ID: 1163137171

View in Genome Browser
Species Human (GRCh38)
Location 19:15320672-15320694
Sequence GTCTCAGGAGTTACTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163137171_1163137179 20 Left 1163137171 19:15320672-15320694 CCCACCCAAGTAACTCCTGAGAC 0: 1
1: 0
2: 0
3: 9
4: 126
Right 1163137179 19:15320715-15320737 GCTCCTTCTATGCCTGACACAGG 0: 1
1: 0
2: 0
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163137171 Original CRISPR GTCTCAGGAGTTACTTGGGT GGG (reversed) Intronic
900716529 1:4148634-4148656 GTCCAAGGAGTTGCTTGGCTGGG + Intergenic
905118745 1:35665331-35665353 GTCTCCTGAGTAACTTTGGTGGG + Intergenic
906431476 1:45759191-45759213 GTCTCAGGAGTTAAAGGGGAGGG - Intergenic
908399378 1:63756071-63756093 GACTCAGGAGTTTCCTGGGAGGG - Intergenic
911334700 1:96568266-96568288 GTCTCAGGAGCTACTTCTGTGGG - Intergenic
916215463 1:162389747-162389769 GTCACAGGAGTGCTTTGGGTTGG + Intergenic
918190031 1:182164781-182164803 ATCTCAGGGGTCACTTGGATTGG + Intergenic
920667699 1:207976730-207976752 TTCTCAAGAGTTACTTGGATTGG + Intergenic
921055135 1:211537669-211537691 GTCTCTGGAGGTACTGGTGTGGG - Intergenic
1065209713 10:23390870-23390892 ATCTCAGGAGTTAGGTGAGTGGG - Intergenic
1066084466 10:31962888-31962910 ATCTCAGGAGTTCAGTGGGTGGG - Intergenic
1067036910 10:42927624-42927646 GTTTCAGGTGTTCCCTGGGTAGG - Intergenic
1069356201 10:67588379-67588401 GTCTCTGGTATTGCTTGGGTGGG + Intronic
1069935530 10:71913170-71913192 ATCTCAGGAGTTAGGTGAGTGGG - Intergenic
1071155016 10:82678097-82678119 ATCTCAGGAGTTATGTGTGTGGG - Intronic
1071954846 10:90746524-90746546 TTCTCAGGAGTAACATGGGAAGG - Intronic
1074330619 10:112504274-112504296 GTAACAGTAGTTACCTGGGTTGG - Intronic
1079185413 11:18231754-18231776 CTCTCAGTCATTACTTGGGTGGG - Intronic
1079336593 11:19575592-19575614 GTCTGAGGAGGTACTTGCATAGG - Intronic
1080442922 11:32311959-32311981 TTCTCAGCTGCTACTTGGGTTGG - Intergenic
1088796174 11:113268516-113268538 GTCTCAGGAGTCATTTGTGAGGG + Intronic
1089659894 11:119978909-119978931 GTCTCAGGAGTCACTGGTGCAGG - Intergenic
1091055488 11:132414465-132414487 ATCTTAGGTTTTACTTGGGTTGG - Intergenic
1093288712 12:17297840-17297862 GTCTCAGGAGGAAGATGGGTGGG + Intergenic
1095371791 12:41476579-41476601 GTTTCAGGTGTTCCTCGGGTAGG - Intronic
1100141102 12:91619909-91619931 TTCTCTGGAGTTACTTGAATGGG - Intergenic
1100758363 12:97777259-97777281 GTCTCAGGAGTTGGGTGAGTGGG + Intergenic
1111788903 13:92827627-92827649 GTCTCAGCAGTAACTCAGGTTGG - Intronic
1112160930 13:96867290-96867312 GAAGCTGGAGTTACTTGGGTTGG - Intergenic
1112641203 13:101277492-101277514 GTCTCAGGAGGCACTTGGTTGGG - Intronic
1123575511 15:21663356-21663378 GGCCCAGGACTTACTTTGGTTGG - Intergenic
1123612131 15:22105828-22105850 GGCCCAGGACTTACTTTGGTTGG - Intergenic
1128789175 15:70420314-70420336 GTCAAAGGAGTTACTTGTGGTGG - Intergenic
1129549435 15:76431885-76431907 GTCACATGAGTTATTTGGTTTGG + Intronic
1131363103 15:91812597-91812619 GTCTTAAGAGTTCTTTGGGTTGG - Intergenic
1131662774 15:94536471-94536493 GTCTCAGGAGTTAACTGAGATGG - Intergenic
1202984379 15_KI270727v1_random:397601-397623 GGCCCAGGACTTACTTTGGTTGG - Intergenic
1138334231 16:56240024-56240046 GCCACAGGAGTTGATTGGGTAGG + Intronic
1140541145 16:75757442-75757464 GTCACAGGAGGTGCTTGGGTAGG + Intronic
1142245529 16:88968472-88968494 GTCTCAGGAGGACCTGGGGTGGG + Intronic
1145888695 17:28399780-28399802 GACACAGGATTTACTGGGGTGGG + Exonic
1147142684 17:38468216-38468238 GTCTCATTAGTCACTGGGGTTGG + Intronic
1147953842 17:44121716-44121738 GTCTCTGCAGCTACTTGGGGTGG + Intronic
1149949867 17:60974045-60974067 GATTCAGCAGTTATTTGGGTAGG - Intronic
1159005026 18:63003838-63003860 GTCCCAGGAGTTCCTTGGACAGG - Intergenic
1160298209 18:77656567-77656589 GTCTCAGGAGACACATGTGTTGG + Intergenic
1160592983 18:79954258-79954280 GGCTCCGGCGTTACTTGGCTTGG - Intergenic
1160776469 19:858864-858886 GTCTCAAGGGTGCCTTGGGTTGG - Intergenic
1163137171 19:15320672-15320694 GTCTCAGGAGTTACTTGGGTGGG - Intronic
1164732004 19:30513474-30513496 GTCACAGGAGTCACCGGGGTTGG - Intronic
1164737708 19:30554013-30554035 GTCTCAGGTATAATTTGGGTTGG - Intronic
1164756300 19:30692205-30692227 GTTTCAGCAGTTTCTTGCGTCGG - Intronic
1165595392 19:37008194-37008216 GCCTCAGGAGTTGCCTGGGGCGG + Intronic
1165799962 19:38543451-38543473 GGTTCAGGTGTGACTTGGGTCGG + Intronic
1167680748 19:50918981-50919003 GTCTCACTAGTTGCTTAGGTTGG + Intergenic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
925608896 2:5686736-5686758 AACTCAGGAGTGACTCGGGTAGG + Intergenic
927052220 2:19341600-19341622 TTCTCAGGCATCACTTGGGTGGG - Intergenic
935292086 2:101619540-101619562 ATCTCAGGAGTTGATTGAGTGGG - Intergenic
935408463 2:102734995-102735017 GTCTCAGAAGGGACTTGGGCTGG - Intronic
937301390 2:120844791-120844813 GTCTCAGGAGCCAGTTGGGTAGG + Intronic
940297210 2:152139676-152139698 GGCTCATGACTTCCTTGGGTGGG - Intronic
941749776 2:169121776-169121798 ATCTATGGAGTTGCTTGGGTAGG - Intergenic
941842763 2:170105438-170105460 ATTTCAGGAGTTGCTTGGCTAGG - Intergenic
942503441 2:176616677-176616699 GTCTCATGAATTAACTGGGTGGG + Intergenic
943686029 2:190819233-190819255 GTCTCAAGTGTTCCTTGGCTTGG - Intergenic
944207548 2:197172387-197172409 GTGTCAGGAAGTACATGGGTAGG - Intronic
947978149 2:234385435-234385457 GCCTTAGGAGTTCCTTGGCTTGG + Intergenic
948241877 2:236444717-236444739 TACACAGGAGTTACTTTGGTGGG + Intronic
948506608 2:238432494-238432516 GTCTGAGGAGTTTCTTAGGCAGG + Intronic
1168894435 20:1313548-1313570 GCCTCAGGAGACACTGGGGTGGG + Intronic
1172917218 20:38452097-38452119 GTGTCAGGTGGTTCTTGGGTAGG - Intergenic
1181327164 22:22058621-22058643 ATCTCAGGAGATACTGGGGAAGG - Intergenic
1181546095 22:23603492-23603514 GTCTCTGGAGGGATTTGGGTAGG - Intergenic
1183637033 22:39070384-39070406 GTCTCAGGATTGACCTGGGAAGG - Intronic
1184752659 22:46497483-46497505 GCCAGAGGAGTTCCTTGGGTTGG + Intronic
1185265499 22:49900509-49900531 TGCTCATGAGTTCCTTGGGTCGG - Exonic
949771885 3:7588028-7588050 GTCTCATGCTTTACTTGGGGAGG - Intronic
960247635 3:115417057-115417079 GTCTCATGAGTTACTTCAGTTGG - Intergenic
962342891 3:134600200-134600222 ATCTCAGGAATTAATTGGTTTGG + Intronic
963615208 3:147528159-147528181 GTTTCTGAAGTTCCTTGGGTTGG + Intergenic
963834742 3:150046746-150046768 GTCTCAGGGATTACTTAGGAGGG - Intronic
968885601 4:3329497-3329519 CTCTCAGGTGTCACTTGGTTTGG - Intronic
969880569 4:10170109-10170131 GTTTCAGCAGTTACTGGGGGGGG + Intergenic
972819462 4:42683124-42683146 GTCCCAGGAGCAACTTGGGGAGG + Intergenic
979386938 4:120077982-120078004 GTCTCAGGAGTTACATAGCAAGG - Intergenic
980302666 4:131014302-131014324 GTCTCTGGCCTTACTTAGGTGGG + Intergenic
986034124 5:3922142-3922164 GTCTCAGGAATGACTTGAGGGGG - Intergenic
986538032 5:8813124-8813146 ATCTCAGGAGTTAGGTGAGTGGG + Intergenic
987320629 5:16766166-16766188 ATCTGCGGAGTTACTTGGGCTGG - Exonic
990450451 5:55928061-55928083 GTCTCAGGATTTGCTTTGGGGGG - Intergenic
991034756 5:62117999-62118021 GTCCCAGAAATTACTTGGGTTGG - Intergenic
991929935 5:71744295-71744317 ATCTCAGGAGTTAGGTGAGTGGG + Intergenic
1004260351 6:14102389-14102411 GTCTCAGGAGGTCCTTGTGAAGG + Intergenic
1005574829 6:27181065-27181087 GTCTCAGGAGTTAAAGGGGAAGG + Intergenic
1006581498 6:35080207-35080229 GTCTCAGGTGTTACCTGACTCGG - Intronic
1008030952 6:46693416-46693438 GTCACGGAAGTTACTTGGTTTGG - Exonic
1013528607 6:110998383-110998405 ATCTCAGGAGTTGGGTGGGTGGG - Intronic
1016712926 6:147194035-147194057 ATCTCAGGAGTTGGTTGAGTGGG + Intergenic
1023546409 7:41322560-41322582 TTTTCAAGATTTACTTGGGTAGG - Intergenic
1024338639 7:48235059-48235081 GTCTCAGGGGTTAGATGGTTGGG + Intronic
1024545482 7:50513820-50513842 GGCTCAGGCTTTCCTTGGGTGGG - Intronic
1024722648 7:52155083-52155105 GTGTCAGGAGTTATTAGTGTTGG + Intergenic
1027206643 7:76105621-76105643 GTCCCAGGAGCTACTTAGGAGGG - Intergenic
1027524463 7:79249663-79249685 GTCTCAGGATTTTCTTTGCTGGG - Intronic
1028833823 7:95352216-95352238 GTCTCAGGAGTTGGGTGAGTGGG + Intergenic
1029681621 7:102115390-102115412 TTCCCATGAGTTACTTGCGTCGG + Intronic
1030738465 7:113079746-113079768 GTTTCACAAGTTACTTGGGAGGG + Intronic
1034070242 7:148177379-148177401 GCCTCAGGAATTCCTTGGCTTGG - Intronic
1036203304 8:6786993-6787015 GCCTTAGGAGATGCTTGGGTGGG + Intergenic
1036432869 8:8706007-8706029 GTCTCAGGAGTTGCTGCTGTGGG + Intergenic
1037326366 8:17695060-17695082 CTGTCAGCAGTAACTTGGGTTGG - Intronic
1039192554 8:34993628-34993650 TTCCCAGAAGTTACTTGAGTTGG + Intergenic
1040483908 8:47852353-47852375 GTCTCAGGATTTCCTTGTGGAGG - Intronic
1041385687 8:57299436-57299458 ATCTTAGGAGTTAGTTGAGTGGG - Intergenic
1041538207 8:58952138-58952160 GTCTCAGAAGACACTGGGGTAGG + Intronic
1041808974 8:61886912-61886934 GTGTCTGGAGTCACTGGGGTTGG + Intergenic
1043752539 8:83957272-83957294 ATCTCAGGATATACTTGAGTTGG - Intergenic
1044845230 8:96373768-96373790 GTCTCAGGAATTTCTTGGAAAGG - Intergenic
1048415760 8:134225965-134225987 TTCTCAGGAGTTAGTTAGGGAGG - Intergenic
1048710922 8:137209547-137209569 GATTCAAGTGTTACTTGGGTGGG - Intergenic
1050334219 9:4575023-4575045 GTCTCAGCAGTGACGTGGCTGGG + Intronic
1052738703 9:32372767-32372789 GACTCAGGAGGTACAGGGGTGGG - Intergenic
1057112283 9:92484737-92484759 GACTGAGGAGTGCCTTGGGTGGG - Intronic
1057626800 9:96685226-96685248 GTATCAGAAGTTACATGGGATGG - Intergenic
1186072838 X:5841406-5841428 ATCTCAGGAGTTGCATGAGTAGG + Intronic
1187168734 X:16829942-16829964 GTCCCAGGAGTCACTGGGTTTGG + Intronic
1187284737 X:17894133-17894155 GACTCAGGAGTGACTTGGTTGGG + Intergenic
1190329249 X:49225776-49225798 GGCTCTGGATTTATTTGGGTAGG + Intronic
1193254781 X:79334868-79334890 GTTTCAGGGGTTACATGTGTAGG + Intergenic
1194504032 X:94710490-94710512 ATCTCTGGCCTTACTTGGGTGGG + Intergenic
1195282593 X:103350406-103350428 GGCTGAGGGGCTACTTGGGTGGG - Intergenic
1195897023 X:109756284-109756306 GTCTCAGGCTTTTCTTAGGTGGG - Intergenic
1197933797 X:131720358-131720380 GTCTCTGGCGTTACTTAGGTGGG - Intergenic
1198944155 X:141991296-141991318 GTCTCAGGAGGTGGTAGGGTAGG - Intergenic
1200801941 Y:7394812-7394834 GTCTCAGGAGTTAAAGGGGAAGG + Intergenic