ID: 1163138736

View in Genome Browser
Species Human (GRCh38)
Location 19:15332225-15332247
Sequence GCTGGCGGAGGCTCGCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163138736_1163138744 5 Left 1163138736 19:15332225-15332247 CCGCGCCGCGAGCCTCCGCCAGC No data
Right 1163138744 19:15332253-15332275 AGTGTCGTCCGCCGCCCCAAAGG No data
1163138736_1163138745 6 Left 1163138736 19:15332225-15332247 CCGCGCCGCGAGCCTCCGCCAGC No data
Right 1163138745 19:15332254-15332276 GTGTCGTCCGCCGCCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163138736 Original CRISPR GCTGGCGGAGGCTCGCGGCG CGG (reversed) Intronic