGG + Intergenic
1091698392 12:2643282-2643304 CTAAAGATGGACAGGGACCATGG - Intronic
1091965044 12:4733464-4733486 CAAAAGATGCACAGGAAACAGGG + Intronic
1092157673 12:6294988-6295010 CTAGTTATGCAGAGGGAACAGGG + Intergenic
1093899201 12:24610611-24610633 CTTCAAAAGCACAGGAAACAAGG - Intergenic
1095059943 12:37673345-37673367 ATTGAGATGCACAGGTGAAAAGG - Intergenic
1095880425 12:47130006-47130028 CTCTAGATGAAAAGGGAACAAGG - Intronic
1099123300 12:78719774-78719796 CTTCACATTCCCAGGGAACATGG - Intergenic
1099249478 12:80235514-80235536 CCTGGGATGCCCAGGGAACATGG + Intronic
1100856720 12:98763958-98763980 CATGACATCCACAGGGAACCTGG - Intronic
1101640514 12:106583237-106583259 CTAGAGATGCCCAGGGAGGAAGG - Intronic
1101844928 12:108355710-108355732 CTTGAGATTCCTGGGGAACAAGG - Intergenic
1103024387 12:117561936-117561958 CTGGAGATTCACAATGAACAAGG + Intronic
1105747536 13:23391894-23391916 CTTCATGTGCACATGGAACATGG + Intronic
1105985401 13:25561278-25561300 CAAGAGATGCAGAGGGAACAGGG - Intronic
1108144575 13:47463490-47463512 CCTGAGAGCCACAGGGAGCAGGG + Intergenic
1108417676 13:50215984-50216006 CTCAAAATGCACATGGAACATGG + Intronic
1108745950 13:53393966-53393988 CTTCAGATGCATAGTCAACAGGG - Intergenic
1110541717 13:76713628-76713650 CTAGAAGTGCTCAGGGAACAAGG + Intergenic
1111200398 13:84928153-84928175 GTTGGGTGGCACAGGGAACAGGG - Intergenic
1111271234 13:85889798-85889820 CATGAGAAGCACAGGGTAAATGG - Intergenic
1112261570 13:97882411-97882433 CTTGATACGGACAGGGGACAGGG - Intergenic
1115721000 14:36161524-36161546 CTGGAGATACCCAGGCAACAGGG - Intergenic
1118303402 14:64634766-64634788 CAGGAGGTGCACAGGGAACAGGG + Intergenic
1119106883 14:71932834-71932856 CTGGAGAAGCCCAGGGAACCGGG - Exonic
1120027246 14:79600396-79600418 CTTCAGATGCACAAGGTTCAAGG + Intronic
1122263622 14:100536830-100536852 CTTGAGATGTACTGGGGCCACGG - Intergenic
1122515878 14:102308063-102308085 CTTAAGATGAACTTGGAACAAGG - Intergenic
1124346196 15:28923070-28923092 TTTGAGGTGCAAAGGGGACAAGG - Intronic
1124823922 15:33074682-33074704 CTTGTGATGACCAAGGAACACGG + Intronic
1126620644 15:50636125-50636147 CTTGCGGTGCACAGAGAAAATGG + Intronic
1128923028 15:71629468-71629490 CCTGAAAGACACAGGGAACACGG - Intronic
1130353100 15:83108142-83108164 CGTGAGATGCAAAAAGAACAAGG - Intronic
1132212659 15:100035973-100035995 AGTGAGAAGCACAGAGAACATGG + Intronic
1132321614 15:100929726-100929748 CGTGAGAGCCACAGGAAACAGGG + Intronic
1136016295 16:27403233-27403255 CTCCACATGCACAGGGAACTGGG - Intronic
1136174614 16:28508164-28508186 CTGGAGACGGACAGGGAACTGGG + Intronic
1136385239 16:29921377-29921399 CGTGAGGTGCAGAGGGAACCTGG + Intronic
1138035179 16:53597182-53597204 TATGGGATGCACATGGAACATGG - Intergenic
1138262863 16:55637883-55637905 CTTTAGAGGCACAGGTAATAGGG + Intergenic
1138793052 16:59931380-59931402 CTAGACATGAACAAGGAACAAGG - Intergenic
1144036485 17:11370612-11370634 CTTGAGGAGCACAGGCAAGATGG - Intronic
1145732642 17:27203099-27203121 ATTGAGACTCACAGGGAACAGGG - Intergenic
1145813586 17:27780195-27780217 CATGTCATGCAAAGGGAACAGGG + Intronic
1146226653 17:31072739-31072761 ATTGAGGCCCACAGGGAACAGGG + Intergenic
1146648625 17:34592253-34592275 CTGCAGAAGCACTGGGAACATGG - Intronic
1146807031 17:35872816-35872838 CTTAAGATGCAGAGAGAATAAGG + Intronic
1152260454 17:79263953-79263975 CTTGAGACACACAAGGAAGAAGG + Intronic
1152838862 17:82553471-82553493 CTTGACATGCAGAGGAGACAAGG - Intronic
1152939748 17:83162051-83162073 CTTGAGCTGCAAAGCAAACAAGG - Intergenic
1155267054 18:24104360-24104382 CCTTAAATGCACAGGGCACAGGG + Intronic
1155888974 18:31242969-31242991 CTTGAGCTGCACAGAGACCCAGG + Intergenic
1156257208 18:35409771-35409793 CTTGAGGGGCAAAGGGAACGTGG + Intergenic
1156530084 18:37806487-37806509 CCTGAGAGGCACAGGGGGCAGGG - Intergenic
1156751242 18:40458423-40458445 CTTGAGATAGACAGGAAATATGG - Intergenic
1158381947 18:56941467-56941489 CTTGAATTGCAGAGGGAACCAGG + Intronic
1159493457 18:69168420-69168442 ATTGAGATGCACAGTGAGCCAGG - Intergenic
1160526106 18:79538731-79538753 CATGACACGCACAGGGAAAAGGG - Intergenic
1161454248 19:4362233-4362255 CTTGAGATGGGCAGAGAACAGGG + Intronic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1163129996 19:15266378-15266400 CTTGAGATGCACAGGGAACATGG - Intronic
1164685125 19:30161460-30161482 CTTCAGAACCACAGGGACCAGGG + Intergenic
1165046380 19:33108203-33108225 CGGGAGATGGACAGGAAACAAGG - Intronic
1165773124 19:38389700-38389722 CGGGAGATGGGCAGGGAACAGGG - Intronic
1166906242 19:46110418-46110440 CTGGAGAGCCACAGGGGACAAGG - Intergenic
1168129384 19:54307830-54307852 GTTGAGAGGCACAGGGAACTAGG - Intronic
1168584156 19:57579039-57579061 CCTGAGATTCACCCGGAACAAGG + Intronic
929925041 2:46200934-46200956 CCTGAGATTTACAGGGCACAGGG + Intergenic
931561522 2:63566961-63566983 CAAGAGATGCACAGGGCAAATGG + Intronic
931758303 2:65394101-65394123 CCAGAGATGCACTGGGCACAGGG - Intronic
931900347 2:66781517-66781539 CTTGACTTGCACAGGTTACAAGG + Intergenic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
933261303 2:80134563-80134585 ATTCAGATGCACAGGGCAAATGG + Intronic
935677620 2:105609476-105609498 CTTGGGATGCACAGGGCAGAGGG - Intergenic
939498848 2:142956027-142956049 TTTGAGATTCACTGGAAACATGG + Intronic
940482583 2:154253973-154253995 CTTGAGATACACAGTGATAAGGG + Intronic
941176719 2:162206137-162206159 CTTTAGATGAACAGGTAACTTGG + Intronic
941356883 2:164504676-164504698 ATTGAAATGAACAGGAAACATGG + Intronic
941849427 2:170164421-170164443 CTGGAGAGGCAAAGGGAAGAGGG - Intergenic
942087982 2:172461518-172461540 CTTCAGAGCCACAGGGACCAAGG - Intronic
943384555 2:187185082-187185104 CTTGATAGGCACAGGAAGCAGGG - Intergenic
943416160 2:187607641-187607663 CGTGAGATCTACATGGAACATGG + Intergenic
946623605 2:221587149-221587171 CTTCATATGCACAGAGAAAAGGG + Intergenic
948132099 2:235608447-235608469 CTGGAGATGCTCAGGGAAGGGGG + Intronic
1168945616 20:1754139-1754161 CTTCAAAAGCACAGGCAACAAGG + Intergenic
1169317922 20:4608755-4608777 CCTGACATGGACAGGGCACAGGG + Intergenic
1170294297 20:14807121-14807143 GTTGGGAGGCACAGGGGACAGGG - Intronic
1171458329 20:25284168-25284190 CTTCACATGCACATCGAACATGG - Exonic
1173298012 20:41776574-41776596 CTCGTAATGCACAGGCAACAGGG + Intergenic
1175598792 20:60256250-60256272 CAGGAGATGCACAGGAAATAAGG + Intergenic
1175773011 20:61635568-61635590 CCTGAGAAGGACAGGGCACAAGG + Intronic
1176925374 21:14743205-14743227 CTTCAGATTCAGAGGGAACAAGG + Intergenic
1177943489 21:27440200-27440222 ATTGATATGCACAGGAGACAGGG + Intergenic
1178291237 21:31370311-31370333 ATTGAGATACACAGGCAATATGG + Intronic
1178477636 21:32951216-32951238 TTTAAGAAGCACAGAGAACACGG - Intergenic
1179310724 21:40193679-40193701 CTTGAGATGCCCAGGAGACTGGG - Intronic
1181031158 22:20149403-20149425 CTGGAGATTCTCAGGTAACACGG - Exonic
1181533888 22:23532016-23532038 CTGGAAATGCACAGAGAGCAGGG + Intergenic
1182852077 22:33483863-33483885 GATGAGATGCATGGGGAACAGGG - Intronic
1183119645 22:35720545-35720567 CTGGAGATGGACAAGGATCAGGG - Intronic
1183296445 22:37032546-37032568 CATGAGAAGCTCAGGGAAGATGG + Intergenic
1183422395 22:37719457-37719479 CTTCAGATGCTCAGGGAAGCAGG + Intronic
1184553547 22:45219023-45219045 CTTCAGATGCACACTGAAAAGGG + Intronic
950698333 3:14721812-14721834 GTTGAGATGCCCAGGGGTCAGGG - Intronic
953864945 3:46575985-46576007 GCTGAGATTCACAGGGGACAGGG - Intronic
957976286 3:87448838-87448860 CTTGATATGCAGAGGTAAGAAGG + Intergenic
958823898 3:99007426-99007448 CTGGAGCTGAACAGGGAACTCGG - Intergenic
959967816 3:112376251-112376273 GTTGATATGGACAGGAAACAGGG - Intergenic
961650670 3:128415323-128415345 CTTGAGATGCCCATGGGCCATGG + Intergenic
962025255 3:131540990-131541012 CTTGAGCTGCCCTGGCAACAGGG - Intronic
965483852 3:169254347-169254369 CTTGAGAATCTCAGAGAACAGGG - Intronic
966976268 3:185086103-185086125 CCTCAGATCCAGAGGGAACAAGG + Intronic
969117653 4:4881958-4881980 CTTGAGGGGCAGAGGGAACCTGG - Intergenic
969682094 4:8649032-8649054 GGTGAGCGGCACAGGGAACATGG - Intergenic
972815338 4:42638868-42638890 CTAAAAATGCACAGGAAACAAGG + Intronic
976378596 4:84374065-84374087 CTTGGCAGGCACAGGGAAAATGG - Intergenic
976907347 4:90256135-90256157 CTTCAGATGGACATGGAACAGGG - Intronic
978765570 4:112401686-112401708 CATGAGATTCACAGGGATCCTGG + Intronic
985183586 4:187292092-187292114 TTTGTGATGCACTTGGAACAAGG - Intergenic
986536589 5:8794192-8794214 CCAGAGATGCACAGGGACCCTGG - Intergenic
989262619 5:39435386-39435408 TTTGATATACACAGGGAATAAGG + Intronic
990680398 5:58236640-58236662 CTTGGGAATCACTGGGAACAAGG - Intergenic
991489711 5:67170650-67170672 GTTGAAATGCTCAGGGACCAAGG - Intergenic
994172401 5:96671735-96671757 AGTGAGATGAGCAGGGAACAGGG - Intronic
996287675 5:121813511-121813533 GTTGGGTGGCACAGGGAACAAGG + Intergenic
1000262423 5:159600501-159600523 CTTAGGCTGCACAGGGATCAGGG + Intergenic
1000839247 5:166196187-166196209 CTTGGGATGCACTGGCAATATGG - Intergenic
1000991288 5:167914697-167914719 CCTGAGAGGCTCAGGGAGCATGG - Intronic
1001441274 5:171744816-171744838 CTTGAGAAGCACTGGAAACAAGG + Intergenic
1006918134 6:37609276-37609298 CTGGAGATACTCAGGAAACAAGG - Intergenic
1006973989 6:38079672-38079694 CATGAGCTGCACAGTGCACAAGG - Intronic
1009811539 6:68673858-68673880 CTTCAAATGCAGAGGGAATAGGG + Intronic
1011293985 6:85807596-85807618 CTTGAAATGTAAAAGGAACATGG - Intergenic
1018254530 6:161904831-161904853 CTTGAGATGCAGAGGACAAAAGG + Intronic
1020625867 7:10578726-10578748 GTTGAGAAGTACAGGGAATAGGG - Intergenic
1023183624 7:37511398-37511420 CATGAGATGAACAGTGAGCAAGG - Intergenic
1024926357 7:54619324-54619346 CTGGAGCTGCACAGGGCATAAGG + Intergenic
1026466179 7:70656789-70656811 GTTGAAATGAACAGGTAACATGG - Intronic
1026989454 7:74575369-74575391 ATGGAGATGGACAGGGAAGATGG + Intronic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1031831633 7:126634461-126634483 TTTGAAATGCAAAGGAAACAAGG - Intronic
1035764367 8:2093948-2093970 CCTGAGAAACACAGGGATCAGGG - Exonic
1036401233 8:8410288-8410310 CTAGAATTGCACAGAGAACAGGG + Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1040319419 8:46285187-46285209 CTTGAGAGACACAGGCAACTTGG + Intergenic
1041466443 8:58162293-58162315 CCTGAGATGCATAGCTAACAAGG + Intronic
1045703808 8:104897149-104897171 CTGCAGATGCACAAGAAACAAGG + Intronic
1046261136 8:111769472-111769494 CCTGAGATACACTGGGATCAAGG - Intergenic
1046859366 8:119072704-119072726 CTGGAGTTCCACAGGGACCAAGG - Intronic
1047589267 8:126309859-126309881 CTTGAGAAGAAAAGGGAAAATGG - Intergenic
1048457083 8:134587893-134587915 CCTGCTATGCACAGGGCACAGGG + Intronic
1049424342 8:142531448-142531470 CGTGGGGTGCACAGGGAGCAGGG + Intronic
1050938882 9:11433506-11433528 CTGGAGATGAACATGGCACAGGG + Intergenic
1055045168 9:71916590-71916612 CTTGAGATGGAGATGGAAAATGG + Intronic
1057005842 9:91558117-91558139 CTTGAGATGCGGAGGGCACTTGG + Intergenic
1058453643 9:105119465-105119487 CCTGAGAACCACAGGGAAGAAGG - Intergenic
1058888027 9:109337627-109337649 CTTGAGATGCTCAGGGAAAGAGG - Intergenic
1059326697 9:113508036-113508058 CATGAGATGCTCTGGGAAAAAGG + Intronic
1059458056 9:114412202-114412224 TTTCAGATGCATAAGGAACATGG - Intronic
1060341757 9:122783517-122783539 CTTGAGAAGCACAGTGGAGAGGG + Intergenic
1061246594 9:129403918-129403940 CTGGAAATGCACAGAGAGCAGGG - Intergenic
1186465191 X:9779339-9779361 CTTCACCTGCACAGAGAACAGGG - Intronic
1188054430 X:25525011-25525033 CTTGAGATGGGCAGGGTTCATGG - Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1190792310 X:53711774-53711796 CTGGAGATGAACAGAGACCAGGG + Intergenic
1192005585 X:67208528-67208550 CTTGAGAGGCAGACAGAACAGGG + Intergenic
1194889005 X:99354370-99354392 CTTCTGAGGCACAGGGAACTGGG - Intergenic
1195527437 X:105908148-105908170 CCTAAGAAGCAGAGGGAACAAGG + Intronic
1197094325 X:122575008-122575030 CTGAAGCTGCACAGGGAAAACGG + Intergenic
1197602244 X:128543865-128543887 CTTGAGAGCCACATGGAGCAGGG - Intergenic
1197851469 X:130865392-130865414 GTTGAAATGCACAGTGAAGATGG - Intronic
1201669137 Y:16497040-16497062 CCTGAGAAGCACAGGATACATGG + Intergenic
1202075359 Y:21031950-21031972 CTTGAGAACCACAGGGAGCAGGG - Intergenic