ID: 1163130759

View in Genome Browser
Species Human (GRCh38)
Location 19:15271441-15271463
Sequence TTCCAACATCAGAAGCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163130759_1163130764 3 Left 1163130759 19:15271441-15271463 CCCTGTAGCTTCTGATGTTGGAA 0: 1
1: 0
2: 0
3: 23
4: 188
Right 1163130764 19:15271467-15271489 GGGGAAATGCTCTCTTCTGTAGG 0: 1
1: 0
2: 0
3: 13
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163130759 Original CRISPR TTCCAACATCAGAAGCTACA GGG (reversed) Intronic
902582081 1:17414172-17414194 TTCCTTAATCAGAAGCAACAGGG + Intronic
903256574 1:22106196-22106218 CCCCAACAACAGAATCTACAAGG - Intergenic
905853229 1:41289773-41289795 TTTCAAAAACAGAAGCAACAGGG + Intergenic
906516054 1:46439488-46439510 GTCCAACTTCAGAACCCACAGGG - Intergenic
912457269 1:109806468-109806490 TTCCCACATTAGAAGGGACAGGG - Intergenic
912557058 1:110524101-110524123 TGCCAACATGAAGAGCTACAGGG - Intergenic
916037748 1:160936013-160936035 GTCCACCACCAGAAGCTCCAGGG - Intergenic
916654185 1:166858994-166859016 TCCCAACATCACCCGCTACAAGG + Intronic
918880285 1:190110811-190110833 TTCCAAAATCAAAGGCTACTTGG - Intronic
921269143 1:213451700-213451722 TTCCAACATCACAAGCTAATGGG - Intergenic
921362325 1:214341445-214341467 TTCTGACATCAGAAGGTAAATGG - Intergenic
921747463 1:218753997-218754019 ACCCAACATCAGAGGATACATGG - Intergenic
923200173 1:231703810-231703832 TTACTACATCAGAAGTTTCAGGG + Intronic
924131986 1:240919793-240919815 TTCAAACATCAAGAGCTCCATGG + Intronic
1063304539 10:4885268-4885290 TTTGAACATCAGATGCTTCAAGG - Intergenic
1064855527 10:19763298-19763320 TTCCAGCATCAAAAGGTAGAAGG + Intronic
1068344420 10:55754966-55754988 TTACATCTTAAGAAGCTACATGG + Intergenic
1072558465 10:96545245-96545267 TTCCACAATCATAAGCAACAGGG + Intronic
1073169590 10:101493026-101493048 CTCCAACTTCAGAAGTTTCAAGG - Intronic
1076192209 10:128490793-128490815 TGCCACCATCAGAAGCTGGAAGG - Intergenic
1085296543 11:75434756-75434778 TTCCCACATCAGTGGCCACAGGG - Exonic
1086099251 11:83082045-83082067 TTCCAACATCAGAATCTCCTGGG + Intergenic
1086120099 11:83296808-83296830 TCCCACCACTAGAAGCTACATGG - Intergenic
1091109709 11:132954486-132954508 TGCCAAAATCAGAAGCCACATGG - Intronic
1092973285 12:13719528-13719550 TACCACCATGAGAAGCTACATGG + Intronic
1099843695 12:88001000-88001022 TTGCAACATCATCAGCTAAAAGG - Intronic
1102560051 12:113755461-113755483 TTCCAAGAGCCGAAGCTACAAGG - Intergenic
1106912171 13:34474737-34474759 TTTCAATCTCAGCAGCTACAAGG - Intergenic
1107618629 13:42200437-42200459 TTCCAACAACAGAAACAACAAGG + Intronic
1108127168 13:47257036-47257058 TTCCAAAATGAGAAGACACATGG + Intergenic
1108801818 13:54105927-54105949 TTCCAAAAGCAGAAGCAATAGGG - Intergenic
1109398806 13:61797297-61797319 TTGAAACAGCAGAAGCTAAAAGG - Intergenic
1109906456 13:68847672-68847694 GTCCAACATAAAAAGCTGCAAGG + Intergenic
1110593323 13:77290130-77290152 TTTCAACATCATTAGCTACTAGG + Intronic
1115204273 14:30885310-30885332 TTGCAGCATCAAATGCTACAGGG + Intronic
1116299686 14:43162290-43162312 TTACATCAACAGAAGATACAAGG - Intergenic
1116544088 14:46141086-46141108 TTCAAACATCAGAAGCACCTAGG - Intergenic
1120755537 14:88240751-88240773 TTCCAACAACAGCAGCCACTGGG - Exonic
1122445842 14:101767925-101767947 GTCCTACATCACAAGCTGCAAGG + Intronic
1123222597 14:106871028-106871050 TTCCTAAATGAGGAGCTACAGGG - Intergenic
1202911595 14_GL000194v1_random:122269-122291 TTTCAACTTCAGAAGATGCATGG + Intergenic
1125168905 15:36743519-36743541 TTCAAGCATCAGAAGTTGCAGGG - Intronic
1126377964 15:48015129-48015151 TTCCAACTCCAGTAGCTATAAGG + Intergenic
1127951005 15:63806363-63806385 TTACAACATGAAAAGCTTCATGG - Intronic
1130011257 15:80154428-80154450 TTTCAACATCAGAATGTGCAGGG + Intronic
1131748851 15:95483063-95483085 TTCCATCATCACATGCCACAAGG + Intergenic
1132819266 16:1854878-1854900 TTCCCACATGAGAAGCCACTGGG - Intronic
1138296311 16:55888309-55888331 TTCCAACATCAGAAGGAGCCTGG - Intronic
1139030651 16:62876697-62876719 TTCCAACATCAGGCTCTTCAAGG + Intergenic
1139422497 16:66857163-66857185 TTGCAACAGCAGCAGCTATAGGG - Intronic
1140871650 16:79112136-79112158 TACCAACATGAGAAGCTAGGGGG + Intronic
1140909432 16:79438149-79438171 TTCCCACATGCCAAGCTACAAGG + Intergenic
1141330951 16:83110305-83110327 TTTCAAAATGAAAAGCTACAGGG + Intronic
1142348243 16:89567978-89568000 TTCCAACATCAGAACCCACTTGG + Intergenic
1144442899 17:15300071-15300093 TTCCAAAAGCAGAAGCTTCCAGG + Intergenic
1145186170 17:20796132-20796154 TACCAAATTCAGAAGCTATAAGG - Intergenic
1145407292 17:22615000-22615022 TTACATCTTAAGAAGCTACACGG + Intergenic
1145766365 17:27460745-27460767 TTCCATCATCAGATGCTCCTGGG - Intronic
1148343900 17:46890719-46890741 TTCCAACAGCCCAAGCTCCAAGG + Intergenic
1148410953 17:47466712-47466734 TACCAAATTCAGAAGCTATAAGG + Intergenic
1150337572 17:64341839-64341861 TTCTAACATCAGAAATGACAAGG - Intronic
1150461347 17:65356381-65356403 TTCCAAGATCAGAGGCCACCTGG - Intergenic
1150617704 17:66784900-66784922 TTCCACCAGCAGGAGCAACATGG - Intronic
1151399244 17:73844800-73844822 TTCCAAGATGAGAAGATCCAAGG - Intergenic
1153788284 18:8554475-8554497 GACCAACATTTGAAGCTACAGGG + Intergenic
1155002374 18:21699657-21699679 TTACAAAAGCAGAAGCTGCAGGG - Intronic
1156601734 18:38615222-38615244 TTCCAGGATCAGAGGCTACATGG + Intergenic
1157699211 18:49749812-49749834 GTCCAACATCACTAGCTACTGGG - Intergenic
1159021022 18:63143309-63143331 TTCCATCAGCACAACCTACAGGG + Intronic
1159438624 18:68449242-68449264 TTCAAGCAACAGAAGCCACATGG - Intergenic
1159959546 18:74545025-74545047 TGCCAACACCAGAAGCTGGAGGG + Intronic
1160153028 18:76409701-76409723 TTCCACCATCTCCAGCTACAGGG - Intronic
1163130759 19:15271441-15271463 TTCCAACATCAGAAGCTACAGGG - Intronic
1164727739 19:30477978-30478000 CTCAATCATCAGAAGCTGCAAGG - Intronic
1165229682 19:34379087-34379109 TTCCAACTTCAGGAGAAACACGG - Intronic
925521446 2:4750287-4750309 TTGCAACAAGAGAAGCTTCAAGG + Intergenic
926882038 2:17556468-17556490 CCCCTACATCAGAAGCTGCATGG + Intronic
928820879 2:35359340-35359362 GTCCAACATCATTAGCTACTAGG + Intergenic
929531082 2:42753270-42753292 TCCCAACATCACAACCTTCAGGG - Intronic
929726190 2:44430172-44430194 TTGAAACATCAGAGACTACAAGG - Intronic
932985378 2:76720357-76720379 GTCCACCATCAGATGCTGCAAGG + Intergenic
933160257 2:79015952-79015974 TTGCACCATGATAAGCTACATGG - Intergenic
933160897 2:79023543-79023565 TTCCAAGTTCAGAAGTTAAAAGG - Intergenic
933201065 2:79449368-79449390 TGCCAACATCAGAAGCAAAAAGG + Intronic
933514333 2:83281380-83281402 CTCTCACATCAGAAGCTTCACGG + Intergenic
933526653 2:83449227-83449249 TTTCAACTTCAGAAGTTTCATGG + Intergenic
933935996 2:87204210-87204232 ACCCAACATCAGAAGATTCATGG - Intergenic
936357151 2:111761619-111761641 ACCCAACATCAGAAGATTCATGG + Intergenic
936386099 2:112030678-112030700 TTCAAGAATCAGAATCTACATGG + Intergenic
937717905 2:125055884-125055906 TTCTAACATCAGAAGATATAAGG - Intergenic
937748542 2:125445590-125445612 TTTAAACAGCAGAAACTACAAGG + Intergenic
937868316 2:126770266-126770288 GGCCATCATCAGAAGCTACAGGG - Intergenic
938574085 2:132587880-132587902 TTCCATCACCAGAAAGTACATGG - Intronic
938953160 2:136275874-136275896 CTCCAGCATCAGGAGCTTCAGGG + Intergenic
939331662 2:140770936-140770958 TACCAACATCTGAAACTACAAGG - Exonic
940674128 2:156708120-156708142 TTCCTCCATCAAAACCTACATGG - Intergenic
941375655 2:164725999-164726021 TTACAGTATCAGAATCTACAAGG - Intronic
941508096 2:166372957-166372979 TTCCAACATCAAGACCAACACGG + Intronic
942403911 2:175632626-175632648 TTTTAACATCTGGAGCTACATGG + Intergenic
943040792 2:182802582-182802604 CTCAAACATCAGCAGCTCCAAGG - Intergenic
944436281 2:199693952-199693974 TTCCCACTTCAGAAGCTAAGAGG - Intergenic
945798934 2:214400327-214400349 TTGCAAAATCTGCAGCTACATGG - Intronic
946010251 2:216558715-216558737 CTCCACCACCAGCAGCTACAAGG + Intronic
946563866 2:220941810-220941832 TTACATAATCAGAAGATACAGGG - Intergenic
947023534 2:225711079-225711101 TTCCAACTTCAGATGATATAAGG - Intergenic
947308939 2:228779059-228779081 TTCCACCACCTGAAGATACAAGG + Intergenic
948429651 2:237911516-237911538 TTCCATCCGCAGGAGCTACAGGG + Exonic
1168752775 20:294993-295015 TTATTACATCAGGAGCTACAGGG - Intergenic
1169717566 20:8637697-8637719 TTCCAACACCATAACCCACATGG - Intronic
1170778605 20:19403213-19403235 GTCCAACATCTGAAGGTACATGG + Intronic
1170996178 20:21361647-21361669 TTCCATCATCAGAAGCAAAAGGG - Intronic
1171343793 20:24450768-24450790 TTGCTTCAGCAGAAGCTACATGG - Intergenic
1172755689 20:37282642-37282664 TTCCAACATCATATGCTGCCTGG + Intergenic
1178449091 21:32676585-32676607 TTTCACCATCAGAAGCTCCTAGG + Intronic
1178987326 21:37317946-37317968 TTCCCACAACAAAAGCTCCATGG + Intergenic
1179481099 21:41679178-41679200 TCCCACCAGCAGAAGCTGCAAGG - Intergenic
1180248481 21:46563994-46564016 TTCCAAAATCTGAAGCAAAAAGG - Intronic
1180375632 22:12090668-12090690 TTTCAACTTCAGAAGATGCATGG - Intergenic
949460548 3:4288547-4288569 CTCAAAAATTAGAAGCTACAAGG + Intronic
953168594 3:40487336-40487358 CTTCAGCATCAGAAGCTCCATGG + Exonic
954317366 3:49808389-49808411 CTCAAACATCAGAGGCTTCAGGG + Exonic
954877805 3:53814468-53814490 TTCCAACATCAAGAGTGACAGGG + Exonic
956833367 3:73075118-73075140 TTGCAACAGCAGCAGCCACAGGG + Intergenic
956899478 3:73700107-73700129 TTCCCACATTAGAAAATACAGGG + Intergenic
959431122 3:106256454-106256476 TTCAAACCCCAGAAGCGACAAGG - Intergenic
964144472 3:153442209-153442231 TACCAACACCAGATGCTAGAAGG - Intergenic
966562372 3:181337334-181337356 TTACAACAGATGAAGCTACATGG - Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967332369 3:188303781-188303803 TTACAAAATCAGAATCTCCAGGG - Intronic
970038601 4:11770352-11770374 TTCCAACAGTGGCAGCTACAGGG - Intergenic
972874439 4:43341071-43341093 ATCCAGCATCAGAAGTCACATGG + Intergenic
973854677 4:54999243-54999265 GTCCAACATCAGAAAAAACAAGG - Intergenic
975504121 4:75119041-75119063 TTCCAACAGGAAATGCTACAGGG + Intergenic
976354961 4:84106395-84106417 TACCAACATGGGAAGCTAGATGG - Intergenic
976993083 4:91394098-91394120 TCCTAACCTCAGAAGCTAGATGG + Intronic
977311731 4:95396139-95396161 TAGCAACTTCAGAAGCTACAGGG + Intronic
980884399 4:138746436-138746458 AACCACTATCAGAAGCTACAAGG + Intergenic
981225925 4:142294325-142294347 TTCCATCATCAGAAGCTTAGGGG - Intronic
982044569 4:151430516-151430538 TTCCAAAATCAGAAAGTAAAAGG - Intronic
983278656 4:165652139-165652161 GTCCAGCACCAGAAGGTACATGG + Intergenic
984013984 4:174404672-174404694 TTCCAACTTCACTAGCTATATGG - Intergenic
984494875 4:180484137-180484159 TTCCAATATCAGGAGCTACTTGG + Intergenic
984553557 4:181187854-181187876 TTTGAATATCTGAAGCTACAAGG + Intergenic
984564798 4:181316390-181316412 GTCCACCAATAGAAGCTACATGG + Intergenic
984843277 4:184088221-184088243 GTCTAATATCAGAATCTACAAGG + Intergenic
984983982 4:185309550-185309572 TTCCAACATGAGAAGCCAGAGGG - Intronic
1202757230 4_GL000008v2_random:76110-76132 TTTCAACTTCAGAAGATGCATGG - Intergenic
994246296 5:97481602-97481624 TTCCAACATCAGAAGCATGGAGG - Intergenic
994378676 5:99044020-99044042 TTTCAACATCACCAGCTTCAAGG - Intergenic
995252093 5:110005542-110005564 GGCTAACATCAGAATCTACAAGG - Intergenic
1000449593 5:161369099-161369121 TTCAAAGATAAGAAGCTCCAGGG - Intronic
1002763355 6:218542-218564 TTCCAAGACGAGAAGCTTCACGG - Intergenic
1004180911 6:13379710-13379732 TGCCAACAACAGAAACTACCTGG - Intronic
1004767815 6:18750880-18750902 TGCCAACATCATAAGCAACTTGG + Intergenic
1004836221 6:19534966-19534988 TTCCAAAATCAGCAGCTAGGAGG - Intergenic
1007684586 6:43657864-43657886 TTCCAAGATCAGAAGAGACTAGG - Intronic
1009024220 6:57978889-57978911 TTCCTGCATCAGAAACTACAAGG - Intergenic
1011464023 6:87636632-87636654 TAAAAACATCATAAGCTACATGG - Intronic
1014113265 6:117645032-117645054 CTCCAGCATCAGAATCAACATGG + Intergenic
1015339361 6:132080159-132080181 TTCCAAGATCAGACGATACTGGG + Intergenic
1015385794 6:132621652-132621674 TTCTAAAATCATAGGCTACAGGG + Intronic
1016571490 6:145518428-145518450 TTTCAACATCAGCAGCAAGATGG + Intronic
1017180866 6:151550690-151550712 ATCCAAGATCAGAACCAACATGG + Intronic
1017585899 6:155922361-155922383 TTCATGCATCAGAAGTTACATGG - Intergenic
1018070400 6:160159785-160159807 TTCAAACACCAGAAGCACCATGG + Intergenic
1018752886 6:166822491-166822513 TTCCAGCCTCCGGAGCTACAAGG + Intronic
1019778946 7:2928617-2928639 CTCCATCGTCAGACGCTACAAGG - Exonic
1019832679 7:3348940-3348962 TGACAACATGACAAGCTACATGG - Intronic
1020376389 7:7492200-7492222 TTCCAAAATCACAAGCTTCTGGG - Intronic
1020794899 7:12667386-12667408 TTCCACCATCTGAAGTTACAGGG + Intergenic
1022843869 7:34190830-34190852 TTCCAACAGCAGACCCTACTAGG - Intergenic
1024018795 7:45346505-45346527 TTCCAAGAACAGATGGTACATGG - Intergenic
1024795406 7:53013477-53013499 TTCCAGCATCACAAGCTATGAGG + Intergenic
1027132195 7:75599041-75599063 TGCCGTCATCAGAAGCTGCAGGG + Intronic
1027337261 7:77164810-77164832 TTCCATCATAAGAAGCCAGAAGG - Intronic
1027901168 7:84116979-84117001 TTTCACCATCAGAACATACATGG + Intronic
1027926416 7:84470224-84470246 TTCCATTATCAGAAGTTTCAAGG + Intronic
1029778538 7:102706310-102706332 TTCCATCATAAGAAGCCAGAAGG + Intergenic
1031901664 7:127417961-127417983 TTCCACTATCAGCAGCAACAAGG + Intronic
1033023918 7:137754399-137754421 TTCAAACATCAGCAGGCACAGGG + Intronic
1033518330 7:142131792-142131814 TTCACAAATCAGAAGCCACAAGG + Intronic
1034988936 7:155535312-155535334 GACCAACAGCAGAAGCTTCAGGG + Intergenic
1035282913 7:157788605-157788627 TCCCACCATGAGAAGCCACATGG + Intronic
1036149148 8:6281954-6281976 TTCCAAAATCAAACCCTACAAGG + Intergenic
1037544454 8:19905097-19905119 TTGCAACATCAGAAGTCACTAGG + Intronic
1040066806 8:43151957-43151979 TACCAACCTCCAAAGCTACAGGG - Intronic
1041143460 8:54846581-54846603 TTCCACCATCAGTAGCAACAAGG - Intergenic
1041569292 8:59319095-59319117 TTCCAATATCATAAAATACAAGG + Intergenic
1042880381 8:73481454-73481476 TTCTAGAATCAGAAGCTAGAAGG - Intronic
1045624681 8:104029804-104029826 TCCCAAAATCAAATGCTACATGG - Intronic
1045837599 8:106541027-106541049 TTCCAACATCACATAGTACATGG - Intronic
1048808953 8:138267716-138267738 TTCCTTGCTCAGAAGCTACAAGG - Intronic
1050449158 9:5761427-5761449 TACCAGCATCAGAAGCTTAAAGG - Intronic
1051177969 9:14380235-14380257 TTCCACCATGAGAAGCTCCATGG + Intronic
1053062693 9:35044236-35044258 TCGCTACATCAGAAGCTACATGG + Exonic
1056446322 9:86669635-86669657 TTCCAACTTCACAAGCAGCAGGG + Intergenic
1056452217 9:86727317-86727339 TGGCAAGAACAGAAGCTACAAGG + Intergenic
1058048865 9:100386613-100386635 TTCAAGCAACTGAAGCTACAGGG + Intergenic
1058253196 9:102728609-102728631 TTTCAACAACAGAATCTAAAAGG - Intergenic
1060182028 9:121541064-121541086 TTCCAGCATCACTAGCTCCAGGG + Intergenic
1060413905 9:123417621-123417643 TTCTAACTTCAGAAGGGACAAGG - Intronic
1060647417 9:125292787-125292809 TTCCAGTATCAGAAGCCAAATGG - Intronic
1061932651 9:133841239-133841261 TCACAACAGCAGCAGCTACAGGG + Intronic
1203753789 Un_GL000218v1:104641-104663 TTTCAACTTCAGAAGATGCATGG + Intergenic
1203538020 Un_KI270743v1:60970-60992 TTTCAACTTCAGAAGATGCATGG - Intergenic
1186091123 X:6049995-6050017 TTCCAACATCAGGATTTACCTGG - Intronic
1186231049 X:7454361-7454383 TTCCAACATCAGATCCAACCAGG + Intergenic
1195313264 X:103654420-103654442 TTCCTAGATCAGAACATACAGGG - Intergenic
1195936396 X:110129847-110129869 TAGCTACATGAGAAGCTACATGG - Intronic
1198191685 X:134313446-134313468 TTCCAACAGCAGATGTTAAATGG + Intergenic
1201167432 Y:11222199-11222221 TTTCAACTTCAGAAGATGCATGG + Intergenic
1201505766 Y:14698049-14698071 CTCCAACATCAGAATTTACATGG + Intronic