ID: 1163133544

View in Genome Browser
Species Human (GRCh38)
Location 19:15292388-15292410
Sequence TGTGGTCCAAATTAGTGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163133544_1163133551 13 Left 1163133544 19:15292388-15292410 CCTTGGCACTAATTTGGACCACA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163133551 19:15292424-15292446 GGAAAACTACCTGCCTAATAGGG 0: 1
1: 0
2: 0
3: 15
4: 143
1163133544_1163133547 -9 Left 1163133544 19:15292388-15292410 CCTTGGCACTAATTTGGACCACA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163133547 19:15292402-15292424 TGGACCACACAATGGACTACGGG 0: 1
1: 0
2: 0
3: 8
4: 78
1163133544_1163133546 -10 Left 1163133544 19:15292388-15292410 CCTTGGCACTAATTTGGACCACA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163133546 19:15292401-15292423 TTGGACCACACAATGGACTACGG 0: 1
1: 0
2: 0
3: 9
4: 108
1163133544_1163133548 -8 Left 1163133544 19:15292388-15292410 CCTTGGCACTAATTTGGACCACA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163133548 19:15292403-15292425 GGACCACACAATGGACTACGGGG 0: 1
1: 0
2: 0
3: 5
4: 71
1163133544_1163133550 12 Left 1163133544 19:15292388-15292410 CCTTGGCACTAATTTGGACCACA 0: 1
1: 0
2: 0
3: 7
4: 97
Right 1163133550 19:15292423-15292445 GGGAAAACTACCTGCCTAATAGG 0: 1
1: 0
2: 0
3: 5
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163133544 Original CRISPR TGTGGTCCAAATTAGTGCCA AGG (reversed) Intronic
902341406 1:15785797-15785819 TGTGGTGCAAAGTGGGGCCAGGG + Intronic
902348665 1:15837164-15837186 TGTGGTGGAAATTATTACCAGGG + Intergenic
912705858 1:111911599-111911621 TGTAGTCCAAATTTGAGCCCTGG - Intronic
917294445 1:173504248-173504270 TGAGGTTCAAATTGCTGCCAAGG + Intronic
917591462 1:176480732-176480754 GGTGGTCCTAACTAGTGTCATGG - Intronic
920315432 1:205073162-205073184 TGTGGTCCGAATTTGTACCAGGG - Exonic
921313579 1:213869793-213869815 TGGGGTCTAAATTCATGCCAGGG - Intergenic
1069092464 10:64217561-64217583 TGTGGTCTTAACTAGGGCCATGG - Intergenic
1070320612 10:75352142-75352164 TGTGCCCCAAACTTGTGCCAGGG - Intergenic
1072000471 10:91190487-91190509 TTTGGTCTAAATTATTACCAAGG + Intronic
1073512290 10:104050345-104050367 TGTTGCACAAATTGGTGCCATGG + Intronic
1076409481 10:130235630-130235652 TCTGGTCCAAATCAGTGTCCAGG - Intergenic
1078370528 11:10740930-10740952 TGAGATCCAAATTACTCCCAAGG + Intergenic
1080023797 11:27592868-27592890 TGTGGTCCAAACTAGAGAAAAGG - Intergenic
1090435906 11:126686126-126686148 TGTGGTCCGAGTTACTGGCAGGG + Intronic
1092036312 12:5338226-5338248 TGTGGTCCAAAATACTGCGGAGG + Intergenic
1092660529 12:10733495-10733517 TGTGGTCCATATCGGAGCCATGG + Intergenic
1094685688 12:32711944-32711966 TGTGGGATAAATTAGTGTCAAGG - Intronic
1101831779 12:108263527-108263549 TGTGAGCCAAATAATTGCCAAGG - Intergenic
1108540848 13:51443888-51443910 TGTGGTCAAAATTAGTTAAAAGG - Intronic
1116050065 14:39791266-39791288 TTTGGTGCAAATTTGTGTCAGGG + Intergenic
1117741995 14:58828196-58828218 TGTGGACCTCATCAGTGCCATGG - Intergenic
1118318565 14:64740341-64740363 TGTGGTTCAAATTACTTTCAAGG + Intronic
1123958861 15:25372567-25372589 TGTGGTCCAACTCTGTGCCCAGG - Intronic
1129544558 15:76381485-76381507 TGGGGTCCAAGATGGTGCCATGG + Exonic
1131259205 15:90879915-90879937 TGTGGTCCAATTCTGGGCCAGGG - Exonic
1132399833 15:101498491-101498513 TGGAGTCCAAATTCTTGCCAAGG - Intronic
1134025278 16:10948458-10948480 TATTGTCCAGATTAGTGGCAAGG + Intronic
1135981965 16:27154761-27154783 AGTGGTCAAAGTTAGTGCCCAGG + Intergenic
1136664221 16:31794039-31794061 TGTGGTACAAACCTGTGCCATGG + Intronic
1139056833 16:63195944-63195966 TGTGGGCAAAATTATTTCCATGG + Intergenic
1141275882 16:82587890-82587912 TGTGGCCCAGGCTAGTGCCATGG - Intergenic
1146445957 17:32933180-32933202 TGTGGACCTCATTGGTGCCATGG + Exonic
1147413790 17:40273809-40273831 TGTGATCCGAAATGGTGCCAGGG + Exonic
1148221986 17:45869553-45869575 TGTGGTCTAAAATTGTGCCATGG + Intergenic
1163133544 19:15292388-15292410 TGTGGTCCAAATTAGTGCCAAGG - Intronic
1165888764 19:39098470-39098492 TGTGGTCCAAGTTACAGTCATGG - Exonic
1166252980 19:41584301-41584323 TGAGGTCCAAATCTGTTCCAGGG - Intronic
925244253 2:2366077-2366099 TGTAGTCCAACCCAGTGCCAGGG - Intergenic
927356267 2:22177334-22177356 TGTGGTCCAAGTTAGGGCAGGGG + Intergenic
927961516 2:27243163-27243185 TGGGGTCCCCATTAGTGCCTTGG - Intronic
929360072 2:41077372-41077394 AGTGGTCAAAATGAGTGACATGG - Intergenic
931799241 2:65742353-65742375 TGAGGTCCAAATTCCTGTCATGG - Intergenic
936871308 2:117136645-117136667 TCAGGTATAAATTAGTGCCACGG - Intergenic
937630178 2:124092454-124092476 TTTGGTCCAAATTTGGCCCATGG - Intronic
939589669 2:144048694-144048716 AGTGGTACAAAGGAGTGCCACGG + Intronic
942304776 2:174596107-174596129 TGTGGTGAAAATTAGTTCCTGGG - Intronic
942812766 2:180017891-180017913 TGAGGTCCACATCAGTGGCATGG - Intergenic
943394399 2:187314769-187314791 GGTGATCCAAATCAGTGTCATGG - Intergenic
944826068 2:203484345-203484367 TCTGGCCCAAAATAGAGCCAAGG - Intronic
944958792 2:204844182-204844204 TTTAATCCAAATTTGTGCCAAGG + Intronic
945649749 2:212542257-212542279 AGTGATCCAACTTAGAGCCAGGG - Intergenic
946348622 2:219132103-219132125 TTTTGTCCAGATTAGAGCCACGG - Intronic
946978262 2:225177323-225177345 TGTGGTGCTAATGAATGCCAAGG + Intergenic
948079609 2:235195111-235195133 TGAGGTCAAAGTTAGCGCCACGG + Intergenic
1169722920 20:8698894-8698916 TGTGGTGCAAAATAGAGCTAAGG - Intronic
1172875724 20:38163282-38163304 TGTGGTCCAAGTGAGGCCCAGGG + Intronic
1181480821 22:23198174-23198196 TGTGGTCCAATTTAGTGCTCTGG - Intronic
1183795904 22:40117438-40117460 TGTAGTCCACATTACTGCCAGGG + Intronic
1184024070 22:41840924-41840946 AGAGGCCCAAATCAGTGCCATGG - Intronic
963866642 3:150368772-150368794 TGTGGTCCTAATCAGTGACTGGG - Intergenic
965600362 3:170448142-170448164 TGAGGTCCTAATTAATGACAGGG + Intronic
965798205 3:172463668-172463690 TGTGGTCAAAATCAGGGCCTTGG + Intergenic
966741047 3:183234142-183234164 TGTGGTCCCACTTGATGCCAGGG - Intronic
967028215 3:185582759-185582781 TGTGGTCCACAGTAGAGACATGG - Intronic
968565928 4:1312806-1312828 AGTGGGCCAGATTAGTCCCAAGG - Intronic
969380600 4:6794518-6794540 TGAAGTGAAAATTAGTGCCAAGG + Intronic
973735103 4:53863954-53863976 TGTGGTTTATATTAGTGCCCTGG - Intronic
976563719 4:86530420-86530442 TGTGGTACATATTGGTGACATGG - Intronic
977690537 4:99903609-99903631 TGTGCTCCAATTATGTGCCAGGG + Intronic
978580581 4:110227735-110227757 TGTGGTCCACATTTGACCCAAGG + Intergenic
981670940 4:147286441-147286463 TGTGGTGCTAATTAGAGACATGG - Intergenic
984183021 4:176508440-176508462 TGTGGTCCAAATCAGTTAAAGGG + Intergenic
984240629 4:177215196-177215218 TGTGGTGCAAAATAGTTTCATGG - Intergenic
986802168 5:11272876-11272898 GGTGGTCCAGATTTGTCCCATGG - Intronic
992847944 5:80773052-80773074 TGTGGTCCAAACTGTTCCCAAGG + Intronic
998906894 5:146914835-146914857 TGTGGTACAATTTAGGGCCAGGG + Intronic
1003575306 6:7287962-7287984 TGAAGTTCAAATTAGTGCCTCGG - Exonic
1005327430 6:24716569-24716591 TATTGTCCAAAATAGTGCTATGG - Intronic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1007514754 6:42402189-42402211 TATGGTCCCAAGTAGTACCAAGG - Intronic
1008158641 6:48049281-48049303 TCTGGCCCCAAATAGTGCCAAGG + Intronic
1016870412 6:148810610-148810632 TGGGGTCAAAATAAGTACCAGGG + Intronic
1017082684 6:150684201-150684223 TGAGGTCTAAGATAGTGCCAGGG - Intronic
1022830331 7:34059457-34059479 TGTGGACCACATTTGGGCCAGGG + Intronic
1034279298 7:149841144-149841166 TGTGTTGCAAATGAGTGACAAGG + Intronic
1037099967 8:15032725-15032747 TGGGGGCCAAAGTAGTGCCAAGG - Intronic
1037876224 8:22550026-22550048 TGTGGTCCTTCTTAGTCCCAAGG + Intronic
1040462648 8:47663490-47663512 TGTGCTCCAAAATAGTGCCTTGG - Intronic
1041178743 8:55226043-55226065 TGTGGTCCACATGAATGCCTGGG + Intronic
1041963174 8:63643545-63643567 TGTGATCCAAATCAGATCCAGGG - Intergenic
1042649609 8:71024676-71024698 TGTGGTCCACATTCTTACCATGG - Intergenic
1044716143 8:95101555-95101577 TGATGACCAAATTAGGGCCAAGG - Intronic
1048166056 8:132062382-132062404 TGTGGTTCACAGGAGTGCCAGGG + Intronic
1050620136 9:7443535-7443557 TGTGGACCAAATTAGACTCATGG - Intergenic
1055719773 9:79159316-79159338 TATTTTCTAAATTAGTGCCAGGG + Intergenic
1059644600 9:116252103-116252125 TGTGTTTTAAATTAGTACCAGGG + Intronic
1189676553 X:43466744-43466766 TGTGGTCTCAATTACTGGCAAGG + Intergenic
1190022298 X:46890328-46890350 TGTGGTACAGCCTAGTGCCATGG + Exonic
1194769490 X:97883922-97883944 AGTGGTTCTAATTAGTGCCTAGG - Intergenic
1195343988 X:103930207-103930229 TGTGGGCCAAAGTATGGCCATGG - Intronic
1196866014 X:120072025-120072047 TGTGTTTCAAGTTACTGCCAGGG - Intergenic
1196877082 X:120164256-120164278 TGTGTTTCAAGTTACTGCCAGGG + Intergenic
1199768993 X:150961885-150961907 TGTGGTCCTAACTTGTGCCCTGG - Intergenic
1200776095 Y:7171574-7171596 TGTGGGTCAAATTTGTCCCAAGG - Intergenic