ID: 1163141779

View in Genome Browser
Species Human (GRCh38)
Location 19:15354438-15354460
Sequence CACCATATGGTGCACTACAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 50}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163141775_1163141779 19 Left 1163141775 19:15354396-15354418 CCACATGTGAACCAGGTGCTGCG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1163141779 19:15354438-15354460 CACCATATGGTGCACTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 50
1163141777_1163141779 -8 Left 1163141777 19:15354423-15354445 CCTGTGAAAGTCACACACCATAT 0: 1
1: 0
2: 1
3: 8
4: 141
Right 1163141779 19:15354438-15354460 CACCATATGGTGCACTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 50
1163141776_1163141779 8 Left 1163141776 19:15354407-15354429 CCAGGTGCTGCGAAGTCCTGTGA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1163141779 19:15354438-15354460 CACCATATGGTGCACTACAAAGG 0: 1
1: 0
2: 0
3: 8
4: 50

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163141779 Original CRISPR CACCATATGGTGCACTACAA AGG Exonic
904748765 1:32727616-32727638 CTCCATATGGTAGACTAGAAAGG - Intergenic
912449739 1:109761546-109761568 CTCCTTCCGGTGCACTACAAGGG + Exonic
918376962 1:183918753-183918775 CACCACCTGGTGCAATATAAAGG - Intronic
919333672 1:196204904-196204926 CACCACACTGTCCACTACAATGG + Intergenic
920542262 1:206787895-206787917 CACCACATGGTGCAGTGGAAAGG - Intergenic
922110670 1:222551928-222551950 CTCCATATTGTTCACGACAAAGG - Intergenic
1080130409 11:28787937-28787959 CACCATATGGTCTTCCACAATGG + Intergenic
1081218773 11:40435117-40435139 CACCATATGTTGCAACAAAATGG + Intronic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1084342832 11:68519157-68519179 CAACATAGGGTCCACTATAAAGG - Intronic
1084441255 11:69174839-69174861 CTCCATTTGGTGCACTGCATTGG + Intergenic
1092752539 12:11732262-11732284 CACCATATAGTGCAGTAAAGGGG - Intronic
1095180231 12:39138935-39138957 CACCATCTGGTCCTCTTCAAAGG - Intergenic
1116237596 14:42298682-42298704 CTCCATGTGGTGAATTACAAAGG + Intergenic
1122852614 14:104545245-104545267 CCCCATCAGGTGCACTTCAAAGG - Intronic
1124926056 15:34071698-34071720 TACCATATAGTGCACTGCAGTGG + Intergenic
1126645160 15:50868485-50868507 CAGTATATGGTGCAATACAAAGG - Intergenic
1134101681 16:11456927-11456949 CACCTGAAGGTGCAGTACAATGG - Exonic
1147898558 17:43768736-43768758 CACCATTTGGAGAATTACAAGGG - Exonic
1152462455 17:80448707-80448729 CACCATTCGGGGCACTACCATGG - Intergenic
1153839697 18:8995543-8995565 CATCATATGGTGCAGGACAATGG - Intergenic
1162419610 19:10558516-10558538 CACCACCTGGTGCACTACTCAGG + Intronic
1163141779 19:15354438-15354460 CACCATATGGTGCACTACAAAGG + Exonic
1163875266 19:19862520-19862542 CACCAGATGGGGCATGACAAGGG - Intergenic
927695302 2:25235711-25235733 CATCTTATGGTGCACTGAAATGG - Exonic
928446083 2:31334495-31334517 CACCATTTGGAGCAATAAAAGGG + Exonic
928834178 2:35523065-35523087 CCCCATATGGTCCACCAAAATGG + Intergenic
933274194 2:80266363-80266385 CACCATCTGGTGCTCTACATAGG - Intronic
938682814 2:133709515-133709537 CACCATATGGTACCCTAGAAGGG + Intergenic
941090983 2:161175483-161175505 CACCATATGGGGAACAGCAAGGG - Intronic
942940311 2:181607775-181607797 CACCCTATGATGGACTACATGGG + Intronic
948860011 2:240748281-240748303 CCCCATAGGGTGCAGGACAAAGG + Intronic
1169397360 20:5244231-5244253 CACCATATTGGGGACTACTAAGG - Intergenic
1170520235 20:17177665-17177687 GACCATGTGGTGGACAACAAGGG + Intergenic
1182896918 22:33866683-33866705 CACCAGATGGAGCCCTAGAATGG + Intronic
953764169 3:45722041-45722063 GAACAAATTGTGCACTACAATGG + Exonic
956609059 3:71103547-71103569 CAGCATTTGGTGCAATACCATGG - Intronic
966348395 3:179003582-179003604 CTCCATCTGGTACACAACAATGG + Intergenic
971144186 4:23959190-23959212 CACCATATGGTGCTCCTCAATGG + Intergenic
975226955 4:71883781-71883803 CACTATATGATGCAAGACAATGG - Intergenic
978689574 4:111490214-111490236 CACCATATGGTCTTCCACAATGG - Intergenic
981408969 4:144405466-144405488 CTCCATATGGTGTTCTATAAAGG - Intergenic
983237579 4:165197194-165197216 CACCATATAGTAGACTACTATGG - Intronic
984035048 4:174656664-174656686 CAGCATATTCTGCACTACCAAGG - Intronic
987193876 5:15505593-15505615 AACCATGTGGTACACTATAAGGG + Intronic
997171230 5:131723440-131723462 CACCATATAGTTTACTACTAAGG + Intronic
999636241 5:153625475-153625497 CACCATACGGGGCACTGCAGGGG + Intronic
1009041416 6:58183584-58183606 CACCATTTTGTCAACTACAAAGG - Intergenic
1011748239 6:90428828-90428850 CCCCATATGTTTGACTACAAAGG - Intergenic
1013296076 6:108759498-108759520 CAGCATATGGTGCATAACACAGG - Intergenic
1026258906 7:68737142-68737164 CAACATATGCTGAACTTCAAAGG + Intergenic
1027990627 7:85355812-85355834 AAACATATGGTGCATTATAAGGG + Intergenic
1031668155 7:124511012-124511034 CAGCAGATGGTGATCTACAAAGG - Intergenic
1032904125 7:136344640-136344662 CAACATAAGTTGCACTACAAAGG - Intergenic
1048115394 8:131516138-131516160 CACCATTGGATGCAGTACAAAGG + Intergenic
1062231246 9:135482847-135482869 CACCAATTTGTGCCCTACAAGGG - Intronic
1193264171 X:79448758-79448780 CACCATATTGTGCAATTCTAGGG + Intergenic
1197633563 X:128889633-128889655 CAGAATATGGTGCAGTACAACGG + Intergenic
1197652726 X:129083520-129083542 CACCAGATGGTACACAGCAATGG - Intergenic