ID: 1163146234

View in Genome Browser
Species Human (GRCh38)
Location 19:15380516-15380538
Sequence GAAGCTGGAGCGCTACCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 127}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163146234_1163146236 10 Left 1163146234 19:15380516-15380538 CCTTCAGGTAGCGCTCCAGCTTC 0: 1
1: 0
2: 2
3: 4
4: 127
Right 1163146236 19:15380549-15380571 GCTTGTTGTTGAGAATACTGCGG 0: 1
1: 0
2: 0
3: 14
4: 206
1163146234_1163146240 26 Left 1163146234 19:15380516-15380538 CCTTCAGGTAGCGCTCCAGCTTC 0: 1
1: 0
2: 2
3: 4
4: 127
Right 1163146240 19:15380565-15380587 ACTGCGGGCCACCATGAGGGAGG 0: 1
1: 0
2: 0
3: 7
4: 92
1163146234_1163146239 23 Left 1163146234 19:15380516-15380538 CCTTCAGGTAGCGCTCCAGCTTC 0: 1
1: 0
2: 2
3: 4
4: 127
Right 1163146239 19:15380562-15380584 AATACTGCGGGCCACCATGAGGG 0: 1
1: 0
2: 0
3: 4
4: 63
1163146234_1163146237 11 Left 1163146234 19:15380516-15380538 CCTTCAGGTAGCGCTCCAGCTTC 0: 1
1: 0
2: 2
3: 4
4: 127
Right 1163146237 19:15380550-15380572 CTTGTTGTTGAGAATACTGCGGG 0: 1
1: 0
2: 0
3: 8
4: 160
1163146234_1163146238 22 Left 1163146234 19:15380516-15380538 CCTTCAGGTAGCGCTCCAGCTTC 0: 1
1: 0
2: 2
3: 4
4: 127
Right 1163146238 19:15380561-15380583 GAATACTGCGGGCCACCATGAGG 0: 1
1: 0
2: 0
3: 5
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163146234 Original CRISPR GAAGCTGGAGCGCTACCTGA AGG (reversed) Exonic
901146874 1:7070746-7070768 CAAGCTGGAGGGCTGCCTGGTGG - Intronic
904397369 1:30230907-30230929 GAAGCTGCATAGCTCCCTGAAGG + Intergenic
909089033 1:71203052-71203074 GCATCTGCAGCTCTACCTGAGGG - Intergenic
913578204 1:120197891-120197913 AGAGCTGGAGCCCTGCCTGATGG + Intergenic
913629967 1:120700467-120700489 AGAGCTGGAGCCCTGCCTGATGG - Intergenic
914560122 1:148809305-148809327 AGAGCTGGAGCCCTGCCTGATGG + Intronic
914612711 1:149320910-149320932 AGAGCTGGAGCCCTGCCTGATGG - Intergenic
917007964 1:170436705-170436727 AAGGCTAGAGTGCTACCTGAAGG + Intergenic
918215632 1:182390754-182390776 GCAGCTGGAGCGCGACCCGGAGG + Exonic
918225520 1:182477694-182477716 GAAGCTGGAGCTGCACCTGTGGG - Intronic
919806413 1:201383325-201383347 GAAGCTGGAGAGATACCACACGG - Exonic
1067221380 10:44346620-44346642 GATGCTGGAGCCCTTCATGAAGG + Intergenic
1072005615 10:91243926-91243948 GAAGATGGAGAGCTCCATGAGGG + Intronic
1073547725 10:104365978-104366000 GAAGCTGGAGCAGCAGCTGAAGG + Exonic
1075399922 10:122153475-122153497 GAAGCTGGAAGGCTTCCTGGAGG - Intronic
1076087076 10:127642674-127642696 GAGGCTGGAACGCCACCTCAAGG + Intergenic
1076590249 10:131577870-131577892 GAGGCTGGAGAGCTCCCTGAGGG + Intergenic
1077706306 11:4489569-4489591 CAAGCTGGAGAACTGCCTGAAGG - Exonic
1081155973 11:39691307-39691329 GAAGTTGGAGCTCTAAATGAGGG + Intergenic
1088651024 11:111958284-111958306 GCAGCTGCAGCTATACCTGAGGG - Intronic
1089038813 11:115426068-115426090 GAGGCAGGAGGGCTACCTGCAGG + Intronic
1101600502 12:106205537-106205559 GCACCTGGAGCGCTGCCTGCTGG - Intergenic
1102933564 12:116879794-116879816 GAAGTTGGAGCGGCGCCTGAAGG - Intronic
1103342779 12:120229984-120230006 TAAGGTGGGGCGCTGCCTGAGGG - Intronic
1106130836 13:26938052-26938074 GATGCTGAATCACTACCTGAAGG + Intergenic
1109460305 13:62647209-62647231 GAAGCTGAGGTGCTGCCTGAAGG + Intergenic
1113240869 13:108335641-108335663 GAAGCGGGAGCGGTAGCTGGAGG + Intergenic
1113597265 13:111542070-111542092 GAAGATGGAGCGCTTCGTCAGGG + Intergenic
1114173804 14:20300693-20300715 GAAGCTGGAGCCCGAGCTGGTGG - Exonic
1117867529 14:60165228-60165250 GCAGCTGCTGCGCTTCCTGAGGG - Exonic
1118620609 14:67611009-67611031 GCTGCTGGAGCCGTACCTGATGG + Intergenic
1121045758 14:90786275-90786297 GAAGCTGGAGCAGTACCTGAAGG - Exonic
1122123496 14:99566975-99566997 GAGGCTGGAGCGCTGCCTTCTGG - Intronic
1122476837 14:102016065-102016087 GCAGCTGGAGCGCTACATTCAGG + Exonic
1122824180 14:104361686-104361708 GAACCAGGAGGGCTCCCTGAAGG - Intergenic
1126060983 15:44782322-44782344 CTAGCTGGAGCACCACCTGAGGG + Intergenic
1126794187 15:52246390-52246412 TAAGCTGCAGAGCTACCTGTTGG - Intronic
1132746622 16:1438892-1438914 GAAGCTGGAGGGCAGCCTGCGGG - Exonic
1133201486 16:4206970-4206992 GAAGGTGGAGCGCCACAGGAAGG - Intronic
1136315802 16:29454202-29454224 GAAGCTGCAGCGGGACCTGGAGG - Exonic
1136430379 16:30193544-30193566 GAAGCTGCAGCGGGACCTGGAGG - Exonic
1139471021 16:67178265-67178287 GGACCTGGAGCGCTACGTGCAGG - Exonic
1140503362 16:75453962-75453984 GTAGCTGGAGAGCTACCTTGAGG - Intronic
1140544465 16:75792902-75792924 GAAGCTGCAGGACTGCCTGATGG + Intergenic
1142132541 16:88437520-88437542 CAAGCTGCAGCGCCACCTGGCGG + Exonic
1144476650 17:15594764-15594786 GAAGTACGAGCGCTGCCTGATGG - Exonic
1144608709 17:16690006-16690028 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144608718 17:16690054-16690076 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144608727 17:16690102-16690124 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1144904089 17:18625725-18625747 GGAGCTGCAGCGCCACCTGCAGG - Intergenic
1144921602 17:18768638-18768660 GAAGTACGAGCGCTGCCTGATGG + Exonic
1145128484 17:20320921-20320943 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1145128492 17:20320969-20320991 GGAGCTGCAGCGCCACCTGCAGG + Intergenic
1148772536 17:50075714-50075736 GAAGCTGGAGCTGCTCCTGATGG + Exonic
1148858397 17:50591507-50591529 GAAGCTGGTGCGCTTCCTGCCGG + Exonic
1152124415 17:78437805-78437827 GAAGCTGGAGCACTACAGCACGG - Exonic
1152319143 17:79598160-79598182 GGAGCAGGAGCGCTGCCTGCTGG + Intergenic
1152738685 17:82009546-82009568 GAAGCTGGAGCGCTACCCAAAGG + Exonic
1153043072 18:832266-832288 GAAGCTGCAGCGGGACCTGGAGG + Intergenic
1158260263 18:55598802-55598824 GAAGCTGGAGCTGTATTTGATGG - Intronic
1161081981 19:2315844-2315866 AAAGCTGGAGCGGCACCTGGTGG + Intronic
1161242523 19:3230261-3230283 GAAGCAGGAGCTCTGCCTGGAGG + Intronic
1161379929 19:3959527-3959549 CAAGCTGGAGTGCGACTTGATGG + Exonic
1161637115 19:5395860-5395882 AAATCTGGAGGGCTTCCTGATGG + Intergenic
1162111475 19:8402149-8402171 GAACGTGGAGCGCTGGCTGAAGG + Exonic
1162444152 19:10712316-10712338 GAAGCCAGAGCCCTACCTGTGGG + Intronic
1162739535 19:12766143-12766165 GGAGCTGCAGCGCCACCTGGAGG - Exonic
1163146234 19:15380516-15380538 GAAGCTGGAGCGCTACCTGAAGG - Exonic
1163509342 19:17725936-17725958 GGAGCCGGAGCGCCCCCTGAAGG - Exonic
1165856753 19:38883602-38883624 GAGGCTGGAGGGCATCCTGAGGG - Intronic
1167379548 19:49130575-49130597 CAAGCTGCAGCGCGACCTCAAGG + Exonic
1167757595 19:51422095-51422117 GAAGGTGGAGCGCCCCCTGGGGG - Intergenic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
926732393 2:16046165-16046187 GAAGATGGAGCGCTACGGGAGGG - Intergenic
927323939 2:21781227-21781249 GAAGCTGGTGCCCTTCCTCATGG - Intergenic
927884851 2:26712111-26712133 GAAGCTGGAGGGCTTCAGGATGG + Intronic
928195357 2:29212510-29212532 GAAGCTGGAGGGAGAACTGAAGG + Intronic
930531332 2:52592105-52592127 AAAGAGGGAGCTCTACCTGAAGG - Intergenic
934038615 2:88109356-88109378 GAAGCTGGAACTCAACCTGGAGG - Intronic
947952194 2:234158030-234158052 GAAGCTGGAGTGAAACCTTAGGG - Intergenic
1169821920 20:9721314-9721336 CATGCTGGAGTGCTCCCTGAAGG + Intronic
1170986764 20:21266118-21266140 GAGGCTGGAGTGCTGACTGAAGG - Intergenic
1172693142 20:36804195-36804217 GAAGCTGGAGCCCAAGCTGCAGG + Intronic
1173854024 20:46238162-46238184 GAAGCAGGAGCCCCATCTGAAGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1178827296 21:36027640-36027662 GAAGCTCAAGCGCACCCTGATGG + Intergenic
1178872742 21:36389835-36389857 GGAGCAGGAGCGCCACCTGGGGG + Intronic
1180193993 21:46182738-46182760 GAAGCAGGTGCGCCTCCTGAAGG - Exonic
1183185283 22:36288323-36288345 GAAGCTGGAGATGGACCTGAAGG - Exonic
950702042 3:14757515-14757537 GGAGCTGGAGCGCTTCCTGTTGG + Exonic
951319140 3:21224042-21224064 CAAGGTGGAGGGCTACATGAGGG - Intergenic
952747603 3:36795678-36795700 GAAGCTGAAGCAATATCTGAAGG - Intergenic
953747117 3:45583564-45583586 AAAGCTGGAGGGCTACTTCAGGG - Intronic
954603137 3:51887850-51887872 GCAGCTGAAGCAGTACCTGAAGG + Intergenic
958756660 3:98257834-98257856 GAAGCAGGAGGGCTAACTTATGG - Intergenic
959342043 3:105144076-105144098 GGAGCTGGATCACTACCTAATGG + Intergenic
962695076 3:137939913-137939935 CAAGCTGCACCACTACCTGACGG - Intergenic
968353278 3:198080492-198080514 GAAGCTGAAGAGCTTCCTCATGG + Intergenic
968705145 4:2074198-2074220 TCAGCTGGAGCGCTCCCTGTGGG + Intronic
977305142 4:95314693-95314715 GCAGCTAGAGAGCTCCCTGAGGG - Intronic
985770729 5:1808575-1808597 GAAGCTGGGGAGCTGCATGAGGG - Intronic
992486379 5:77201067-77201089 GAGGCTGCAGCTCTGCCTGAAGG - Intergenic
994183034 5:96788556-96788578 GAAGCAAGAGCACTACATGAAGG - Exonic
998248841 5:140535379-140535401 GAAGATGGGGAGCTGCCTGATGG - Exonic
999210743 5:149886347-149886369 AAAGCTGAAGCGCTACTTCACGG - Exonic
1003716547 6:8652697-8652719 GAAGCTGGAGCTTTTCCTCATGG + Intergenic
1005041222 6:21602157-21602179 GAAGCTGCAGCGGGACCTGGCGG + Intergenic
1006170150 6:32087746-32087768 GGACCTGGAGCGCCACCTGCGGG - Intronic
1006980852 6:38146555-38146577 GAAGCTGCAGAGCTTCCTTAAGG - Intronic
1009424551 6:63500070-63500092 GGAGCAGGATGGCTACCTGAGGG - Intergenic
1016949622 6:149566787-149566809 CAAGCCGGCGCGCGACCTGACGG + Intronic
1017871926 6:158493871-158493893 GAAGCCAGAGCTCCACCTGAGGG - Intronic
1018022557 6:159775572-159775594 GAAGCTGGAGCACTGGCTCATGG + Intronic
1018241407 6:161778834-161778856 GAAGCTGGACTGCTACGGGAAGG - Intronic
1023291383 7:38672011-38672033 GGAGCTGGTGCCCCACCTGATGG - Intergenic
1023394727 7:39742382-39742404 GAAGGAGGAGCGCTTCCTGCTGG + Intergenic
1028467298 7:91167420-91167442 GAAGCTGAAAAGCTACCTTATGG - Intronic
1032455517 7:132070577-132070599 CAAGCTGGAGGGATCCCTGAGGG + Intergenic
1033136147 7:138786113-138786135 GAAGCTGGAGGGCTCCGTGGTGG - Intronic
1040077097 8:43247188-43247210 GAAGCTGAAGCGCTTCCTCGTGG - Intergenic
1041186484 8:55306278-55306300 AAAGCTGGATAGCTACCTGCAGG - Intronic
1041441533 8:57902049-57902071 GCAGCTGTAGGGCTACCCGATGG - Intergenic
1047451652 8:124970314-124970336 GAAACTGAAGCACTCCCTGAGGG + Intergenic
1048138343 8:131768330-131768352 GAAGCTGGTGCTCCACCTGCAGG - Intergenic
1049442048 8:142614085-142614107 GCAGGTGGAGCGCGAGCTGAAGG - Exonic
1049518870 8:143078116-143078138 GGAGCTGGAGTGATACGTGATGG + Intergenic
1049682350 8:143925137-143925159 ACAGCTGGAGCGCTCCCTGCAGG - Exonic
1049775189 8:144400802-144400824 GAAGCTGGACCTCTGCCTGGGGG + Exonic
1053503252 9:38620265-38620287 GAAGCTGAAGAGCTTCCTCATGG + Intergenic
1056583195 9:87909561-87909583 GAAGTTGGAGCGATCTCTGATGG - Intergenic
1057152879 9:92809663-92809685 GAAGCTGAAGAGCTTCCTCATGG - Intergenic
1062235914 9:135507506-135507528 GAAGCTAGAGCGTCACCTGGGGG + Intergenic
1190359911 X:49638838-49638860 GCAGCTGGAGCGAACCCTGATGG + Intergenic
1196734955 X:118975095-118975117 GCAGCTGGTGCGCTGCCTGGCGG + Exonic