ID: 1163133067

View in Genome Browser
Species Human (GRCh38)
Location 19:15288644-15288666
Sequence GCAGCTGGTGCTACACAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163133064_1163133067 -10 Left 1163133064 19:15288631-15288653 CCAAAGCAGCCGAGCAGCTGGTG 0: 1
1: 0
2: 1
3: 11
4: 182
Right 1163133067 19:15288644-15288666 GCAGCTGGTGCTACACAGGCTGG 0: 1
1: 0
2: 1
3: 33
4: 243
1163133061_1163133067 2 Left 1163133061 19:15288619-15288641 CCCTTGTTTTTACCAAAGCAGCC 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1163133067 19:15288644-15288666 GCAGCTGGTGCTACACAGGCTGG 0: 1
1: 0
2: 1
3: 33
4: 243
1163133062_1163133067 1 Left 1163133062 19:15288620-15288642 CCTTGTTTTTACCAAAGCAGCCG 0: 1
1: 0
2: 0
3: 10
4: 86
Right 1163133067 19:15288644-15288666 GCAGCTGGTGCTACACAGGCTGG 0: 1
1: 0
2: 1
3: 33
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163133067 Original CRISPR GCAGCTGGTGCTACACAGGC TGG Intronic
900256145 1:1699273-1699295 GCTGCTGGTGCTGGGCAGGCTGG + Intronic
900498488 1:2987863-2987885 GGAGCTGGGGCTGCACATGCGGG + Intergenic
900760375 1:4466541-4466563 GCAGCCGCTGGTACACAGACGGG + Intergenic
901206499 1:7500599-7500621 GCTGCTGCTGCTACAGAAGCGGG - Intronic
901470958 1:9456156-9456178 CCAGCTGGAGATGCACAGGCGGG + Intergenic
902429550 1:16352443-16352465 GCAGCTGCTGCTGCTCAGGCCGG + Exonic
904684822 1:32252285-32252307 CCAACTGGCCCTACACAGGCAGG - Intronic
908569388 1:65392730-65392752 GCAGCTGGTCCCACCCAGGCTGG + Exonic
911592871 1:99767879-99767901 TCAGCTGATGCCACACAGACCGG - Intergenic
912499517 1:110112795-110112817 CCAGCTGGTGCCACAGGGGCTGG - Exonic
912648025 1:111413749-111413771 GGAGCTAGTGCTACACAGAGTGG - Intergenic
916037713 1:160935735-160935757 GCAGCTGTTGCTCCACAGGACGG + Intergenic
917139815 1:171824729-171824751 GCAGCTGGTGCTGCACCAGCAGG - Intergenic
918512180 1:185323326-185323348 GTAGCTGGGGTTACACAGGCAGG - Intergenic
919824366 1:201493127-201493149 GCAGGTGGTGGTTCAGAGGCTGG - Intronic
920599777 1:207312426-207312448 CCAGCTGGTGCCACCCAGACTGG + Intergenic
921269184 1:213451907-213451929 GCAGCTGACGCCACCCAGGCTGG - Intergenic
922803353 1:228373863-228373885 GCAGCTGGTACTACCCAGAGGGG + Intronic
922808115 1:228401098-228401120 GCAGCAGCTGCTGCAGAGGCTGG - Exonic
922866162 1:228863149-228863171 GAAGCTGGCCCTTCACAGGCAGG - Intergenic
924715988 1:246574614-246574636 CCAGCTGGGGCAACACAGGGAGG - Intronic
1063413588 10:5855346-5855368 TCACCTGGTGCTACTCAGCCTGG + Intergenic
1065916586 10:30358496-30358518 GGAGCTGGAGCTTCACAGGTAGG - Intronic
1070162674 10:73875029-73875051 GCAGCTGGCTCTGCGCAGGCTGG - Intergenic
1070711624 10:78687173-78687195 GAAGTTGATGCTAGACAGGCTGG + Intergenic
1071503704 10:86220690-86220712 GCAGCATGTGGGACACAGGCTGG - Intronic
1073006679 10:100330219-100330241 GCAGCTGTTTCCACACAGCCTGG + Exonic
1074450417 10:113554961-113554983 GCGGCTTGTGTTCCACAGGCTGG + Intronic
1075121804 10:119669916-119669938 GGAGCTGGGGGTACACAGGGTGG - Exonic
1075122209 10:119672476-119672498 GGATCTTGTGGTACACAGGCTGG - Exonic
1075815827 10:125264231-125264253 GCAGCTGCTGGGACGCAGGCTGG + Intergenic
1076063194 10:127429177-127429199 CCAGCTGGTGCTACAGAGAAGGG - Intronic
1076441650 10:130484730-130484752 GGAGATGATGCTAGACAGGCAGG + Intergenic
1076634797 10:131875260-131875282 CCAGCTGGTGCTTCCCTGGCTGG - Intergenic
1076847614 10:133077004-133077026 GCAGCTGGTGCCACAGAGACGGG - Intronic
1077184868 11:1231496-1231518 GCAGCTGGTGCCACTCATGCAGG + Exonic
1077206233 11:1346163-1346185 GCAGCTGGGACTAGACAAGCAGG + Intergenic
1077396576 11:2326667-2326689 GCATCTGTTGCTGCACAGGGAGG + Intergenic
1077877423 11:6320032-6320054 CCAGCTGGTGGCCCACAGGCCGG + Intronic
1078191379 11:9094533-9094555 GCAGCCGCTCCTACACAAGCGGG + Intronic
1079134873 11:17770687-17770709 GCAGGTGGTTCTGGACAGGCAGG + Intronic
1080432365 11:32210662-32210684 GCAGCTGCTGATTCACAGCCTGG + Intergenic
1083611999 11:64008723-64008745 GCAGCTGCACCCACACAGGCAGG + Intronic
1083622752 11:64057066-64057088 AGAGCTGGTGCGACGCAGGCTGG - Intronic
1083832703 11:65243019-65243041 GCTGCTGGAGCTACAAAGGTAGG - Intergenic
1084008673 11:66336028-66336050 GCAGCTGCAGCCACACGGGCCGG + Exonic
1084459183 11:69286788-69286810 GCACCTGATGCCACCCAGGCAGG - Intergenic
1084654860 11:70509255-70509277 ACAGCTGGTGCTGCAGGGGCAGG - Intronic
1084749901 11:71197778-71197800 GTAGCTGGGACTACACTGGCAGG + Intronic
1085253670 11:75159948-75159970 GGAACTGGGGCTAGACAGGCTGG + Intronic
1085407257 11:76270510-76270532 GCTGCTGGTGCCTCTCAGGCTGG + Intergenic
1088652652 11:111972093-111972115 GAAGCAGGTGGTACACATGCAGG - Intronic
1089332775 11:117701503-117701525 GCATCTGGAGGTACACAGGCAGG + Intronic
1090662933 11:128894768-128894790 TAAGCTGCTGCTGCACAGGCAGG - Intronic
1093784891 12:23181484-23181506 GCAGCTGGTGCAACTTAGGAAGG + Intergenic
1093855925 12:24102155-24102177 GCAGCAGGTGCTACACAGGAAGG - Intergenic
1094036995 12:26082157-26082179 GCAGCTGGAGCTGCAGTGGCTGG + Intergenic
1094599715 12:31898031-31898053 GCAGCAGGAGCTACAGAGCCGGG - Intergenic
1096883875 12:54698002-54698024 GCAGCCTGTGCTCCTCAGGCTGG + Intergenic
1098765431 12:74482596-74482618 GCAGCTGGTGATCCACAGTCAGG - Intergenic
1099166013 12:79308033-79308055 GCAGCTGATGCTTCAAATGCAGG - Intronic
1100345207 12:93723391-93723413 CCAGCTGGTGCCACCCAGACTGG + Intronic
1100528484 12:95442428-95442450 GCAGCTGGTGATCCAGAGGTAGG - Intergenic
1101211842 12:102542643-102542665 GCAGCTGGTGGTACAAAGTGTGG + Intergenic
1101326063 12:103716980-103717002 CCAGCTAGGGCTACACGGGCAGG - Intronic
1102192309 12:110998025-110998047 TCAGCTGGTGCTGCCCAGACAGG + Intergenic
1102905284 12:116669951-116669973 ACAGCTGGTGCCAGAAAGGCAGG - Intergenic
1104017699 12:124971623-124971645 ACAGCAGGTGCCACACAGACAGG + Intronic
1104906254 12:132215006-132215028 GCGGAGGGTGCTACAGAGGCCGG - Intronic
1106448971 13:29862680-29862702 GAAGCTGGTACCACACAGGAAGG - Intergenic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1107108025 13:36667640-36667662 GCAGCTGGCGCAAGGCAGGCTGG + Intergenic
1107595673 13:41960913-41960935 GCAGGTGGTGCAGCGCAGGCCGG - Exonic
1108260147 13:48647835-48647857 GAAGCTAGGGCTACAGAGGCGGG + Intergenic
1113228481 13:108185080-108185102 GCAGCTGTTACTACCAAGGCAGG + Intergenic
1117641729 14:57807307-57807329 CCAGCTGGTGCTACCTAGGTGGG + Intronic
1117839894 14:59849239-59849261 GCACCTAGTGCTAGGCAGGCAGG - Intronic
1119733922 14:76968893-76968915 GCAGCTGGTGCTGCACCAGCAGG + Intergenic
1120918668 14:89733797-89733819 TCATCTGATGCTAGACAGGCAGG + Intergenic
1122569489 14:102685610-102685632 GTAGCTGGGACTACACACGCAGG + Intronic
1122843366 14:104477339-104477361 GCGGCTCTTGCTCCACAGGCGGG - Intronic
1122853046 14:104547060-104547082 GCAGCTGCTGCTCCAGATGCAGG + Intronic
1125483668 15:40097825-40097847 GAAGATGGTGCTCCCCAGGCCGG - Intronic
1125639330 15:41216703-41216725 GTAGCTGGTGCTTCAGGGGCAGG + Exonic
1125723274 15:41855316-41855338 GCAGCTGCAGCTACACCAGCTGG - Exonic
1126831020 15:52605359-52605381 GAAGCTGGTGATATACAGGTGGG + Intronic
1128390700 15:67180676-67180698 GAAGCTGCTGCTCCACAGGCTGG + Intronic
1128655139 15:69455233-69455255 GCAGCTGGTGCTGCACCAGCAGG + Exonic
1128842091 15:70858774-70858796 GCAGCTGCTCCTACACAAGTGGG + Intronic
1129302258 15:74632155-74632177 GCAGCTGGTTCTACAGAGGAAGG + Exonic
1130213909 15:81950961-81950983 GCCTCTGCTGTTACACAGGCAGG - Intergenic
1130650449 15:85759541-85759563 GCAGCTGGCCTGACACAGGCGGG + Exonic
1130722556 15:86403743-86403765 ACAGCTGGTGTTACAGAGCCAGG + Intronic
1130887498 15:88106196-88106218 GCAGCGGCTGCTACAGCGGCCGG + Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1134100296 16:11447184-11447206 GCATCTGGTGTCACACAGACTGG + Intronic
1134319424 16:13149305-13149327 GCAGCTGGGGATACAGAGGAGGG + Intronic
1134622404 16:15699387-15699409 GTAGCTGGGACTACACATGCAGG + Intronic
1135084356 16:19463037-19463059 GTAGCTGGGACTATACAGGCAGG + Intronic
1135589981 16:23698107-23698129 GCTGCTGCTTCTACACAGGTTGG + Intronic
1135638677 16:24100995-24101017 CCAGCTGGTGCAACCCAGACTGG - Intronic
1136922884 16:34346241-34346263 GCAGCTGGTGGGTCCCAGGCTGG + Intergenic
1136981689 16:35065565-35065587 GCAGCTGGTGGGTCCCAGGCTGG - Intergenic
1137009554 16:35309370-35309392 GCTGCTGGTGCCACGCGGGCAGG - Intergenic
1137264500 16:46857819-46857841 GCAGTTGCTGCTGCACCGGCTGG + Intergenic
1137609187 16:49807707-49807729 GCAGCTGGTCCCACCAAGGCAGG + Intronic
1137833667 16:51569691-51569713 GCAGCTGGTACTCCCCAGACAGG + Intergenic
1140201858 16:72901436-72901458 GCAGCCGGCGCAACACAAGCAGG + Intronic
1141002909 16:80324830-80324852 GAAGCTGGTGTATCACAGGCAGG + Intergenic
1141701510 16:85644404-85644426 TCAGCTGGTGGCATACAGGCTGG - Intronic
1141993339 16:87622495-87622517 ACAGCTGCTGCTTCACAGGAAGG - Intronic
1143201617 17:5117188-5117210 GCAGCGGGTGCTACAAAGCAGGG - Intronic
1143938956 17:10518396-10518418 TAAGCTGGTGCTTCACTGGCAGG + Intronic
1144488584 17:15687734-15687756 GCAGATGGGGCTGCAGAGGCTGG + Intergenic
1144531650 17:16044831-16044853 GCAGCTGGTGCTGCACCAGTGGG + Intronic
1144670630 17:17130726-17130748 GGAGCTGGGGCTTCAGAGGCAGG + Intronic
1144912427 17:18694571-18694593 GCAGATGGGGCTGCAGAGGCTGG - Intergenic
1145959529 17:28879430-28879452 GCAGGAAGAGCTACACAGGCTGG + Exonic
1147456036 17:40538699-40538721 CCAGCCGCTGCGACACAGGCTGG + Intergenic
1147871395 17:43590097-43590119 GCAGCTGGTCCGACTCAGGGAGG - Intergenic
1148128186 17:45247544-45247566 GCAGCTGGGGTTAGACACGCCGG + Intergenic
1148685110 17:49496541-49496563 GCAGCTCTGGCTACGCAGGCGGG + Intronic
1149026869 17:52036907-52036929 GCAGGTGGAGCTACTGAGGCGGG + Intronic
1149727760 17:58913753-58913775 CCAGCTGGTGCCACCCAGACAGG - Intronic
1150096657 17:62381897-62381919 GCAGCAGGAGCTGCACAGCCTGG - Intronic
1151231256 17:72686678-72686700 TCAGCGTGTGCTCCACAGGCAGG + Intronic
1152586647 17:81192347-81192369 GCAGCTGGAGCTGGAGAGGCAGG - Exonic
1152776535 17:82205493-82205515 GCAGCTGGAGCCACGCAGGCTGG - Intronic
1156049923 18:32920137-32920159 GCAACTGGTGCTAAGGAGGCAGG - Intergenic
1158592387 18:58788739-58788761 GCAACTGGGGCTAAGCAGGCAGG + Intergenic
1159639029 18:70841654-70841676 CCAGCTGGTGCTAACCAGGCTGG - Intergenic
1160710519 19:549091-549113 GCGGCTGTTGTTACACATGCGGG - Exonic
1161343726 19:3756922-3756944 GCATCTGGTTCTACTCAGACTGG - Intronic
1161374070 19:3930025-3930047 GTAGCTGGTACTACAGAAGCAGG + Intergenic
1161865243 19:6828418-6828440 GGAGCTGGTGAAACACACGCAGG + Exonic
1162534760 19:11256312-11256334 GCAGCTGCTGCTCCAGAGGAGGG + Intronic
1162578592 19:11513921-11513943 GCAGCTGGTTGTACACAGCCAGG + Exonic
1162805350 19:13135452-13135474 TCAGCTTCTGCTACACGGGCCGG + Exonic
1163125694 19:15243158-15243180 GCAGCTGCTGCTGCACAGAGGGG + Exonic
1163133067 19:15288644-15288666 GCAGCTGGTGCTACACAGGCTGG + Intronic
1163459579 19:17428824-17428846 GTAGCAGGGACTACACAGGCAGG - Intronic
1163696834 19:18768502-18768524 GCAGCTGCTGCTCCAGAGACAGG - Exonic
1164272131 19:23682522-23682544 GAAGCTGGGGATGCACAGGCAGG - Intronic
1167203857 19:48086659-48086681 GCAGCTGGTGCTCCACCTGCTGG + Intronic
1167637588 19:50664067-50664089 GTAGCTGGGACTACAGAGGCAGG + Intronic
924972503 2:141819-141841 GCATGAGGTGCTACACACGCTGG + Intergenic
925932592 2:8721720-8721742 GCACCTGGAGCCACACTGGCTGG + Intergenic
925977083 2:9149263-9149285 GCAACTGCTGCCACCCAGGCCGG + Intergenic
927515085 2:23667644-23667666 GCAGCCGGGTCTACACAGGATGG - Intronic
929201579 2:39242968-39242990 GTAGCTGGGACTACAGAGGCAGG - Intergenic
930095216 2:47561472-47561494 GCAGCAGGTGCCACACAGCAGGG + Intronic
932101186 2:68900683-68900705 GCAGCTGGTGTTGCACAGGGTGG - Intergenic
935262843 2:101369997-101370019 GCAGCTGATTCCACAGAGGCAGG + Intronic
937047521 2:118859506-118859528 GCAGCTGGTGCTGCACTGGAGGG + Intergenic
937244471 2:120483685-120483707 GAAGCTGGTGCTCCAGAAGCTGG + Intergenic
937543612 2:122988961-122988983 GCAGCTGCAGCTGCACAGCCCGG - Intergenic
937855031 2:126666105-126666127 GCAGCTGCTGGGACACAGGTGGG - Intronic
937894999 2:126971719-126971741 GGGGCTGGTCCTCCACAGGCTGG - Intergenic
937895010 2:126971751-126971773 GGGGCTGGTCCTCCACAGGCTGG - Intergenic
939311982 2:140491975-140491997 GCAGCAGCTGCTACACAGCTTGG + Intronic
939755375 2:146103008-146103030 GCAGCTGGTGCCACCCATACCGG - Intergenic
941613500 2:167691825-167691847 GCAGCTTGTGAAGCACAGGCAGG + Intergenic
942465231 2:176201020-176201042 GCAGCTGGTGCTGCACCAGCAGG - Intergenic
942947301 2:181684213-181684235 GCTGCAGGTCCTGCACAGGCTGG + Intergenic
943784172 2:191858598-191858620 ACAGCTAGTGGTTCACAGGCTGG + Intergenic
944691303 2:202160887-202160909 GCAGCTGGCTCAAGACAGGCTGG + Intronic
944808111 2:203302390-203302412 GCAGGTGGTGCCACCAAGGCTGG - Intronic
944949465 2:204730839-204730861 CCATCTGGTGCTACAGAGGATGG + Intronic
946099480 2:217307157-217307179 GGAGTAGGTGCTACTCAGGCTGG + Intronic
946337668 2:219049413-219049435 GCAGCAGGTGTGACTCAGGCCGG + Intergenic
948450730 2:238069505-238069527 GCAGCTGGAGCTCAGCAGGCTGG - Intronic
1170028861 20:11923088-11923110 GCAAATGGTGCTGCACAGTCCGG + Exonic
1172436463 20:34932025-34932047 GCAGCAGGAGCTAAGCAGGCCGG - Exonic
1172873908 20:38152758-38152780 GGAGCTGGTGATGCAGAGGCAGG - Intronic
1173802762 20:45905052-45905074 GCAGCTGGGGCTCCACTGCCCGG + Exonic
1174288091 20:49486124-49486146 GCTGCTAGTGTTACACAGGGTGG + Intergenic
1175637578 20:60598636-60598658 GCAGCTGGCGAGAGACAGGCTGG - Intergenic
1175924827 20:62466513-62466535 GCAGTTGGTGCAGCAGAGGCCGG + Exonic
1176386461 21:6140592-6140614 GCAGCTGCTGCCAGCCAGGCAGG + Intergenic
1177301058 21:19245839-19245861 GCAGCTGATGCTACACACGAAGG - Intergenic
1178362285 21:31958573-31958595 GATGGAGGTGCTACACAGGCTGG + Intronic
1178803466 21:35818652-35818674 GCCCCTGGCGCTGCACAGGCTGG - Intronic
1179714144 21:43279159-43279181 GCAGCTGGTGTGGCAGAGGCAGG + Intergenic
1179737012 21:43397660-43397682 GCAGCTGCTGCCAGCCAGGCAGG - Intergenic
1179886517 21:44316428-44316450 GCAGCTGGTGGTTCAGAGGCTGG + Exonic
1181758572 22:25042043-25042065 CCAGCTGGTTCTTCACAGGCAGG + Intronic
1181948999 22:26540910-26540932 GCTGCTCGTAGTACACAGGCAGG + Exonic
1184279672 22:43429827-43429849 GCAGCTGGTCCTCCACACCCAGG - Intronic
1184527301 22:45032538-45032560 AAAGCTAGTGCTACACAGCCAGG + Intergenic
950443546 3:13023348-13023370 GCAGCTGGGGCTTCCCAGGCAGG + Intronic
950447433 3:13046473-13046495 GCAGCAGATGCTATACAGGAAGG - Intronic
950662818 3:14477293-14477315 GTAGCTGATGCTACACACGAAGG - Exonic
950945491 3:16941436-16941458 GTAGCTGGTGCTGCTGAGGCTGG - Intronic
953348292 3:42194679-42194701 GCAGCTGGTTCCACACGTGCTGG + Intronic
953420042 3:42747271-42747293 GCAGCTCCTGCTTCACAGACTGG + Exonic
953462782 3:43094978-43095000 GCAGCAGGAGCTCAACAGGCTGG - Intronic
960309617 3:116105196-116105218 ACAGCTGGTGATATACAGTCTGG + Intronic
961326713 3:126113332-126113354 GCAGAGGGTGGGACACAGGCAGG + Intronic
962893221 3:139691496-139691518 GAAGCTGGTGATACAAAGTCTGG - Intergenic
962921882 3:139957787-139957809 GCAGCTTGTGGCAAACAGGCTGG - Intronic
966909306 3:184549859-184549881 GCAGGTGGTGCTAAGCAGGTTGG + Intronic
968764555 4:2461481-2461503 GCTGCTGGTGCTGTACAGGGCGG + Intronic
969641496 4:8401717-8401739 GCAGATGGGGCACCACAGGCAGG - Intronic
969998827 4:11343372-11343394 GCTGCTTGTGCCACACAGGGTGG - Intergenic
974298783 4:60038455-60038477 GCAGCAGGTGCTACACTGGTAGG + Intergenic
976161971 4:82211256-82211278 GCAGCTGGTACTCCAGGGGCAGG - Intergenic
977383549 4:96308453-96308475 GGAGCTGTTGCTTCAGAGGCTGG + Intergenic
978016709 4:103753904-103753926 GCAGCTGGTACTGGAAAGGCAGG - Intergenic
979552987 4:122012022-122012044 GGAGCTGGTTCTACAAAGGCAGG - Intergenic
981337095 4:143580540-143580562 GCAGCAGGAGCTCCAGAGGCTGG - Intronic
982257316 4:153463605-153463627 GCAGCTGGGACCACAGAGGCAGG - Intergenic
982486986 4:155977859-155977881 TCAGCTGATGCTACCCAGACTGG - Intergenic
982767920 4:159369081-159369103 GTAGCTGGTGCCAAAAAGGCTGG + Intergenic
985680019 5:1251105-1251127 GCAGCTGGGACTACAGATGCTGG + Intergenic
985693449 5:1326273-1326295 GACGCTGGAGCTCCACAGGCAGG - Intronic
986786065 5:11114920-11114942 TCAGCAGGTGCTTCACTGGCTGG - Intronic
990123007 5:52479251-52479273 CCAGCTGGTGCCACCCAGACAGG - Intergenic
991611467 5:68454036-68454058 CCAGCTGGTGCCACCCAGACTGG - Intergenic
993823892 5:92657119-92657141 GCAGCTGCTCCTACACACTCAGG - Intergenic
994182220 5:96780076-96780098 CCAGCTGTTGCTAAAGAGGCAGG - Intronic
994320947 5:98393446-98393468 GCAGCTGTTCCTACACAAGTGGG - Intergenic
997285790 5:132677401-132677423 GCAGCCAGAGCTAGACAGGCAGG + Intronic
997524614 5:134544318-134544340 GATGCAGGTGCTACACAGGAAGG + Intronic
997529046 5:134570959-134570981 CCAGCTGGTGGCACACGGGCAGG - Intronic
997708182 5:135978366-135978388 CCATCTGGTGCTACAGAGACAGG + Intergenic
997969491 5:138389110-138389132 GCTGCTGTTGCTTCACAGGCAGG - Intronic
999277136 5:150338891-150338913 GCAGCTGGGGATAGACAGGGTGG - Intronic
999462039 5:151766008-151766030 GCAGCTGGTGCTGCACCAGCAGG - Intronic
1001643008 5:173258481-173258503 TCAGCTGGTGTTACCCAGGTTGG + Intergenic
1002140488 5:177134419-177134441 GCAGCTGCTGCTACCCTGACTGG + Intronic
1006906707 6:37537834-37537856 GCAGATGGTGCTACAGGGGCAGG + Intergenic
1007407242 6:41642148-41642170 GCACCGGGTGCCACACATGCTGG - Intronic
1010161520 6:72862150-72862172 CCAGCTTGTGCTAGACAGACAGG - Intronic
1010936075 6:81863334-81863356 GCAGCTAATGCCAAACAGGCAGG + Intergenic
1012379559 6:98604031-98604053 TCACCTGGTGTTACACAGGCTGG + Intergenic
1015045143 6:128767924-128767946 GTAGCTGGTGTTTCACAGGCTGG + Intergenic
1015186253 6:130419945-130419967 GAAGGTGGTGCTACACATGGTGG + Intronic
1015367784 6:132416283-132416305 TCAGCTGGTGCTACCCAGACAGG + Intergenic
1019398384 7:835965-835987 GCAGATGCTGCTGGACAGGCGGG + Intronic
1020444028 7:8249428-8249450 GCACATGGTGCTTCAGAGGCTGG - Intronic
1020491162 7:8785951-8785973 TCAGCTTGTGCTACATTGGCAGG - Intergenic
1022673301 7:32476109-32476131 GCAGTAGGTGCTCCACAGGAGGG - Intergenic
1023022373 7:36021802-36021824 GGAGCTGGACCTACACAGGTTGG + Intergenic
1023913781 7:44573585-44573607 GCAGCTGTTGCTCCATAGGAAGG - Exonic
1027192163 7:76003003-76003025 GCTGTTGGTGCCAGACAGGCAGG + Intronic
1028223165 7:88219976-88219998 GCGGCGGGTACTACCCAGGCGGG - Exonic
1031952689 7:127908578-127908600 TCAGCTGGTTCTACACACTCTGG - Intronic
1032506983 7:132442984-132443006 GAAGCTGGTGCAGCACGGGCTGG - Intronic
1033164358 7:139026755-139026777 GCAGCTGGAGCTGCAGAAGCTGG - Exonic
1034507621 7:151506853-151506875 GCTGGTGGTGCTACACAGCTGGG + Intronic
1035694456 8:1584546-1584568 GCAACGGTTGCAACACAGGCTGG - Intronic
1036617323 8:10398611-10398633 GCAGCTGGTGCTAGAATTGCTGG - Intronic
1040284990 8:46094976-46094998 GCAGCTGTGGGGACACAGGCGGG + Intergenic
1044613774 8:94119550-94119572 ACAGCCGGGGCTGCACAGGCGGG + Intergenic
1046932403 8:119854988-119855010 GGAGCTGGGGCTGCACAGGGTGG + Intronic
1048024956 8:130577837-130577859 GCAGCTGGGACTACAGACGCAGG + Intergenic
1048138343 8:131768330-131768352 GAAGCTGGTGCTCCACCTGCAGG - Intergenic
1048223924 8:132566818-132566840 GAAGTTGGGGGTACACAGGCTGG - Intergenic
1049433980 8:142577794-142577816 CCAGCTGGTGGAACACAGCCAGG - Intergenic
1049670919 8:143869513-143869535 GCAGCCTGTGCCCCACAGGCAGG + Exonic
1053104256 9:35396850-35396872 GCAGTTCGTGCTACAATGGCTGG + Exonic
1056589115 9:87951426-87951448 CCAGCTTGTGCTACCCAGACTGG + Intergenic
1056823434 9:89860434-89860456 GCAGCTGGTGGTGGACAGGCAGG + Intergenic
1056901733 9:90606266-90606288 CCAGCTGGTGCCACCCAGACTGG - Intergenic
1058839498 9:108892349-108892371 GAAGCTGGTGCTAAAGAAGCTGG + Intronic
1059404847 9:114093234-114093256 GCAGGTGGTGCTCCCCTGGCAGG + Exonic
1060875753 9:127082437-127082459 GCTGCTGCTGCTGCATAGGCAGG + Intronic
1061039521 9:128131849-128131871 GCAGCTGGCGGTGGACAGGCAGG - Intergenic
1062254640 9:135615169-135615191 CCTGCTGGGGCTACACAGCCGGG + Intergenic
1187338502 X:18401337-18401359 GCACATGGTGATTCACAGGCAGG - Intergenic
1187675237 X:21709940-21709962 GCAGATGGTGCTTCTCAGTCTGG - Intronic
1190456677 X:50634415-50634437 GCAGCTAGTGGCACAGAGGCAGG - Exonic
1194074120 X:89367603-89367625 GCAGCGGGTACCACCCAGGCGGG - Intergenic
1198841850 X:140865534-140865556 GCAGCAGGTGCAACACAGTGGGG - Intergenic
1199814699 X:151387102-151387124 GCAGCTGGTGCTTCACCATCTGG + Intergenic
1200152139 X:153956464-153956486 GCAGCTCCTCCTGCACAGGCTGG + Intronic
1200729512 Y:6719130-6719152 GCAGCGGGTACCACCCAGGCGGG - Intergenic
1201951381 Y:19567778-19567800 GCAGCTGCAGCTACAAAGCCCGG - Intergenic