ID: 1163132045

View in Genome Browser
Species Human (GRCh38)
Location 19:15280368-15280390
Sequence CCTTCTCTGCAGAAGCAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 317}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163132038_1163132045 7 Left 1163132038 19:15280338-15280360 CCACACTTTGCTGTACCCATCAG 0: 1
1: 0
2: 0
3: 20
4: 171
Right 1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG 0: 1
1: 0
2: 4
3: 39
4: 317
1163132037_1163132045 16 Left 1163132037 19:15280329-15280351 CCAGCAGCACCACACTTTGCTGT 0: 1
1: 0
2: 0
3: 27
4: 219
Right 1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG 0: 1
1: 0
2: 4
3: 39
4: 317
1163132040_1163132045 -8 Left 1163132040 19:15280353-15280375 CCCATCAGTGGCCTGCCTTCTCT 0: 1
1: 1
2: 1
3: 25
4: 289
Right 1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG 0: 1
1: 0
2: 4
3: 39
4: 317
1163132041_1163132045 -9 Left 1163132041 19:15280354-15280376 CCATCAGTGGCCTGCCTTCTCTG 0: 1
1: 0
2: 4
3: 35
4: 339
Right 1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG 0: 1
1: 0
2: 4
3: 39
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163132045 Original CRISPR CCTTCTCTGCAGAAGCAGCT GGG Exonic
900203206 1:1420412-1420434 CCCGCGCTGCAGCAGCAGCTCGG + Exonic
900393163 1:2442643-2442665 CCTTGGGTGCAGAAGCAGCATGG + Intronic
900565463 1:3329758-3329780 CCCTCTCTCCAGAAGCCGCACGG - Intronic
900961790 1:5927075-5927097 CTGCCTCAGCAGAAGCAGCTAGG + Intronic
901173398 1:7280439-7280461 AGGTTTCTGCAGAAGCAGCTTGG + Intronic
902718699 1:18290232-18290254 CCTGTGCTGCAGAAGCAGCCAGG + Intronic
903749431 1:25611641-25611663 CCTTCACTGAGGAGGCAGCTGGG - Intergenic
904787566 1:32994140-32994162 CCTTTGCTGCAGAAGCCACTGGG - Intergenic
904903143 1:33873530-33873552 CTTGCTCTGATGAAGCAGCTGGG + Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906676002 1:47694183-47694205 CTCTCGCTGCAGGAGCAGCTTGG + Intergenic
911102101 1:94103317-94103339 CATTGACTGCTGAAGCAGCTGGG + Intronic
912543880 1:110437145-110437167 CCACCTCAGCAGGAGCAGCTGGG + Intergenic
912631873 1:111253344-111253366 GCTTCTCAGCAGAGGCACCTTGG - Intergenic
913155475 1:116092759-116092781 TCTGCGCAGCAGAAGCAGCTAGG - Intergenic
914359638 1:146922075-146922097 ACTTCTCTCCTGAAGAAGCTGGG + Intergenic
914494114 1:148177819-148177841 ACTTCTCTCCTGAAGAAGCTGGG - Intergenic
915389994 1:155534083-155534105 CCTTCTGGGCTCAAGCAGCTGGG - Intronic
916499301 1:165373329-165373351 CCTGCTCTGCAGGAACAGCTTGG - Intergenic
917008342 1:170441687-170441709 CCTTCTCTGCAGAATTGCCTTGG - Intergenic
918606580 1:186434499-186434521 CTTTCTCTGAAGGAGCAGCAAGG - Intergenic
919205831 1:194420804-194420826 CCAGGTCTGCAGATGCAGCTGGG + Intergenic
920298706 1:204975534-204975556 CCCCCTCTGCAGAAGCTCCTTGG - Intronic
920693069 1:208161427-208161449 GCCTCTCTGGAGAATCAGCTAGG + Intronic
921271458 1:213474046-213474068 CCAGCTTTGGAGAAGCAGCTGGG - Intergenic
921916460 1:220616997-220617019 TCTTCTCTTCTGAGGCAGCTTGG + Intronic
922731371 1:227950234-227950256 CCTTCTCTGGCGAAACAGCAGGG - Intergenic
923439903 1:234007402-234007424 CCTTCTCCGCAGGAGGAACTTGG - Intronic
923652130 1:235883844-235883866 CCCTCTCTGCAGAAGAATCAGGG - Intergenic
924300977 1:242637366-242637388 CCTTCTCTGCAAACTCTGCTTGG + Intergenic
924601910 1:245498392-245498414 TCTTCACTGGAGAGGCAGCTGGG + Intronic
924881465 1:248165593-248165615 CCAGCTCCGCAGAAGTAGCTGGG + Intergenic
1062990202 10:1807543-1807565 TGTTATCTGCAGAGGCAGCTGGG - Intergenic
1063662973 10:8046527-8046549 CCTTCTCGGCAGCAGCCGCTAGG - Intergenic
1063964718 10:11338095-11338117 CCTTCTCTCATGAAGCTGCTGGG + Intergenic
1064963877 10:20995779-20995801 CCACCTCTGCAGATGCTGCTCGG + Intronic
1065234156 10:23630589-23630611 CCTTCTCCCCAGTAGCTGCTAGG - Intergenic
1066335049 10:34467885-34467907 CCTTCTCTGCAGAAGAGCCTGGG - Intronic
1066372131 10:34826167-34826189 CCTTATCTGCAGAAGAGCCTGGG - Intergenic
1067054726 10:43043982-43044004 CCTTCTCTGCAAAAGCCCCAAGG + Intergenic
1067525660 10:47036848-47036870 CCGTGTCTGTAGCAGCAGCTAGG + Intergenic
1068870518 10:61938813-61938835 CTTTCTTCTCAGAAGCAGCTTGG + Intronic
1069121770 10:64576837-64576859 ACCCCTCTGCAGAAACAGCTTGG + Intergenic
1070057044 10:72945446-72945468 CCATCTCTGGAGATTCAGCTGGG - Intronic
1070330723 10:75415257-75415279 CCTTTTCTTCTGAAGCAGCAGGG - Intergenic
1072136754 10:92554381-92554403 CCGTCTCTACAAAAACAGCTGGG + Intronic
1072431981 10:95380468-95380490 CTTTCTTTGCAGGAGCACCTGGG + Intronic
1072546785 10:96446209-96446231 CCTTCTCTGCATCAGCACCAAGG + Intronic
1074050580 10:109877737-109877759 GCTCCTGTGCAGAAGCAGCAAGG + Intronic
1074077609 10:110143095-110143117 CATTCTCTCCGGAAGCAGGTTGG - Intergenic
1075334186 10:121597298-121597320 CCTGCTCTGCCGCAGCGGCTGGG - Intronic
1075683350 10:124347824-124347846 GCGTCTGTGCAGAAGCAGCACGG - Intergenic
1076063197 10:127429178-127429200 CCTTCTCTGTAGCACCAGCTGGG + Intronic
1076299543 10:129414658-129414680 GCTTCTCTGCAGAACACGCTGGG + Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1076452887 10:130568995-130569017 CCATCTCTGGAGGAGCAGGTTGG + Intergenic
1076826145 10:132970703-132970725 TCTTTGCTGCAGAAGCACCTGGG + Intergenic
1077298770 11:1837876-1837898 CCTTCCCTGCATGAGCAGCAGGG + Intergenic
1079842191 11:25417385-25417407 CCTTCTTGGCAGAAGAAGCATGG + Intergenic
1080690218 11:34549996-34550018 TCACCTCTGCAGGAGCAGCTGGG + Intergenic
1083560757 11:63671346-63671368 CCTTCAAAGCAGAAGCAGCAGGG + Exonic
1084095935 11:66911397-66911419 CCTTCTTTACAGGAGCAGCCTGG + Intronic
1084332343 11:68437608-68437630 CCTTCGCTGCAGAGGGACCTGGG + Intronic
1085314316 11:75535167-75535189 CCTTATCTCCAGGAGCAGCAGGG + Intergenic
1085507428 11:77068249-77068271 CCTGGCCTGCAGCAGCAGCTGGG - Intronic
1085682894 11:78594840-78594862 CGTTATCTGCAGGAGCAACTGGG - Intergenic
1085724715 11:78944220-78944242 CAACCTCTGCAGAAGCAGTTTGG + Intronic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1088180505 11:107103939-107103961 CCACCACTGCAGATGCAGCTGGG + Intergenic
1089810354 11:121126336-121126358 CCTCATCTGCAGCAGCAGCAGGG - Intronic
1089882603 11:121789239-121789261 CCTTCTCTCAAGTGGCAGCTGGG - Intergenic
1091001098 11:131911210-131911232 CCTTCCCGGCGGAAGCAGCGAGG + Intronic
1091316749 11:134619260-134619282 CCTTTCCTGCAGAAGCAGCGTGG + Intergenic
1091622399 12:2099288-2099310 GGTTCTCTGCAGAAGGATCTAGG - Intronic
1091705636 12:2691376-2691398 CCGCCTCTGCAGACGCAGCCGGG - Intronic
1092008731 12:5090743-5090765 CCTTCTCAGCAGACAGAGCTAGG + Intergenic
1092650469 12:10629664-10629686 CGTCCTCTACAGAACCAGCTGGG - Exonic
1092900915 12:13058620-13058642 CCTTCTCTGCAGTACCACTTGGG - Intronic
1094047951 12:26187626-26187648 ACTTCTCTGCACCAGCAGGTGGG + Intronic
1095430305 12:42126720-42126742 CCCTCTCTACAAAAACAGCTGGG + Intronic
1097279781 12:57837782-57837804 CCCTCTCTGCACCAGCAACTGGG + Intronic
1098520636 12:71431763-71431785 CCATCACTGCAGACACAGCTGGG + Intronic
1099115918 12:78623913-78623935 CCTGCTCTGCAGGAGCAGTCAGG - Intergenic
1102326954 12:111994026-111994048 GAATCTCTGAAGAAGCAGCTTGG + Intronic
1104067094 12:125315089-125315111 CCTTCTGTGCATAAGCTGCCTGG - Intronic
1107258450 13:38460489-38460511 CCAACTCTTCAGAAGCTGCTCGG + Intergenic
1111478578 13:88788984-88789006 TCTTTTCTCCAGCAGCAGCTAGG - Intergenic
1113511142 13:110855620-110855642 CCTTCTCTGCAGAGCCAGCAAGG - Intergenic
1113913622 13:113856829-113856851 CCGTCCCTGCAGAAGCAGAGAGG - Intronic
1114618816 14:24082601-24082623 GCTACCCTGCAGCAGCAGCTGGG - Exonic
1117385943 14:55212891-55212913 CCTTCTGTGCACAATGAGCTTGG + Intergenic
1117501652 14:56358367-56358389 CCTTCTCTCTGGAGGCAGCTGGG - Intergenic
1119686597 14:76637541-76637563 CCTACTTTTCAGAAGCAGATGGG - Intergenic
1121005927 14:90490701-90490723 CCTTCACTGGAGAGGCAGCAAGG + Intergenic
1121236029 14:92391815-92391837 CCTGCTCTGCAGCCCCAGCTGGG + Intronic
1121270179 14:92632634-92632656 TCTCCTGGGCAGAAGCAGCTGGG - Intronic
1121348649 14:93155142-93155164 GCTGAGCTGCAGAAGCAGCTTGG - Intergenic
1121964932 14:98295321-98295343 CTTTCCCAGCAGCAGCAGCTGGG - Intergenic
1122375811 14:101256391-101256413 TCATCTCTGCAAAAGGAGCTGGG + Intergenic
1122405194 14:101496626-101496648 CCGGCTCTGCAGAAGCATCTCGG - Intergenic
1122549679 14:102543310-102543332 ACTCCTCTGCAGGAGCAGCCTGG + Intergenic
1123039276 14:105483777-105483799 CTTCCTCTGCAGACTCAGCTTGG - Intergenic
1123206143 14:106715137-106715159 CCTCCTCTGAAGAAGCCCCTGGG - Intergenic
1124254111 15:28127223-28127245 GTGTCTCTGCAGACGCAGCTGGG + Intronic
1125002378 15:34784967-34784989 CCTTCTTTCCTGAAGAAGCTAGG + Intergenic
1126567981 15:50119704-50119726 TCATCTCTGCAAAAGCAGGTGGG - Intronic
1126769423 15:52040262-52040284 CCTTCTGTCCAAAAGCAACTGGG + Intronic
1126793742 15:52243518-52243540 CCTTCTCTGCATGACCAGCGTGG - Intronic
1126950174 15:53872179-53872201 CCTGCTCTGAAAATGCAGCTGGG - Intergenic
1127937106 15:63651918-63651940 CCTTCTCTTCCCAAGAAGCTGGG - Intronic
1127966964 15:63929726-63929748 CCTGCTCTTCAGCAGCAGCCCGG + Intronic
1128172967 15:65529355-65529377 TCTTCTCTGCAGAAGAACTTGGG + Intergenic
1128340448 15:66819024-66819046 CCTTCTCTGCAGAGTCTGCGTGG + Intergenic
1128511506 15:68316448-68316470 CCTTCTCTGCAGGAGTGGCTGGG + Intronic
1128680678 15:69649180-69649202 CCTTCTCTGCCAGAGCAGCTTGG - Intergenic
1128732252 15:70029252-70029274 CCTTCTCTTCTGAAGCTTCTGGG + Intergenic
1128762974 15:70230453-70230475 CCTTCTCTCCAGAACCCACTGGG + Intergenic
1129219131 15:74121289-74121311 CCTTATCTCCAGACTCAGCTGGG - Intronic
1129748801 15:78045030-78045052 CTTTTTCTGCAGAAGCATTTGGG + Exonic
1131763866 15:95654163-95654185 AGTTCACTGCAGAAGCAGCTAGG + Intergenic
1132761324 16:1509881-1509903 GAGTCTCTGCAGAAGCAGCAGGG - Exonic
1133065279 16:3201983-3202005 CCTCCTCTGCAGGAGCAGTCAGG + Intergenic
1134799263 16:17069564-17069586 CCCTCTCTGCAAAAGCTTCTAGG + Intergenic
1135195968 16:20394880-20394902 GCTTCTCTGCAGACCCACCTGGG + Intronic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1138078596 16:54066850-54066872 CCATCTCTGCAGCCCCAGCTTGG + Intronic
1139170473 16:64625384-64625406 CCATCACTGCAGATACAGCTGGG - Intergenic
1139217753 16:65145708-65145730 ACTTCTGAGCAGAAGCAGCCTGG - Intergenic
1139690116 16:68635778-68635800 TCTTGTCTGCAGATCCAGCTTGG - Intergenic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1141618386 16:85222821-85222843 CCTCCTCTGCAGCAGAAGTTTGG + Intergenic
1141799595 16:86297875-86297897 CTCTGTCTGCAGAAGCAGATTGG + Intergenic
1141853026 16:86660454-86660476 CCTGCCCTGCAGACTCAGCTAGG + Intergenic
1141915056 16:87090122-87090144 CCATCTGTCCAGAAGCAGCATGG - Intronic
1141949526 16:87331653-87331675 CTGTCTCTGCAGGGGCAGCTGGG + Intronic
1142249157 16:88983249-88983271 CCTGCTCTTCGGAAGCAGCTGGG - Intergenic
1142784873 17:2213343-2213365 CCTTCTCTGAAGCTGCTGCTTGG - Intronic
1144961206 17:19045145-19045167 CCATCTCTGCACGAGCAGCCTGG - Intronic
1144973955 17:19129379-19129401 CCATCTCTGCACGAGCAGCCTGG + Intronic
1145220882 17:21087495-21087517 CCATCTCAGCAGAAACAGCTTGG - Intergenic
1146255199 17:31388338-31388360 ACTTCTCTGCAGGAGCACATGGG + Intergenic
1147369130 17:39979817-39979839 CCTTCCCTGCAGAACCAGTGGGG + Intergenic
1147612438 17:41809931-41809953 CATTTTCTGGACAAGCAGCTTGG - Intronic
1149952866 17:61009834-61009856 CCCTCTGTGCAGAAGCTGCCAGG - Intronic
1150065608 17:62106403-62106425 CAGTCTCTGCAGAAGAAGCTAGG + Intergenic
1151116805 17:71745170-71745192 CCTTCTCATCAGAGGAAGCTAGG + Intergenic
1151865098 17:76796508-76796530 CCGACTCTGCAGCACCAGCTGGG + Intergenic
1152561842 17:81082544-81082566 TGTTCTCTGGAGAAGCAGCCAGG + Intronic
1152570998 17:81121243-81121265 CGCTCTCTGCAGAAGCAGGTGGG - Exonic
1152587823 17:81196933-81196955 CGCTCTCTGCAGCAGCAGCATGG + Exonic
1155437435 18:25827680-25827702 CCTTCTCTGAACGAGCAGGTTGG - Intergenic
1157498016 18:48170372-48170394 CCTTCTCTGGAGAGGCTGCCAGG - Intronic
1160516354 18:79481242-79481264 CCAGCTCTGCGGACGCAGCTGGG - Intronic
1160521249 18:79509385-79509407 CCTTCACTGTAGGAGGAGCTGGG + Intronic
1161780551 19:6289008-6289030 CCTTCTCAGGAGAAGCTGCAAGG + Intergenic
1162569888 19:11465719-11465741 CCTTCTCAGCAGCTGCAGCTGGG - Intronic
1162648394 19:12066362-12066384 ACTTATCTGCAGAAGTATCTTGG + Intronic
1163132045 19:15280368-15280390 CCTTCTCTGCAGAAGCAGCTGGG + Exonic
1164547715 19:29182991-29183013 CCTACTCGGCAGAAGCAGAGAGG - Intergenic
1164590693 19:29505269-29505291 ACTTGTCTGCAGGAACAGCTGGG - Intergenic
1164763230 19:30743821-30743843 CCTGGGCTGCAGAGGCAGCTAGG + Intergenic
1167006828 19:46781733-46781755 CCTTCTCTGCACAAGTGGCTGGG - Intronic
1167524619 19:49975975-49975997 CCTGCTCAGGAGAAGCAGGTGGG - Intergenic
1168094893 19:54108869-54108891 CCTCCTCTGCACCAGCACCTGGG + Intronic
1168237155 19:55070817-55070839 CCATCTCTACAAAAGTAGCTGGG - Intronic
925162389 2:1695030-1695052 TCTGCTCTGGAGGAGCAGCTTGG - Intronic
925270957 2:2607051-2607073 ACATCTCTTCAGAAGCAGCATGG - Intergenic
925791886 2:7497573-7497595 ACTGCTCTGCAGAACCAGTTAGG - Intergenic
926398273 2:12468174-12468196 CCTTCTATCCAGAAGGTGCTAGG + Intergenic
926684069 2:15685069-15685091 CTGACTCTGAAGAAGCAGCTGGG - Intergenic
928312102 2:30219794-30219816 GCTTCTCTGCAGCAGCTGCCTGG - Intergenic
929577789 2:43063288-43063310 CCTTCTCAGACGAGGCAGCTGGG + Intergenic
930734523 2:54762898-54762920 CCTTTTCAGCAGATGGAGCTGGG + Intronic
931325829 2:61221649-61221671 TCTTCTCTGCTGAAGGAGATGGG - Intronic
933253843 2:80058619-80058641 ACTTCTCTGGCCAAGCAGCTGGG - Intronic
933349693 2:81137538-81137560 CCATCACTGCAGACACAGCTGGG + Intergenic
935102455 2:100009912-100009934 CTTTCCCAGCAGAAGCAGGTGGG + Intronic
937549554 2:123070213-123070235 CCTTCTCTTCAGAGGTAGCCTGG + Intergenic
937883605 2:126885975-126885997 CCTTCCCTGCTGACTCAGCTCGG - Intergenic
938392374 2:130916103-130916125 GCGTCTCTTCCGAAGCAGCTTGG - Intronic
938583937 2:132670769-132670791 CCTTCTGTCAAGAACCAGCTCGG + Intronic
939471804 2:142631632-142631654 CCCTCTCTGCAGCAGTAGATTGG - Intergenic
939471889 2:142633125-142633147 CCCTCTCTGCAGCAGTAGATTGG + Intergenic
940096934 2:149987443-149987465 CCTTCTCTGTGGAGGTAGCTGGG - Intergenic
940213974 2:151285653-151285675 CCTTCTCAGCAGACAGAGCTAGG - Intronic
941889480 2:170563877-170563899 CTTTATCTACAGAAGAAGCTGGG + Intronic
947820249 2:233064122-233064144 CCCTCTCTGCAGGAGCAGCTGGG + Intronic
948034698 2:234848534-234848556 CCTTCTCAGCAGCTGCAGCAGGG + Intergenic
948635035 2:239329415-239329437 CAGCCTCTGCAGCAGCAGCTTGG + Intronic
948635174 2:239330046-239330068 CAGCCTCTGCAGCAGCAGCTTGG - Intronic
1168928312 20:1600616-1600638 GCTTCTCTGCAGAATCAGCTGGG + Intronic
1169558233 20:6770543-6770565 CCGTCCCTGTAGAGGCAGCTTGG + Intronic
1170873239 20:20227532-20227554 ACTTCCCTGCAGAAGCTGCAAGG - Intronic
1171096212 20:22334626-22334648 CCTGCCCTGGAGAATCAGCTGGG + Intergenic
1171289119 20:23970214-23970236 GCTTCTCAGCAGCAGCAGCCTGG - Intergenic
1172094062 20:32452172-32452194 GCTGCTCTGCAGACCCAGCTGGG + Intronic
1173051940 20:39571739-39571761 CCTTCTTTGCAGAGGGATCTGGG + Intergenic
1173186590 20:40844895-40844917 CCTTCTCTGCAGAAGTTTCTGGG - Intergenic
1173400645 20:42723216-42723238 CCTTCTTTGCAAAACCAGGTTGG - Intronic
1173742674 20:45412461-45412483 CCTTCTGTGCAAAAGCCTCTAGG + Intergenic
1174124083 20:48289853-48289875 CCTCCTCTGCAGAGGCTGCAGGG - Intergenic
1175449598 20:59051832-59051854 CCTGCTCTGCACAGCCAGCTGGG - Intergenic
1175601052 20:60273506-60273528 CCTTCTCTGCCTGGGCAGCTCGG + Intergenic
1175669823 20:60892560-60892582 CCTTCTCTGCAGAACCAGTATGG + Intergenic
1176108936 20:63402472-63402494 CCTTCTCTCTAGAAAGAGCTGGG - Intergenic
1177571354 21:22890860-22890882 CCCTCTGTGCAGAATCACCTGGG + Intergenic
1178255753 21:31051005-31051027 CAGTCTCTGCAGAAGAAGCCAGG - Intergenic
1178603281 21:34013447-34013469 CCTTCACTTGAGAAGCATCTAGG + Intergenic
1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG + Intergenic
1179288307 21:39996840-39996862 CCTTCTCTGCAGGAGCACCGTGG - Intergenic
1179503624 21:41825230-41825252 AGTTCTGTGCAGAAGCACCTTGG - Intronic
1180008357 21:45033589-45033611 CCCTGTCTGCCGGAGCAGCTGGG + Intergenic
1180705171 22:17805045-17805067 GCTTCTCTGGAAAGGCAGCTTGG + Intronic
1180884932 22:19235606-19235628 CCTTCTCTAGGAAAGCAGCTGGG - Intronic
1181277744 22:21697163-21697185 CCTCCTCTGCAGGCCCAGCTTGG - Exonic
1181647725 22:24242836-24242858 CCTGTTCCGCAGCAGCAGCTGGG + Intronic
1182978721 22:34647898-34647920 CCATCTCTGCAGCAGTAGATGGG - Intergenic
1183714774 22:39527245-39527267 CCTTTTCCCCACAAGCAGCTGGG + Intergenic
1185258594 22:49849544-49849566 CCCTCTCCGCAGAGGCAGCGCGG - Intergenic
950029166 3:9840576-9840598 TCTTCCCCTCAGAAGCAGCTGGG + Exonic
950116386 3:10452803-10452825 CCTTCTGTCCAGAAGGAACTTGG + Intronic
951648109 3:24916428-24916450 CCTTCTCCTTAGAAGCATCTAGG - Intergenic
952993729 3:38856228-38856250 ACTTCACTGCAGACACAGCTGGG + Intronic
953392980 3:42544638-42544660 CTGCCTCTGCAGAAGCAGCCTGG + Intergenic
953648681 3:44779399-44779421 CCTTCTCAGCAGACAGAGCTAGG + Intronic
953770925 3:45778129-45778151 CCTTCTCAGCAGGAGCACCTGGG - Intronic
955504009 3:59613260-59613282 CCTTCTCTGCAGAAATCTCTAGG - Intergenic
957083092 3:75655546-75655568 CCTTCTCTGCTGGGCCAGCTCGG + Intergenic
958529594 3:95309532-95309554 CAGGCCCTGCAGAAGCAGCTAGG - Intergenic
959587599 3:108039602-108039624 TCTTCTCCTCAGAAGCAACTGGG - Intergenic
959744382 3:109759632-109759654 CCTTCTTTGCAGATGCTGCTGGG - Intergenic
962908698 3:139828097-139828119 CCTTCACTTCAGCAGCAGCTGGG - Intergenic
966888065 3:184387510-184387532 CCATCTCTGCAGACCCCGCTGGG - Intronic
967742639 3:193020228-193020250 CCTTCTCTCCATGAGAAGCTGGG - Intergenic
968492610 4:898321-898343 CCAGCTCTGCACCAGCAGCTCGG + Intronic
969388592 4:6873916-6873938 CCTACTCAGCAGAAGTGGCTGGG + Intronic
969567937 4:7991200-7991222 CCTTCTCTGCAGATGCTGAGAGG + Intronic
972413027 4:38811695-38811717 CCTGCTCTGCAGGAGCAGTCAGG + Intronic
973606008 4:52588426-52588448 CCTTCTCTGCTGGAGCAAATTGG + Intergenic
974260320 4:59518068-59518090 ACCTCTCTGCACAAGCAGCCTGG - Intergenic
975983495 4:80183918-80183940 CGGTCTCTGCTGCAGCAGCTGGG - Intronic
976912010 4:90319144-90319166 CCTGCTCAGCACTAGCAGCTGGG - Intronic
978054782 4:104249661-104249683 CCTCTTCTGCAGGAGCTGCTGGG + Intergenic
979812508 4:125055356-125055378 CCCCATCAGCAGAAGCAGCTAGG + Intergenic
980738391 4:136918933-136918955 CCCACTCTGCTGCAGCAGCTGGG + Intergenic
980927457 4:139152445-139152467 CCACCTCTGCACAAGTAGCTGGG + Intronic
980970105 4:139559545-139559567 CCTTCTCTTCATACCCAGCTTGG + Intronic
981774361 4:148348063-148348085 TCTTCTCTTCAGAAACACCTGGG - Intronic
982162248 4:152581827-152581849 TCTTCTATGAAGAAGCAGTTAGG + Intergenic
982460104 4:155659003-155659025 CCTTTTCTGAAGAGGCAGCCTGG + Intergenic
984463092 4:180059606-180059628 CCTTCCGTGCAGAAGGAGCAAGG - Intergenic
984923042 4:184782719-184782741 CCTCCCCTGTAGAAGGAGCTAGG - Intronic
985427067 4:189841354-189841376 CCTTCTCTGCATAAACACCAGGG - Intergenic
986825379 5:11515153-11515175 TTTTCTCTGCAGAAGCATCATGG + Intronic
987086612 5:14475403-14475425 TCTCTTCTGCAGAAGCAGATGGG + Intronic
987741976 5:21920948-21920970 CCTCCTCTGCAGCAGATGCTTGG + Intronic
988260755 5:28883431-28883453 CCATCACTGCAGAAACAACTGGG + Intergenic
990711146 5:58582172-58582194 CTTTCTCTGCAGCTGCAGCTTGG + Intergenic
992170150 5:74093355-74093377 CTTTCTCTGCTGCAGCTGCTGGG + Intergenic
992493658 5:77270767-77270789 CCTTCTGGGAAGAAGCAGCAGGG + Intronic
992667005 5:79020153-79020175 CCATCTCTGCAGAATCACCTGGG + Intronic
993598094 5:89884763-89884785 CCTTCTCCACAGAAGCAGCATGG + Intergenic
995051932 5:107716833-107716855 CCTTCCCTCCAGAAGCACCAGGG - Intergenic
995082656 5:108071959-108071981 TCTTCTCTGCAGCATCAGATTGG + Intronic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996241150 5:121203844-121203866 CTTTCTCTGCTGAGGCAGATTGG - Intergenic
996360315 5:122638221-122638243 CCTTTTCTGCAGAACCCACTTGG + Intergenic
997982677 5:138478881-138478903 CTTTCTCTTCAGAAGTATCTTGG + Intergenic
998344800 5:141452446-141452468 CCTTGTCAGCAGACGGAGCTAGG + Intronic
998420113 5:141977090-141977112 CCTTCTCAAGAGAGGCAGCTGGG - Intronic
998674810 5:144395512-144395534 TCTTCTCTGCAATCGCAGCTGGG + Intronic
999083158 5:148863395-148863417 CCCACTCTGCAGAGCCAGCTGGG - Intergenic
999127328 5:149255291-149255313 CTATGTCTGCAGAAGCATCTGGG + Intronic
1000608541 5:163350387-163350409 TCTTCTCTGCAGAAACATTTTGG - Intergenic
1001446216 5:171785927-171785949 CCTTCTCCGTTCAAGCAGCTGGG - Exonic
1001547662 5:172580422-172580444 CCTGCTCTCCAGGAGCAGCTGGG - Intergenic
1006154372 6:32006349-32006371 GCTTGTCTGCAGGAGGAGCTGGG - Intergenic
1006455020 6:34126715-34126737 CCATGTCTGCAGCAACAGCTGGG - Intronic
1006641416 6:35491583-35491605 ACTCCTCTGCAGAGGCAGATGGG - Intronic
1007098645 6:39229574-39229596 CCTTCCCCGCACAAGCAGCCCGG + Intergenic
1007615863 6:43179555-43179577 CCTCCTCTGAGGAAGCAGTTGGG + Exonic
1007954254 6:45901994-45902016 CCTGCATTCCAGAAGCAGCTTGG + Exonic
1010015508 6:71101457-71101479 ACATCACTGCAGATGCAGCTGGG - Intergenic
1010800793 6:80173387-80173409 GCTTCTCTGCAGAAGAAATTAGG + Intronic
1014796062 6:125725603-125725625 CCTTCTCAGCAGACAGAGCTGGG - Intergenic
1018131379 6:160735151-160735173 CTTTTTCTGCAGAAGCATCTTGG + Intronic
1019660531 7:2221382-2221404 CGTTCCCTCCAGAAGCAGATAGG + Intronic
1021385231 7:20021291-20021313 ACTTCTCTTCAGAAGCTTCTAGG - Intergenic
1021601063 7:22363934-22363956 CATTCTCAGCAGAGGCAGCACGG - Intergenic
1022334459 7:29409131-29409153 CCTTCTCTGCATAAGCACGTGGG + Intronic
1023695434 7:42841121-42841143 CCGTCTCAGCAGCACCAGCTGGG + Intergenic
1024250852 7:47504714-47504736 CATACCCTGCAGGAGCAGCTGGG + Intronic
1026933221 7:74236678-74236700 GCTTCCCTGGAGAAGGAGCTAGG + Intronic
1027704838 7:81516961-81516983 TCTCCACTGCAGATGCAGCTTGG + Intergenic
1028573970 7:92325328-92325350 TCTTCTCTGCAGAAGCTGCTGGG + Intronic
1029223001 7:99005058-99005080 CCTTGTCTTGAGAAGAAGCTAGG - Intronic
1029455139 7:100666218-100666240 CCTTCACTGAATAAGGAGCTGGG + Intergenic
1029692743 7:102193054-102193076 CCTTCTCTGCAGCCCCAGGTTGG - Intronic
1032504992 7:132427992-132428014 CCTGCTTTGCAGAAGCATATGGG - Intronic
1032649019 7:133857644-133857666 CCTGCCCTGCCGCAGCAGCTGGG - Intronic
1032864159 7:135909327-135909349 CCCTCTCTCCAGAGGCAGCCTGG - Intergenic
1033348678 7:140544644-140544666 CCTCCTCTCCAGAAGCAGGGAGG + Exonic
1034384805 7:150732214-150732236 CCTTCTCTGAAAAAGCAAATAGG + Intronic
1034941342 7:155232308-155232330 CCTCCTCACCAGAAGCACCTGGG - Intergenic
1036430171 8:8682357-8682379 CCATCTCTGCAGAACCAGTTTGG - Intergenic
1037336799 8:17800718-17800740 CCTTCTCAGCAGAAGCAAGCGGG - Intronic
1038650930 8:29402530-29402552 CCTTCTCTCCCACAGCAGCTCGG + Intergenic
1038813126 8:30871986-30872008 CCTTCTGTAAAGAAGTAGCTGGG + Intronic
1039887823 8:41665210-41665232 CCCTCTCGGCTGAAGCAGCCCGG + Intronic
1039895522 8:41714115-41714137 CCTGCTCTCCAGGGGCAGCTGGG + Intronic
1041795859 8:61747239-61747261 CCTTCTCTGCAGCTGCAGGTAGG - Intergenic
1043608504 8:82031906-82031928 CTTTCTGTGCAGAAGCATTTTGG + Intergenic
1043758751 8:84037232-84037254 CCTTCTCTGGAGAATCTGATCGG + Intergenic
1044293540 8:90500778-90500800 CCTTCTCTGTATAGCCAGCTGGG + Intergenic
1044529872 8:93294797-93294819 CCTTATTTGCAGGAGCAGCATGG + Intergenic
1046312815 8:112460821-112460843 GCTTCTCAGCAAAAGCCGCTAGG + Intronic
1047243451 8:123116596-123116618 CCTTCTCGGTAGAAAGAGCTTGG - Intronic
1048504556 8:135009138-135009160 TCTTCACTGGAGAAGCAGCCAGG - Intergenic
1049261617 8:141642041-141642063 CTCTCTCTGCGGAAGAAGCTGGG - Intergenic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1049378286 8:142299439-142299461 CCTCATCTGCAGAAGGCGCTAGG - Intronic
1049483527 8:142839477-142839499 CCTCCACCGCAGGAGCAGCTGGG - Intronic
1049544660 8:143224658-143224680 TCTGCTCTGTAGAAGGAGCTTGG + Intergenic
1051360924 9:16280982-16281004 CCATCTCTGATTAAGCAGCTGGG + Intergenic
1052398577 9:27972245-27972267 ACTTTTCTGCATCAGCAGCTGGG + Intronic
1057114986 9:92512583-92512605 CCATCTCTGCATAAGAAGCTTGG + Intronic
1057560597 9:96125265-96125287 CCTGCTCTGCAGAGCCAACTGGG + Intergenic
1058703588 9:107620812-107620834 CATTGTCTGCAGAAGAAACTGGG - Intergenic
1058873315 9:109220972-109220994 CCTACTTTGCAGGAGAAGCTTGG + Intronic
1059153159 9:111967130-111967152 TCTTCTCTGCAGGATCTGCTGGG - Intergenic
1059399288 9:114058912-114058934 CTTTCTGGGCAGAAGCAGGTGGG - Intergenic
1059441064 9:114307150-114307172 CCTCCTCTGCACAAGCGGCTGGG + Intronic
1060848653 9:126857431-126857453 CCTCCTCTGCAGAGGCAGCCAGG + Intergenic
1060929396 9:127479447-127479469 GCTGCTCTGCTGAAGGAGCTGGG - Exonic
1061087194 9:128405983-128406005 CCTTCTCAGCAGCAGGAGCTGGG + Intergenic
1061824848 9:133251858-133251880 GCTTCGCAGCAGGAGCAGCTGGG - Intronic
1062104161 9:134743678-134743700 CATTATGTGCAGAAGCAGCCTGG + Intronic
1062195709 9:135272771-135272793 GCGTCTCTGCAGAGGCTGCTGGG - Intergenic
1062614402 9:137389482-137389504 CTTTCCCAGCAGAGGCAGCTTGG - Intronic
1185566369 X:1098393-1098415 CCTTGTCTGCCCAAGTAGCTGGG - Intergenic
1186045444 X:5532064-5532086 CCTTCTCTTCAGTGGCAGCGTGG - Intergenic
1186985185 X:15005177-15005199 CCTTCTCAGCAGAAGCTTATAGG + Intergenic
1187350163 X:18506334-18506356 CCTTCTCAGCAGACAGAGCTAGG + Intronic
1187402768 X:18976331-18976353 CCTTCTCTGTAAAAGCATCTTGG + Intronic
1187675338 X:21710900-21710922 TCTTCTTTGCAGAAGGAGCCAGG + Intronic
1188135913 X:26494811-26494833 CCTTCCCTACAGGAGCATCTGGG + Intergenic
1189166972 X:38870067-38870089 CCTACTCCCCAGAAGCAGCCTGG - Intergenic
1189432916 X:40964867-40964889 TCTTCACTGCAGAAACACCTTGG + Intergenic
1190137204 X:47807844-47807866 CCGACTCTGCAGCACCAGCTTGG + Intergenic
1190323036 X:49189409-49189431 TCTTCTCAGCAGAGGCAGCTGGG - Intronic
1190497415 X:51040087-51040109 CCTTCTCAGCATAGGGAGCTTGG + Intergenic
1190561165 X:51686685-51686707 CCCTCTCTGCTGAAGCAGAAAGG + Intergenic
1190563126 X:51706632-51706654 CCCTCTCTGCTGAAGCAGAAAGG - Intergenic
1190901407 X:54677552-54677574 CCTTCTTTAAAGAAGCAGCTAGG - Intergenic
1193635972 X:83949117-83949139 CCTTCTCAGCAGGAGCAGCTAGG + Intergenic
1194473538 X:94329446-94329468 CCTACTCTTCTGAAACAGCTTGG - Intergenic
1194756043 X:97741204-97741226 CCCTCTCTGGAGAAGGGGCTGGG + Intergenic
1195418950 X:104652177-104652199 CTTTAACTGCAAAAGCAGCTTGG - Intronic
1199529597 X:148831570-148831592 CCTTATCTGCAGCAGCAGTGGGG - Intronic
1200044569 X:153394322-153394344 CCCTCGCTGCAGGAGAAGCTGGG + Intergenic
1201391597 Y:13503138-13503160 CCATCACTGCAGACGCAGCTGGG + Intergenic