ID: 1163135302

View in Genome Browser
Species Human (GRCh38)
Location 19:15306614-15306636
Sequence CTTTCATCTGAACACTTTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 4, 3: 33, 4: 274}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163135296_1163135302 26 Left 1163135296 19:15306565-15306587 CCTGGCCATTTTTAGCTTCTGAC 0: 1
1: 0
2: 5
3: 19
4: 210
Right 1163135302 19:15306614-15306636 CTTTCATCTGAACACTTTAAAGG 0: 1
1: 0
2: 4
3: 33
4: 274
1163135298_1163135302 21 Left 1163135298 19:15306570-15306592 CCATTTTTAGCTTCTGACTTGGT 0: 1
1: 1
2: 0
3: 17
4: 270
Right 1163135302 19:15306614-15306636 CTTTCATCTGAACACTTTAAAGG 0: 1
1: 0
2: 4
3: 33
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163135302 Original CRISPR CTTTCATCTGAACACTTTAA AGG Intronic
904013941 1:27406175-27406197 CTTTCATCAGAACCCTAAAATGG - Exonic
905106023 1:35564092-35564114 CTTTCTTCTGAAGACTTTTAAGG + Intronic
905599955 1:39241316-39241338 CTTTCCTCTAAACAATTAAAAGG - Intronic
905965155 1:42086692-42086714 CTTTCTTCTGAAACCTTTATAGG - Intergenic
906534669 1:46544810-46544832 CTTTCAGCTGAACTCTTCCAGGG - Intergenic
907115518 1:51964923-51964945 CTTACATCTTAACACTTAACAGG - Intronic
907192324 1:52659813-52659835 CTTTTCTCTGAACACTTTCAAGG + Intronic
907652380 1:56307650-56307672 CTTTTATTTGAACACTTAAGAGG - Intergenic
908151794 1:61310324-61310346 CTTCCATCTGATCACATTACTGG + Intronic
909188223 1:72516987-72517009 GTTTTATCTGAACAGTTTTATGG - Intergenic
909361532 1:74765282-74765304 ATTTCATGTGTACACTTTATAGG + Exonic
909572577 1:77133758-77133780 CTTTCAACTGAAAACCTTGAAGG - Intronic
910537640 1:88317428-88317450 CTTTTATCTGAACAGTCCAAAGG - Intergenic
911716459 1:101139005-101139027 GTTTCATCTGAACCCATAAATGG - Intergenic
912176144 1:107159897-107159919 CATTTATATGAACACGTTAATGG - Intronic
915695138 1:157732903-157732925 CTTTCACTTGAACACTTAAAGGG - Intergenic
916291075 1:163166783-163166805 TTTTAATCTCAACAGTTTAAGGG + Intronic
917340468 1:173972002-173972024 TTTTCATCTAAAAACTTTGAGGG + Intronic
918678968 1:187327247-187327269 CTTATATGTGAACAATTTAAGGG + Intergenic
921272397 1:213484328-213484350 CAGTCATCTGAAGGCTTTAATGG + Intergenic
921370978 1:214423033-214423055 CTGTCATCTCAGCACTTTGAGGG + Intronic
923481259 1:234386505-234386527 CTTTCACTTGAACACTTTAGAGG + Intergenic
923871161 1:237995531-237995553 CTGTAATCTCAACACTTTGAGGG - Intergenic
924929388 1:248714228-248714250 CTTTGTTCTGAATTCTTTAAAGG - Intergenic
1063716333 10:8530528-8530550 CTATAATCCCAACACTTTAAGGG - Intergenic
1063747485 10:8901416-8901438 CTTTCATCTCAATTCTTAAAAGG - Intergenic
1063925725 10:10975389-10975411 CTGTAATCTCAACACTTTGAGGG - Intergenic
1064646287 10:17463425-17463447 CTTTCCTCTGAAAACTTCAATGG + Intergenic
1065129408 10:22605312-22605334 CTCTCATGTGAAGAGTTTAACGG + Intronic
1065511696 10:26485793-26485815 CTGTCATGCTAACACTTTAATGG - Intronic
1066319730 10:34289542-34289564 CATTTATCTCAACATTTTAAAGG - Intronic
1067734112 10:48835949-48835971 CTTCCATCTGCATTCTTTAAGGG - Intronic
1068660436 10:59617585-59617607 CTTTCATCACATCACATTAAAGG + Intergenic
1069158941 10:65066519-65066541 CTTTCTTCTTAACACTTTAATGG + Intergenic
1072059242 10:91793293-91793315 CTATAATCTGAACATTTTAGAGG + Intergenic
1072141424 10:92592285-92592307 CTGTAATCCCAACACTTTAACGG - Intergenic
1073911102 10:108345769-108345791 AAGTCATGTGAACACTTTAAAGG + Intergenic
1074073972 10:110103393-110103415 CTGTCATTTGAACACTTTACTGG + Intronic
1074542844 10:114379708-114379730 CTTACATGTGAACACTTCCAGGG + Intronic
1074780711 10:116800148-116800170 CTTTCACCTGAACCCTGTATTGG - Intergenic
1075186133 10:120259646-120259668 TTTTCACTTGAACACTTAAAAGG + Intergenic
1077624338 11:3757179-3757201 TTTTTATCTGAACACTATAAGGG - Intronic
1079454833 11:20627219-20627241 TTTTTACCTGAACCCTTTAAGGG + Intronic
1079677027 11:23241775-23241797 TTTTCATCTGATCATTTTAATGG - Intergenic
1080916244 11:36663304-36663326 ATTTCATTCGAAGACTTTAAGGG - Intergenic
1081326853 11:41755327-41755349 TGTTCATCTGAAAACTTTGAAGG + Intergenic
1082562081 11:54629950-54629972 ATTTTATCTCAACATTTTAAGGG - Intergenic
1082826770 11:57585609-57585631 CTTTCATCTGAATAAGTGAAAGG - Intergenic
1083247776 11:61443010-61443032 CTGTAATCCCAACACTTTAAGGG - Intronic
1084137724 11:67199280-67199302 CTTTCACTTGAACACTTAAGAGG - Intronic
1087952233 11:104236801-104236823 TACTCATCTGAACACTTAAAGGG + Intergenic
1089763218 11:120744013-120744035 CTTTCAGCTGCACACCTTAGAGG - Intronic
1089930885 11:122310311-122310333 CTTTAATATGAAAAATTTAAAGG - Intergenic
1090957694 11:131528009-131528031 TTCTCATCTGAAAACTTGAAGGG - Intronic
1094630849 12:32172409-32172431 CTCTGATCTTAACACTTTGATGG + Intronic
1095127837 12:38503125-38503147 CTTACATCAGAAGAATTTAAGGG + Intergenic
1095728749 12:45481310-45481332 CTTTCATCTGTACACATTAATGG - Intergenic
1096349808 12:50887620-50887642 ATTTCATGTGAACATTTTATGGG + Exonic
1100618743 12:96251430-96251452 CTTTCTCTTGAACACTTTATAGG - Intronic
1102685824 12:114723763-114723785 CTATAATCTGAGCACTTTAGGGG + Intergenic
1103126394 12:118426362-118426384 GTTTCATCTGAAGGCTTGAATGG - Intergenic
1103232036 12:119339525-119339547 CTATAATCTGAACACTTTGGGGG + Intronic
1104034425 12:125088588-125088610 ATTTAATCTGTACACTTTTAAGG + Intronic
1104765045 12:131324785-131324807 CTTTGTTCTGAATTCTTTAAAGG + Intergenic
1105788488 13:23773011-23773033 TTTTCAAGTGTACACTTTAATGG + Intronic
1109088659 13:58010563-58010585 CTTTCTTCTGAATCCTTTATTGG + Intergenic
1111220170 13:85194530-85194552 CTTTCATTTGAACACTTAAGAGG - Intergenic
1111272330 13:85902938-85902960 CTGTTATCTCAACACTTTGAGGG + Intergenic
1113554979 13:111225870-111225892 CTTTCATTTGAACACTTAAGAGG - Intronic
1114373599 14:22118010-22118032 CTTTCATCAGAGCACTAAAAAGG - Intergenic
1115243571 14:31272745-31272767 CTTTGTTCTGAATTCTTTAAAGG - Intergenic
1115354671 14:32434700-32434722 CTTGGATCTTAACACTTAAATGG + Intronic
1115839513 14:37452142-37452164 TTTTCATCTCAAATCTTTAATGG - Intronic
1115912467 14:38271557-38271579 CTTCCATGTAAACACTTTAATGG + Intergenic
1116970463 14:51059363-51059385 CTATCATCTGTATATTTTAAGGG - Intronic
1117264756 14:54075606-54075628 AATTCATCTGAATCCTTTAATGG - Intergenic
1117910051 14:60628250-60628272 ATTTCATATTAACACTTTTATGG + Intergenic
1118031384 14:61821470-61821492 CTTTCATCTGAAGGCTTGAGTGG + Intergenic
1118519587 14:66567368-66567390 CTTTCATCTGAAGTCTTCCAGGG + Intronic
1118527030 14:66656894-66656916 CTTTCACTTTAACACTTAAAGGG - Intronic
1121126238 14:91408506-91408528 CTTTCATGTGAACCCTTTGTTGG - Intronic
1125134474 15:36325896-36325918 TTTTAATCTGAACAATATAATGG + Intergenic
1125267957 15:37905419-37905441 CTATAAACTGAACAATTTAAAGG - Intergenic
1125496828 15:40203889-40203911 GTTTAATCTGAAGACTTTTAAGG + Intronic
1126530742 15:49708283-49708305 ATTTCCTCTGCCCACTTTAATGG + Intergenic
1126975227 15:54170610-54170632 ATTTCATTTGAACAGGTTAAAGG + Intronic
1127633668 15:60849363-60849385 ATATCATCTGAAAACTTTTAGGG + Intronic
1128145938 15:65332584-65332606 CTTTCATTTGGACAGGTTAACGG + Intronic
1128722590 15:69961671-69961693 CTTTCACTTGAACACTTAGAGGG - Intergenic
1129275702 15:74443840-74443862 CTGTAATCTCAACACTTTAGGGG + Intergenic
1129628730 15:77234122-77234144 CTGTAATCTCAACACTTTGAGGG - Intronic
1130900231 15:88201455-88201477 CTTGCATCTGAATTCTATAATGG + Intronic
1133246221 16:4450607-4450629 CTTTCAACTGCACATTTTAAAGG - Intronic
1133479618 16:6157201-6157223 CTTTTATTTGTACACTTTAAAGG - Intronic
1135173921 16:20211180-20211202 CTTACATCTGAACAATTACATGG + Intergenic
1135529926 16:23244483-23244505 CTGTCATCTGAAGACTTGACTGG - Intergenic
1136619289 16:31417330-31417352 CTGTAATCTCAGCACTTTAAGGG - Intronic
1137620317 16:49872114-49872136 CCTTCATAAAAACACTTTAAGGG + Intergenic
1138144404 16:54595794-54595816 CTCTCATCTGAACACCTTCAAGG + Intergenic
1138284317 16:55796766-55796788 TTTTCGTTTGAATACTTTAAAGG - Intergenic
1138284685 16:55800221-55800243 TTTTCGTTTGAATACTTTAAAGG + Intergenic
1140176525 16:72665578-72665600 ATTTCATCTGAACCAGTTAATGG + Intergenic
1140922021 16:79547682-79547704 CTTGGATCTGAAGTCTTTAAAGG + Intergenic
1143574478 17:7782707-7782729 CTGTCATCTCAACACTTTGGAGG + Intronic
1143970938 17:10795195-10795217 CTTTCATTTGATGACCTTAAGGG - Intergenic
1144007353 17:11113228-11113250 CATTGATCTGAATACATTAAAGG - Intergenic
1144395580 17:14839548-14839570 CTATCATGAGAACACTGTAAGGG - Intergenic
1144526793 17:15997361-15997383 CGTTCATCTGAACATCTTGAGGG + Intronic
1145285255 17:21500943-21500965 CTGTAATCTCAACACTTTGAGGG - Intergenic
1145392268 17:22464803-22464825 CTGTAATCTCAACACTTTGAGGG + Intergenic
1145726676 17:27133964-27133986 CTTTCACTTGACAACTTTAAAGG + Intergenic
1146660436 17:34662086-34662108 CTTTCATCTGAAAACTGAGATGG + Intergenic
1147515116 17:41108791-41108813 CTTTGTTCTGAATTCTTTAAGGG - Intergenic
1148012729 17:44497330-44497352 CTGTAATCTCAACACTTTGAGGG + Intronic
1148572966 17:48685279-48685301 CTATAATCTGAGCACTTTGAGGG - Intergenic
1150962504 17:69929909-69929931 TTTCTATCTGAACACTTAAAGGG - Intergenic
1150964717 17:69955031-69955053 CTTTCAGCTGAAAACTGCAAAGG - Intergenic
1152943867 17:83187925-83187947 CATTCATCTGAAGTCTTCAAAGG - Intergenic
1153218265 18:2839868-2839890 CTGTAATCTCAACACTTTAGGGG - Intergenic
1153712296 18:7811826-7811848 CTATATTCTGAACACTTGAAAGG + Intronic
1155336145 18:24767297-24767319 CCTTCTTCCAAACACTTTAATGG - Intergenic
1156768898 18:40695464-40695486 CTTTCCCCTGAACACTTAAAGGG - Intergenic
1157081617 18:44531731-44531753 CTTTCCTCTGAACACTAGAGAGG + Intergenic
1157789270 18:50516917-50516939 TTTTCATCTGAGCACAATAATGG + Intergenic
1158910873 18:62060962-62060984 CTGTCAGCTGAACAGTTTTATGG + Intronic
1159541351 18:69781129-69781151 GTTTCCTCTGAAAAATTTAAAGG - Intronic
1161185177 19:2913200-2913222 CTGTCATCTCAGCACTTTAGAGG - Intronic
1163135302 19:15306614-15306636 CTTTCATCTGAACACTTTAAAGG + Intronic
1163832493 19:19553835-19553857 CTTTCATCTTAAAACTATGAGGG + Intergenic
1165503173 19:36206349-36206371 CTGTCATCTCAGCACTTTGAGGG + Intronic
926108132 2:10165262-10165284 CCTTCATCGGAACACTTGCAGGG + Intronic
926759535 2:16265628-16265650 CTTTCACTTGGATACTTTAAAGG + Intergenic
926909374 2:17836321-17836343 CTTTATTTTGCACACTTTAATGG - Intergenic
927628492 2:24749386-24749408 CTCTCAGCTGAAGACTTGAATGG - Intronic
927749112 2:25650621-25650643 CTTGCTTCTCATCACTTTAATGG - Intronic
929596959 2:43182043-43182065 CTGTAATCTGAGCACTTTAGGGG + Intergenic
929715992 2:44310148-44310170 CTGTAATCCTAACACTTTAAGGG - Intronic
929991403 2:46792257-46792279 CTATCAATTGAAGACTTTAATGG + Intergenic
930394113 2:50798109-50798131 CTTTCAAGTGAACAGTTTATTGG - Intronic
930486757 2:52019877-52019899 CTTTCACCTGAACATTATATTGG - Intergenic
930567915 2:53046678-53046700 CTTTTTTCTGAATATTTTAATGG - Intergenic
930695887 2:54411376-54411398 CTTACATCTGAACTCTTAAAAGG + Intergenic
930857831 2:56038334-56038356 CTTTTGCCTGAACACTTTATAGG - Intergenic
931851667 2:66257855-66257877 ATTTCTTCTGAAAACTTTCAGGG + Intergenic
932129051 2:69170880-69170902 CTTGCATCAGAACAGTTTACTGG - Intronic
933858781 2:86443319-86443341 TGTTCATTTGAACACTTTCAGGG + Intronic
934108808 2:88722822-88722844 CTTTGTTCTGAATTCTTTAAAGG + Intronic
935161894 2:100536601-100536623 CTTTGATCTCAGCACTTTGAGGG - Intergenic
936675171 2:114706415-114706437 GTTTCTTCTGAAGACTCTAAAGG + Intronic
937579504 2:123467171-123467193 CTTTGTTCTGAATTCTTTAAAGG - Intergenic
938051134 2:128172920-128172942 CTCTCAACTGTACACGTTAATGG - Intronic
938681955 2:133701228-133701250 CTTTCACTTGAACACTTAAAGGG - Intergenic
941100788 2:161292902-161292924 CTTTCATCTTTTCACTTAAAAGG - Intergenic
941275675 2:163487830-163487852 CTTTCATGTGAACAATTGAATGG - Intergenic
942251750 2:174053398-174053420 CTTTCATCTCAGCCCTTCAAGGG - Intergenic
943307844 2:186288316-186288338 CATTGATTTGAAAACTTTAAAGG - Intergenic
943506484 2:188766571-188766593 CTTTGTTCTGAAATCTTTAAGGG + Intronic
943935464 2:193909734-193909756 CTTTCACTTGAAAACTTAAAGGG - Intergenic
944900417 2:204208148-204208170 ATTTAATCCCAACACTTTAATGG + Intergenic
945249313 2:207750617-207750639 CTTTCATCTGATCACTATAGTGG + Intronic
945330403 2:208533035-208533057 CTTTTACTTGAACACTTTAGAGG - Intronic
945920119 2:215747236-215747258 CTTTCAATGGAACACTTTTAAGG - Intergenic
946816219 2:223581277-223581299 CTTTCATCTGAGGATTTCAAAGG - Intergenic
947090499 2:226505529-226505551 TTTTCATATGAACAGGTTAAAGG + Intergenic
1169090472 20:2858362-2858384 CTGTAATCTGAGCACTTTAGGGG - Intronic
1169248928 20:4045691-4045713 CTTACATCTGAGAACTTTCATGG + Intergenic
1170411629 20:16098174-16098196 CTTTCATCTTAAAATTTTAGAGG - Intergenic
1170682792 20:18541499-18541521 CTTTCACTTGAACACTTAGAGGG + Intronic
1173730794 20:45327116-45327138 GTCTCTTCTGAACACTTCAAAGG + Exonic
1174688190 20:52475984-52476006 CTTTAAATTGAACTCTTTAAAGG + Intergenic
1174933377 20:54840909-54840931 CTTTCAACTGAATATTTTACAGG - Intergenic
1175505579 20:59482082-59482104 ATTTCATCTGAAAGCTTTAGAGG + Intergenic
1178484954 21:33013238-33013260 ATTTCCTCTGAAGGCTTTAATGG + Intergenic
1178881694 21:36455096-36455118 TTTTCATCTGTGCACTGTAAGGG - Intergenic
1179235478 21:39541632-39541654 CTTTGATTTGAAATCTTTAATGG + Intergenic
1185138227 22:49085838-49085860 CTTTAAAGTGAACACTTTCATGG + Intergenic
949203801 3:1413626-1413648 CTTTTTTCTGAACATCTTAAAGG - Intergenic
949411856 3:3774257-3774279 CTTTCACTTGAACACTTAGAGGG - Intronic
949620870 3:5810210-5810232 TTTTGCTCTGAACTCTTTAAGGG + Intergenic
950635902 3:14314367-14314389 CATTGAACTGTACACTTTAAAGG - Intergenic
950777526 3:15363458-15363480 CTGTAATCCCAACACTTTAAGGG - Intergenic
952084200 3:29797933-29797955 CTTTCACCTGAACAACTTAGAGG + Intronic
953559798 3:43978423-43978445 CTTTCATCTGAACAACTCAGTGG - Intergenic
954508479 3:51100065-51100087 CTGTCATCTGGTCACTGTAAAGG - Intronic
954587836 3:51752128-51752150 CTTTGTTCTGAATTCTTTAAAGG + Intergenic
954862826 3:53704510-53704532 CTTACATCTGATCACTTCATAGG - Intronic
955064043 3:55519549-55519571 CTATTATCTGGACACTTTCATGG - Intronic
955593547 3:60563407-60563429 CTTTCACTTGAACACTTAAAAGG - Intronic
957328849 3:78733253-78733275 TTTTAATCTGATCACTTTACAGG - Intronic
957874635 3:86129707-86129729 GTTTCATCTGAAGACTTCAGGGG + Intergenic
958050981 3:88345799-88345821 CTTTCATTTGAACACTTTAGAGG - Intergenic
958091945 3:88887759-88887781 ATTTGATTTGAACACTTTACAGG - Intergenic
958425528 3:93974397-93974419 CTTTCAACTGAAGTCTTTATCGG - Intergenic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
961733173 3:128982693-128982715 CTTTCACTTGAACACTTTAGAGG + Intronic
961969765 3:130949067-130949089 CTTTCACTTGAACACTTAAGAGG - Intronic
962270247 3:133972715-133972737 ATTTCTTCTCAACACTTTGAAGG - Intronic
963549991 3:146707840-146707862 CTTTCATTTGGACACTTAGAGGG + Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964023242 3:152040692-152040714 CTTTGTTCTGAATTCTTTAAAGG + Intergenic
964611685 3:158622142-158622164 CTTTGTTCTGAATTCTTTAAAGG + Intergenic
968266052 3:197364277-197364299 CTTCTGTCTGAGCACTTTAAAGG - Intergenic
968294296 3:197561950-197561972 CTTTGTTCTGAATTCTTTAAAGG - Intronic
968580699 4:1392146-1392168 AGTTCATCTGAACACTTGATTGG - Exonic
969727228 4:8927737-8927759 CTTTGTTCTGAATTCTTTAAAGG - Intergenic
970141053 4:12982681-12982703 GTTTCTTCTGGAAACTTTAAGGG + Intergenic
970854483 4:20636538-20636560 CTTTGTTCTGAACTCTTTAAAGG + Intergenic
970921293 4:21398334-21398356 CTTTAATCTGAAAATTTCAAAGG + Intronic
971564876 4:28125422-28125444 CTTTCATCTGAACACTTAGAAGG + Intergenic
971775128 4:30953546-30953568 ATTTCATTTGAACACCTTCAAGG + Intronic
971977850 4:33713831-33713853 TTTTCATATGAACACTTCATAGG + Intergenic
974278680 4:59760574-59760596 CTATAATCTCAGCACTTTAAGGG - Intergenic
974660926 4:64887861-64887883 CTTTCACTTGAACACTTAACAGG + Intergenic
975656472 4:76646002-76646024 CTTCCATCTGAACACAGTCAAGG + Intronic
975863269 4:78700540-78700562 CTCACACCTGAACACTTTGAGGG + Intergenic
976183868 4:82426349-82426371 CTTAACTCCGAACACTTTAATGG + Intronic
977280515 4:95034000-95034022 CTTTCAGCTGAAAAATTTGATGG - Intronic
978501494 4:109414829-109414851 CTTTGATCTCAAAGCTTTAAAGG + Intergenic
980071945 4:128252882-128252904 CTTTGTTCTGAATTCTTTAAAGG + Intergenic
980822285 4:138033610-138033632 CTTTCAACAGATTACTTTAAGGG - Intergenic
985826266 5:2193853-2193875 TTTTCAATTGAACACTGTAAAGG - Intergenic
985835326 5:2267310-2267332 CTTACATATGAAGACATTAATGG + Intergenic
990819989 5:59827844-59827866 TTTTCATATGTACATTTTAATGG - Intronic
991057610 5:62336712-62336734 CATTCATCTTAAGAATTTAAGGG + Intronic
991153707 5:63403326-63403348 CATTCAGCTGAAGACTTTACAGG - Intergenic
991596552 5:68312682-68312704 CTGTCATCTGAAGGCTTGAATGG - Intergenic
993713683 5:91253237-91253259 CTGTAATCCGAACACTTTAGGGG + Intergenic
995843796 5:116471224-116471246 CTTCCGTGTTAACACTTTAAGGG - Intronic
996555370 5:124772943-124772965 CTTTCATCTGAAGACCTCAAAGG - Intergenic
998279519 5:140792113-140792135 ATTTCTTCTGAAGACTTTAGGGG + Intronic
998863670 5:146472656-146472678 CTTTCACTTGAACACTTTGAGGG - Intronic
1000456908 5:161460701-161460723 CTTTCATCTCAGCACCTCAATGG - Intronic
1002668076 5:180841591-180841613 CTTCCATCTGAACACTTGAGTGG - Intergenic
1003598754 6:7499280-7499302 CTTTCACTTGAACACTTAAGAGG + Intergenic
1003924651 6:10865746-10865768 CTTTGATGTGTATACTTTAAAGG + Intronic
1004801935 6:19157973-19157995 CTTTCCTGTGAACCCTTTAGTGG + Intergenic
1008201350 6:48594360-48594382 CTTTTATTTTAACACATTAAGGG + Intergenic
1008220161 6:48845031-48845053 CCTCCACCTGAACACTTTAGTGG - Intergenic
1010395379 6:75386220-75386242 CTTTCATCTGACCACTTGCTTGG - Intronic
1010396486 6:75398582-75398604 CTCTCTTCTGAACAGTTTCAGGG - Intronic
1010748545 6:79592135-79592157 CATTAATATGAACACATTAAGGG + Intergenic
1011939630 6:92826680-92826702 CTTTGTTCTGAACTCTTTAAAGG - Intergenic
1012250205 6:96971716-96971738 TTTCCACCTGAACACTGTAACGG - Intronic
1013041856 6:106442774-106442796 CTCTCATCTCATCTCTTTAAGGG - Intergenic
1015329214 6:131957592-131957614 ATTTTATCTGAACAATTTAGCGG + Intergenic
1015525287 6:134170256-134170278 CTTTCCTCTGAACCCTGTTAGGG - Exonic
1015648278 6:135420961-135420983 CTTTCACTTGAATACTTAAAAGG + Intronic
1015930964 6:138359613-138359635 CTTTCATCAGACCAATTTCAGGG + Intergenic
1016166511 6:140952037-140952059 CTTTCATCAGAAAACCTAAAGGG + Intergenic
1016274369 6:142331295-142331317 CTTTGAACTATACACTTTAAAGG - Intronic
1016625382 6:146160954-146160976 CTTTCTTATGAACATTTTATTGG - Intronic
1016831849 6:148442084-148442106 CTTTCTTTTGAAAACTTTTATGG + Intronic
1020423820 7:8040935-8040957 CATTCATTTGAACACTTAAGAGG - Intronic
1021701956 7:23328167-23328189 CTATCATCTTAAATCTTTAAAGG + Intronic
1022144992 7:27528271-27528293 TTTTCATTTGAACACTTAAGAGG - Intronic
1022361086 7:29658432-29658454 ATGACATCTGAACATTTTAAAGG + Intergenic
1024605105 7:51016638-51016660 CTTTGATCTGAACTCTTGACAGG + Exonic
1024723367 7:52163957-52163979 CTTTCATGTGAAAACTATGATGG - Intergenic
1025774440 7:64547373-64547395 GTTTCCTCTGTAGACTTTAAAGG - Intronic
1026057900 7:67000694-67000716 CTATCATCTCAGCACTTTGAGGG - Intronic
1026380471 7:69794285-69794307 CTTTCATCAGAGCACCCTAAAGG + Intronic
1026720199 7:72824341-72824363 CTATCATCTCAGCACTTTGAGGG + Intronic
1027678817 7:81193015-81193037 CTTTCATCTGTTCCATTTAATGG - Intronic
1029378110 7:100194299-100194321 CTTTCATTTGGACACTTAAAAGG + Intronic
1029929775 7:104358498-104358520 CTTACATCTCAACTCTGTAAGGG - Intronic
1030079237 7:105762995-105763017 CTTTCATCTGAAGGCTTAACTGG - Intronic
1030469212 7:109941642-109941664 CTTTCAACAGATCACTTTAAGGG + Intergenic
1030782879 7:113623710-113623732 CTTTGTTCTGAATTCTTTAAAGG + Intergenic
1031735875 7:125360812-125360834 CTTTCACTTGATCACTTAAAGGG + Intergenic
1032465220 7:132140240-132140262 CTGTCATCATAACACTTCAAGGG - Intronic
1033140891 7:138825380-138825402 CTTTCACTTGAACACTTCAGAGG - Intronic
1033319594 7:140327619-140327641 CTTTCATCTGAGGACTTCAAAGG - Intronic
1038297573 8:26309677-26309699 CTTTCACTTGAACACTTAAGAGG + Intronic
1038810593 8:30837855-30837877 GTTTCATCTGATCACTTCAGTGG - Exonic
1039983861 8:42431042-42431064 CTTTCAGTTGAACACTTAGAGGG - Intronic
1040441279 8:47445522-47445544 CTTTCATGTGAACACTTAGAGGG - Intronic
1041399183 8:57423405-57423427 CTTTCATCTAAAGACTTTCCTGG + Intergenic
1042674737 8:71307283-71307305 ATTTTATCTGAACACTTTGCTGG + Intronic
1043173132 8:76990540-76990562 CTTTCACTTGAACACTTAAGAGG + Intronic
1045316123 8:101045120-101045142 TTTTCATGAGAACATTTTAATGG + Intergenic
1046155561 8:110285611-110285633 GATTAATCTGAACTCTTTAAAGG + Intergenic
1046594292 8:116242354-116242376 CCTTCATCAGAATACTTGAAGGG - Intergenic
1047477023 8:125242442-125242464 ATTTCATTTGGACACTTTAGAGG - Intronic
1051114673 9:13681079-13681101 CTTTCATTTGAACGCTTAACAGG + Intergenic
1052476547 9:28968075-28968097 CTTTTATCTGAACTTTATAATGG + Intergenic
1055933747 9:81585905-81585927 CATTCATCTGTACATTTTAAAGG + Intronic
1056934965 9:90909476-90909498 GTTACTTTTGAACACTTTAACGG + Intergenic
1057467742 9:95331044-95331066 CTTTGTTCTGAATTCTTTAAAGG + Intergenic
1057910145 9:99013808-99013830 CTTTGTTCTGAATACTTTAAGGG + Intronic
1058996994 9:110308779-110308801 CTTTGCTCTGAATTCTTTAAAGG - Intronic
1059787400 9:117600249-117600271 CCTTCAGCTGAATAATTTAATGG + Intergenic
1059967373 9:119628523-119628545 CTTTCATCTGAAGGCTTGATAGG + Intergenic
1186353982 X:8770878-8770900 TTTTTTTCTGGACACTTTAAGGG + Intergenic
1187139357 X:16577683-16577705 CTTTGTTCTGAATTCTTTAAAGG - Intergenic
1187694117 X:21901253-21901275 CTTTCATCTGAACATAGTCAGGG + Intergenic
1187800418 X:23056124-23056146 CTTTCACTTGAACACTTAAGAGG - Intergenic
1188422185 X:30003667-30003689 GTTTCATTTGAAAATTTTAAAGG - Intergenic
1188736599 X:33725500-33725522 CTATCTTCTGAACACTTTGCTGG + Intergenic
1189691801 X:43624538-43624560 CTTTGTTCTGAATTCTTTAAAGG + Intergenic
1190896269 X:54621416-54621438 CAGTCATCTGAAAACTTTACTGG - Intergenic
1191042518 X:56099441-56099463 CTTTCACTTGAACACTTAGAGGG - Intergenic
1191798252 X:65046811-65046833 CTTTCACTTGAACACTTAAAAGG + Intergenic
1193835669 X:86340563-86340585 CTTTCACTTGAACACTTAGAGGG - Intronic
1194869476 X:99110601-99110623 CTTTCATCTGAAACCTTGACTGG + Intergenic
1195990570 X:110678339-110678361 CTTACATTTGAACATTTTACTGG + Intronic
1196306089 X:114104855-114104877 CTATCATTTGAGCACTTTACAGG + Intergenic
1197101991 X:122667211-122667233 ATTTTATCTGGAAACTTTAATGG + Intergenic
1197134075 X:123040800-123040822 CTTTCATCTAAAGATTATAAAGG + Intergenic
1197800058 X:130339340-130339362 CTGTAATCTCAACACTTTGAGGG - Intergenic
1198034270 X:132785332-132785354 CTGTCTTCTGAACACTTCCAAGG - Intronic
1198408521 X:136340935-136340957 CTTGCATCTGAAAGATTTAATGG + Intronic
1200913662 Y:8552715-8552737 TTTTTTTCTGAACATTTTAATGG + Intergenic