ID: 1163130265

View in Genome Browser
Species Human (GRCh38)
Location 19:15268057-15268079
Sequence TCAGTTCTAAACTGAGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163130262_1163130265 3 Left 1163130262 19:15268031-15268053 CCTCATCTATAACATGCTGTTCC 0: 1
1: 0
2: 2
3: 15
4: 204
Right 1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 154
1163130260_1163130265 15 Left 1163130260 19:15268019-15268041 CCCACTCTGTCACCTCATCTATA 0: 1
1: 0
2: 1
3: 26
4: 312
Right 1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 154
1163130261_1163130265 14 Left 1163130261 19:15268020-15268042 CCACTCTGTCACCTCATCTATAA 0: 1
1: 0
2: 5
3: 55
4: 370
Right 1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163130265 Original CRISPR TCAGTTCTAAACTGAGAGCC TGG Intronic
900850336 1:5137457-5137479 TCAGCACTTAACAGAGAGCCTGG + Intergenic
905038352 1:34931186-34931208 TCAGTTCTAAAGTGGGTTCCTGG - Intergenic
908169230 1:61488355-61488377 TCAGATTTAAGCTGATAGCCGGG - Intergenic
909269001 1:73599646-73599668 TCAGTTCAAATCTGAAAGCCTGG + Intergenic
915790805 1:158668893-158668915 TCACTTCTCAACTTAGATCCTGG + Intronic
916589092 1:166173175-166173197 TCAGTTCTAAGCACAGTGCCTGG + Intergenic
917592210 1:176487867-176487889 TCAGTTTAAAATTGAGAGACTGG - Intronic
919831342 1:201542165-201542187 TGAGCCCTAAACTGAAAGCCAGG - Intergenic
920266124 1:204724508-204724530 TCAATTTTAAACTGTAAGCCAGG + Intergenic
923624271 1:235601416-235601438 TTGGTTATACACTGAGAGCCGGG - Intronic
1064578029 10:16765853-16765875 TCAGACCTAAACTCAGACCCGGG + Intronic
1065161985 10:22931750-22931772 TCCTTTCTAAACTGAAAGCCAGG + Intronic
1065487813 10:26251848-26251870 TGAGTTTAAGACTGAGAGCCTGG + Intronic
1066419451 10:35250505-35250527 GCAGTTCTAGAATGAGACCCAGG - Intronic
1068067780 10:52153654-52153676 TCAGTTCTACTCTGTGAGACTGG - Intronic
1071431571 10:85611013-85611035 TCATTTCATAACTGAGATCCTGG + Intronic
1072010526 10:91299211-91299233 TCATCTGTAAAATGAGAGCCCGG + Intergenic
1072898794 10:99389513-99389535 TCAGTTCTAAATTCAGGTCCTGG - Intronic
1073050487 10:100663868-100663890 CCAATTCTAAACTGAGACACTGG + Intergenic
1073831157 10:107384965-107384987 TCTGCTCCAAACTGAGGGCCAGG - Intergenic
1080120477 11:28671315-28671337 TCATTTCTAAATCAAGAGCCTGG - Intergenic
1080531022 11:33176711-33176733 ACAGTTCTAAACTGAGACCTGGG - Intergenic
1083094350 11:60234068-60234090 TCAGTTCAAAAGAGAGAGCCAGG - Intronic
1084443999 11:69192971-69192993 TATGTTGTAAACTGAGAGTCAGG - Intergenic
1084446661 11:69207566-69207588 TCAGGACTGAACTGTGAGCCTGG + Intergenic
1085196280 11:74673832-74673854 TCAGTTCTGAACTGGGGGCTGGG - Intergenic
1090810643 11:130238635-130238657 TCAGTTTAAAAATCAGAGCCTGG - Intronic
1090956665 11:131519159-131519181 TGAGTTTCAAATTGAGAGCCAGG + Intronic
1091671188 12:2453376-2453398 TCAGATCTAAACTATGAACCAGG - Intronic
1092892675 12:12983453-12983475 TTAATTCTAAAATGAAAGCCTGG - Intronic
1093654260 12:21677050-21677072 TCAGATCTTAACTCAGTGCCTGG - Intronic
1094439942 12:30463841-30463863 TCGGTTCAAAGCTGAAAGCCTGG - Intergenic
1095364120 12:41381979-41382001 TCAAACCTAAACTGAGAGCATGG - Intronic
1095644083 12:44521869-44521891 ACAGTTATAAACAGTGAGCCTGG - Intronic
1096139166 12:49227943-49227965 CCAGCTCTAAAATGACAGCCTGG + Intronic
1096315270 12:50559117-50559139 TCAGTTCTAAACTCAGAACATGG + Intronic
1101053563 12:100888750-100888772 TCATTTGTAAACTGAAAGGCTGG - Intronic
1101772243 12:107761678-107761700 TCAGTTCTCTACTGCGCGCCAGG + Intergenic
1102019425 12:109671403-109671425 TCACTTCTGGACTTAGAGCCTGG - Intergenic
1105859747 13:24398992-24399014 TCAGTCCTAATGTGAGAACCTGG - Intergenic
1106495827 13:30273543-30273565 TGAGTTCTTAACTGTGAACCAGG - Intronic
1107240662 13:38230731-38230753 TCAGTTCCAATGTGAGAACCGGG - Intergenic
1108167241 13:47706497-47706519 TCAGTTCCAACCAGTGAGCCAGG + Intergenic
1112451308 13:99513099-99513121 TATGTTCTAAACTGACAGCTTGG - Intronic
1113750632 13:112774280-112774302 TCTGTTCTAAACTGGAAGCCAGG + Intronic
1114717163 14:24839059-24839081 TCCCTTCTCAACTGGGAGCCTGG + Intronic
1117370782 14:55076716-55076738 TCAGCTATAAAATGAGGGCCGGG + Intergenic
1117996115 14:61479739-61479761 ATAGTTCTGAACTGATAGCCAGG + Intronic
1120555853 14:85929443-85929465 TCAGCTGTAAAGTGAGTGCCTGG + Intergenic
1122246847 14:100409227-100409249 TCACTTGTAAAATGAGAGGCTGG - Intronic
1126776140 15:52102206-52102228 AAAGTTCTCATCTGAGAGCCAGG - Intergenic
1134199309 16:12184676-12184698 TGAGTTTTGAACTGGGAGCCTGG + Intronic
1135033253 16:19055920-19055942 TCACTTCTAAATTAAGAGACCGG + Intronic
1135482253 16:22830617-22830639 TAAGTTCAATATTGAGAGCCTGG + Intronic
1135510883 16:23081887-23081909 TCAGATACAAACTAAGAGCCAGG + Intronic
1135917747 16:26621324-26621346 CCAGTTCTAACCTGAGCCCCAGG - Intergenic
1137334802 16:47537660-47537682 AGATTTCTAGACTGAGAGCCTGG + Intronic
1139384800 16:66559668-66559690 CCAGTAATAAACTGGGAGCCAGG + Intronic
1140364941 16:74374034-74374056 TCAGTTCTGATCTCAGAGGCGGG - Intergenic
1143938949 17:10518328-10518350 ACAATTCTTAACTGAGAACCAGG + Intronic
1147552477 17:41453917-41453939 GCAGTTCTTAAGTGAGTGCCTGG - Intergenic
1148289738 17:46434345-46434367 AGAGTTCTAAACTGAGACCGAGG - Intergenic
1148311906 17:46651917-46651939 AGAGTTCTAAACTGAGACCGAGG - Intronic
1148397221 17:47318792-47318814 GCAGTTCTACACTCAAAGCCTGG + Intronic
1148458204 17:47822108-47822130 TCAGATGTAAAATGAGAGGCGGG - Intergenic
1148607749 17:48943159-48943181 TGAGTTTAAAATTGAGAGCCGGG - Intronic
1148719658 17:49742178-49742200 TCAGTAATTAATTGAGAGCCTGG - Intronic
1156123137 18:33869492-33869514 TCATTTACAAACTTAGAGCCTGG - Intronic
1157405973 18:47423147-47423169 TCAGTTCTACAAAGAGACCCAGG - Intergenic
1161516665 19:4700221-4700243 TGAGTTCCAGACTGACAGCCAGG - Exonic
1162963841 19:14146105-14146127 CCTGTCCTAAACTGAGACCCTGG - Intergenic
1163130265 19:15268057-15268079 TCAGTTCTAAACTGAGAGCCTGG + Intronic
1165570821 19:36773212-36773234 TGAGTTCCAAACTAACAGCCAGG - Exonic
1168055578 19:53862903-53862925 TCAGATCAAAACTCAGTGCCGGG + Intergenic
925293984 2:2765887-2765909 CCAGTTCTGACCTGAGAACCTGG - Intergenic
925610600 2:5697660-5697682 CCAGTTCTATATTGAGAACCTGG - Exonic
926892080 2:17647552-17647574 TTAGTTCAAAACTCAGCGCCTGG + Intronic
928093322 2:28389948-28389970 TGAGTGCTAAAATCAGAGCCAGG - Intergenic
928543168 2:32302934-32302956 TCAGTTCTAAATTCAAACCCTGG + Intronic
930243636 2:48961332-48961354 TGAGTTCTAGACTGAGGGTCAGG + Intergenic
936580611 2:113697216-113697238 CCAGTCCTAAACTGATGGCCCGG + Intergenic
937123831 2:119460317-119460339 GGAGTTCTAGACAGAGAGCCAGG - Intronic
940391860 2:153141540-153141562 GCAGTTCTCAACTGGGAGCTGGG + Intergenic
943180581 2:184535671-184535693 TAATTTCCAAACTGAGGGCCAGG + Intergenic
943510135 2:188815048-188815070 TCATTTCTAAATTTAGAGACAGG + Intergenic
944344230 2:198641225-198641247 AAAGTTCTGAGCTGAGAGCCAGG - Intergenic
948097969 2:235351335-235351357 TCAGTGCTAACCTGAGAGTTTGG + Intergenic
1168740742 20:189293-189315 ACAGTTTTCACCTGAGAGCCTGG - Intronic
1169002824 20:2180351-2180373 CCAGTTCTAAGCAGAGAGGCCGG - Intergenic
1169716729 20:8627842-8627864 GCAGGTCTACGCTGAGAGCCAGG + Intronic
1170676859 20:18490206-18490228 TCAGTTCTAGACTTACAGCTTGG + Intronic
1174068755 20:47885334-47885356 TCATTTCTGATCTGAGACCCAGG + Intergenic
1174342001 20:49903230-49903252 TGAGTGCTATACTGCGAGCCTGG - Intergenic
1174378416 20:50141178-50141200 GAAGTCCTCAACTGAGAGCCAGG + Intronic
1179144304 21:38753623-38753645 TCAGTTATAAACTGAAGCCCAGG - Intergenic
1182446152 22:30390720-30390742 TCAGTTGTAAAATGGGAGCTTGG + Intronic
1183744488 22:39685146-39685168 TCAGCACTAAACAGTGAGCCCGG - Intronic
1184422737 22:44391380-44391402 TCAGTTGTAAAGCCAGAGCCTGG + Intergenic
951589286 3:24245610-24245632 CCAGCTATAAACTGAGGGCCTGG + Intronic
953781276 3:45872937-45872959 TCTAATCTAAACTGAGGGCCAGG + Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
959010250 3:101067151-101067173 TTATGTCTCAACTGAGAGCCTGG - Intergenic
960167910 3:114424876-114424898 TCTGTCCTAAACTGAGAGGCCGG - Intronic
961496476 3:127295959-127295981 TCAGTTACAAACTGGGATCCTGG + Intergenic
962998620 3:140655688-140655710 TCAGTTCTAATGTGAGAACCTGG - Intergenic
963546308 3:146662836-146662858 TCAGTTCTGATCTGCCAGCCTGG - Intergenic
964481761 3:157145678-157145700 TCAGTTCTAAAATAACAGTCTGG + Intergenic
965894702 3:173561181-173561203 TCATTCCTAAACTGAAAGTCTGG - Intronic
967661888 3:192121921-192121943 TCTGTTCTAAACTAAGGGCCTGG + Intergenic
969472344 4:7396408-7396430 TCGGTCCTCAGCTGAGAGCCTGG - Intronic
970924375 4:21434044-21434066 TTACTTCTGAGCTGAGAGCCTGG - Intronic
973820926 4:54660609-54660631 TCAGTTGGAAACTGTGTGCCAGG + Intronic
973995850 4:56457639-56457661 TTAATTCTAAACTGAAAGCAGGG - Intronic
977221528 4:94343335-94343357 TCAGTTCTAAGAGGAGTGCCAGG + Intergenic
980070612 4:128240028-128240050 TCAGTCCTGAACTGAAATCCTGG + Intergenic
980937595 4:139241243-139241265 GCGGTTCTAAGCTGGGAGCCTGG - Intergenic
982793460 4:159618535-159618557 TAAGTTTTAACCTGAGAGACTGG - Intergenic
984610718 4:181833896-181833918 TAAGTTCTCAACTAAGTGCCAGG - Intergenic
985012417 4:185597359-185597381 TCAGTTTTACACAGAGAGCTGGG + Intronic
986249959 5:6046402-6046424 TCGGTTCTCAAAGGAGAGCCGGG - Intergenic
986400555 5:7375111-7375133 TCAGTGATAAACTGTGGGCCGGG - Intergenic
989125389 5:38047664-38047686 TCAGCTCTAAAATGAGAACAGGG + Intergenic
990990321 5:61677622-61677644 TGAGACCTCAACTGAGAGCCAGG - Intronic
991127162 5:63082328-63082350 TCTGTTTTAACCTGAGAGCGAGG - Intergenic
994640179 5:102398101-102398123 TCAGTTCCAAACTGGAAGTCTGG + Intronic
995893435 5:116983492-116983514 TCAGTTCTAATCTGAGGCACAGG - Intergenic
998503179 5:142651260-142651282 TCAAATCTGAACTCAGAGCCAGG - Intronic
999528919 5:152440085-152440107 TCAGTTTCAAACTGAGAGACAGG - Intergenic
1004332140 6:14731546-14731568 TCATTTGTAAAATGAGAGACTGG - Intergenic
1010229502 6:73521867-73521889 TCTATTCTAAACTGAAAGCCTGG - Intronic
1012956849 6:105580119-105580141 TCAGGTCTTCAATGAGAGCCAGG - Intergenic
1020015077 7:4826300-4826322 TCAGTAATAAAATGAAAGCCCGG + Intronic
1020868153 7:13591527-13591549 TCAGTTCCAATGTGAGAACCTGG + Intergenic
1022238198 7:28482864-28482886 GCTGTTCTAATCTGAAAGCCTGG - Intronic
1024339503 7:48242927-48242949 TCAGTAGAAAACTGAGAGTCTGG - Intronic
1028911546 7:96213397-96213419 TCAGCTATAAAATGAGAGCTGGG - Intronic
1034466684 7:151233904-151233926 TCAGTTTTAACCAGAGAACCTGG - Exonic
1037252418 8:16912102-16912124 TCAGTTGTATACTCAGAGCCTGG + Intergenic
1039229191 8:35424492-35424514 TCATTCCTAGACTGACAGCCTGG - Intronic
1039323219 8:36455924-36455946 TAAGTTCTAATCTGAGAGGGAGG - Intergenic
1039698769 8:39941280-39941302 TCATTTTTAAAAAGAGAGCCGGG - Intronic
1041526655 8:58813937-58813959 TCTGTTCAAAACTCAGAGGCTGG - Intronic
1041600967 8:59716942-59716964 TCAGTTCAAGACTGAAGGCCTGG - Intergenic
1043524693 8:81083485-81083507 CCAGCTCTAAATTGAGAGCTGGG - Intronic
1044277057 8:90313466-90313488 TCAGTTCTAAATTTTGAGGCTGG - Intergenic
1044557756 8:93582706-93582728 CCCGTTCTTAACAGAGAGCCAGG + Intergenic
1044829951 8:96237299-96237321 TCAGTTTTAAGCTCAGAGCTGGG + Intergenic
1045642412 8:104266291-104266313 TCAGTTTTGAACTTAGAGCATGG + Intergenic
1046601046 8:116317238-116317260 TCAGTCCCAAAGTGAGAACCTGG - Intergenic
1047507148 8:125488907-125488929 TCATCTGTAAACTGAGAGTCTGG + Intergenic
1049795022 8:144493268-144493290 CCAGTTCTAAACAGATAACCCGG - Intronic
1056105630 9:83343664-83343686 TCTGTTTCAAACGGAGAGCCAGG + Intronic
1057339703 9:94188963-94188985 TCAGGTCAAAACTCAGAGCCAGG + Intergenic
1059596191 9:115723667-115723689 TCAGTTCTAAGGAGAGAACCTGG - Intergenic
1060787656 9:126463348-126463370 TCAGTTCAAAACTGAATACCTGG - Intronic
1061895670 9:133646054-133646076 TCACTTCAAAACTTGGAGCCGGG - Intronic
1186329964 X:8521415-8521437 TCAGTTCTGCACAGAGAGTCTGG + Intergenic
1187874224 X:23790459-23790481 AAAGTGCTAAACTGAAAGCCTGG - Intergenic
1188331624 X:28878834-28878856 GCAGTGCTCAACTGAGGGCCAGG - Intronic
1189068892 X:37843506-37843528 TCAGTGCTAAACTCAGGACCTGG + Intronic
1189652427 X:43204214-43204236 TCAGTCCCAAAGTGAGAACCTGG + Intergenic
1191099757 X:56712557-56712579 TCAGTCCCAATGTGAGAGCCTGG + Intergenic
1192592127 X:72369048-72369070 TGAGAACCAAACTGAGAGCCTGG - Intronic
1192822187 X:74657030-74657052 TCAGTCCTAATGTGAGAACCTGG + Intergenic
1195211446 X:102654863-102654885 TCAGGTCCAAAATGAGAGCTGGG + Exonic
1195560719 X:106279949-106279971 TCAATTCTAAACTGAGATATTGG - Intergenic
1196098875 X:111828077-111828099 TCATTTCTATAGTGAGAGCTTGG + Intronic
1199440356 X:147860894-147860916 TCAGTTCAACTCTGAAAGCCTGG - Intergenic
1199942742 X:152640876-152640898 CTAGTTCCAAACTGAGAGCACGG + Intronic