ID: 1163146243

View in Genome Browser
Species Human (GRCh38)
Location 19:15380576-15380598
Sequence GTCCAAGAAGTCCTCCCTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 152}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163146243_1163146246 2 Left 1163146243 19:15380576-15380598 CCATGAGGGAGGACTTCTTGGAC 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1163146246 19:15380601-15380623 CTCCATCATGAGCTGCGGGCAGG 0: 1
1: 0
2: 1
3: 12
4: 127
1163146243_1163146249 10 Left 1163146243 19:15380576-15380598 CCATGAGGGAGGACTTCTTGGAC 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1163146249 19:15380609-15380631 TGAGCTGCGGGCAGGGCAGAAGG 0: 1
1: 0
2: 3
3: 45
4: 518
1163146243_1163146251 21 Left 1163146243 19:15380576-15380598 CCATGAGGGAGGACTTCTTGGAC 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1163146251 19:15380620-15380642 CAGGGCAGAAGGAGCTGGAGAGG 0: 1
1: 1
2: 14
3: 117
4: 835
1163146243_1163146250 16 Left 1163146243 19:15380576-15380598 CCATGAGGGAGGACTTCTTGGAC 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1163146250 19:15380615-15380637 GCGGGCAGGGCAGAAGGAGCTGG 0: 1
1: 1
2: 5
3: 53
4: 720
1163146243_1163146244 -3 Left 1163146243 19:15380576-15380598 CCATGAGGGAGGACTTCTTGGAC 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1163146244 19:15380596-15380618 GACTGCTCCATCATGAGCTGCGG 0: 1
1: 0
2: 0
3: 11
4: 138
1163146243_1163146247 3 Left 1163146243 19:15380576-15380598 CCATGAGGGAGGACTTCTTGGAC 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1163146247 19:15380602-15380624 TCCATCATGAGCTGCGGGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 134
1163146243_1163146245 -2 Left 1163146243 19:15380576-15380598 CCATGAGGGAGGACTTCTTGGAC 0: 1
1: 0
2: 2
3: 12
4: 152
Right 1163146245 19:15380597-15380619 ACTGCTCCATCATGAGCTGCGGG 0: 1
1: 0
2: 0
3: 15
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163146243 Original CRISPR GTCCAAGAAGTCCTCCCTCA TGG (reversed) Exonic
900403283 1:2481601-2481623 GTCCAACCAGACCTCCCTAAGGG + Intronic
903089092 1:20893447-20893469 CTCCATGAAATCCTACCTCATGG - Intronic
904260812 1:29286669-29286691 GTCCTAGAAATCTACCCTCAAGG + Intronic
904282214 1:29428557-29428579 GTCCATGTGGTCCTCACTCAGGG - Intergenic
907311826 1:53543218-53543240 GCACTAGCAGTCCTCCCTCACGG + Intronic
915737005 1:158091365-158091387 CTCCAAGAAGTTCTCCTTCCAGG - Exonic
917069968 1:171139932-171139954 GTCAAAGAAAACCTCCCACAGGG + Intronic
919959952 1:202456930-202456952 GTCATAGAACTCTTCCCTCATGG - Intronic
920231873 1:204476013-204476035 GACCAAGAAGGCCACCCCCAAGG + Intronic
920691351 1:208148811-208148833 CTCCAGGAAGTACCCCCTCAGGG - Intronic
920759386 1:208767607-208767629 CTCCAGGAAGTCCTGCCACATGG - Intergenic
1063286634 10:4695626-4695648 GGCCAAGAACTCTTCACTCAGGG + Intergenic
1064524092 10:16234991-16235013 GTCCAGGAAGTCCTCCCAATGGG + Intergenic
1064660254 10:17600741-17600763 GTGCAAGAAGGCTTCCCTTAAGG - Intronic
1067099595 10:43324931-43324953 GTCCAGGGAGTTCTCACTCAGGG - Intergenic
1069093047 10:64224845-64224867 ATCCAAAAAGGCCTCCCTTAAGG + Intergenic
1070639679 10:78158712-78158734 GTCCAAGAACTACTACCTCTTGG - Intergenic
1073206582 10:101772631-101772653 GTCCAAGAACTGCTTTCTCAGGG - Intronic
1074131574 10:110583122-110583144 GTTCAAGGAGTCCTCCCACCTGG + Intronic
1081360768 11:42175025-42175047 CTCCATGAAGTCTTCCCCCAGGG + Intergenic
1083580516 11:63821979-63822001 GTGCAAGCAGTCCTCCCACCTGG + Intronic
1084309705 11:68309800-68309822 GTCCAAGAGGCCCTCTCTCCTGG + Intergenic
1085452986 11:76648063-76648085 GCCCAAGAAGTCTGCCCTCCAGG - Intergenic
1085749917 11:79152765-79152787 GTCCAGGAAGTCATGCTTCAGGG - Intronic
1089665115 11:120013461-120013483 GGCCAGAAAGTCCTCCCTTAGGG + Intergenic
1089904094 11:122020169-122020191 GTTCAAGAAGTAATCCCTGAAGG - Intergenic
1090046537 11:123340279-123340301 TTCCAAGAACTCCTCCCCAAAGG + Intergenic
1091776406 12:3187795-3187817 CTCCAAGAAGCCCTTCCTGATGG + Intronic
1095827992 12:46550251-46550273 ATCCAGGAAGTCTTCCCTGATGG + Intergenic
1095982310 12:47980516-47980538 CTCCAAGAATTGTTCCCTCAAGG - Intronic
1096910040 12:54974276-54974298 GTCAAAACAGTCCTCCCTGAGGG + Intronic
1098567095 12:71948871-71948893 AACCAAGAAGTCCTCTCTGAAGG + Intronic
1099684585 12:85868373-85868395 TTCCAAGAATCCCTCCCTGATGG - Intergenic
1100987827 12:100221181-100221203 GGGTAAGAAGTCCTCACTCAAGG - Intronic
1102177514 12:110886835-110886857 GTCCAGGAAGACCTCCTTCCGGG - Intronic
1102599700 12:114020479-114020501 TTCTCAGAAGTCCTCCCCCAGGG + Intergenic
1106371692 13:29140783-29140805 ATTCAAGAAGGCTTCCCTCATGG + Intronic
1112944941 13:104916661-104916683 GTCCAAGACGTTCTCAATCATGG + Intergenic
1113576491 13:111398732-111398754 GTCCCACATGTCCTCCCTCTTGG + Intergenic
1113982805 13:114290250-114290272 GTCCCAGAAGCCCTTCCCCAGGG - Intronic
1115071814 14:29332190-29332212 GACCAAGAAGTCCAACATCAAGG - Intergenic
1115899181 14:38125969-38125991 CTCGAAGACCTCCTCCCTCAGGG + Intergenic
1120275965 14:82372363-82372385 GTCCAAAAAGGACTACCTCAAGG + Intergenic
1121402428 14:93691674-93691696 CTCCACGGAGTCCTCCCGCATGG - Intronic
1122258454 14:100498215-100498237 CACCAAGCAGTCTTCCCTCAGGG - Intronic
1122936530 14:104960537-104960559 GTCCTAGAAGCAATCCCTCATGG + Intronic
1124240367 15:28023311-28023333 GTCACAGATCTCCTCCCTCATGG + Intronic
1127381473 15:58434267-58434289 CACCAGGAAGTACTCCCTCAAGG + Intronic
1127993933 15:64141493-64141515 CTCCACAAAGTCCTCCCTCCTGG - Intronic
1128538688 15:68509918-68509940 TTCCAAGAAGCCTTCCCTGATGG - Intergenic
1129343418 15:74901168-74901190 GCCCAAGCAGTCCTCCCACATGG - Exonic
1129769123 15:78192537-78192559 CTCCAAGAGGTTCTGCCTCAAGG + Intronic
1131078639 15:89515288-89515310 CTCCAGGAGGCCCTCCCTCAGGG + Intergenic
1131575322 15:93584196-93584218 CTCCATGAGCTCCTCCCTCATGG - Intergenic
1132204293 15:99975974-99975996 GCCCAGTAAGTCCTCCCTGACGG - Intronic
1133572138 16:7051688-7051710 GTGCAAGAATTCCTCCATAAAGG - Intronic
1134076366 16:11294670-11294692 GTTCAAGCAGTCCTCCCGCTGGG + Intronic
1134347774 16:13407200-13407222 GGCCAAGAAGTCCTAGATCAAGG + Intergenic
1137552740 16:49451797-49451819 CTCCAGGAAGCCTTCCCTCATGG + Intergenic
1138395797 16:56703764-56703786 CACCAAGAATTCCTGCCTCAAGG + Intronic
1138424882 16:56924747-56924769 GTACAAGAAGTAGTCCCCCAAGG - Intergenic
1139395432 16:66634949-66634971 GTCAAACAGGTCCTCCCGCAGGG + Intronic
1140120440 16:72078934-72078956 GTTCAAGAAGTCCTTCCTGAAGG - Intronic
1140199547 16:72883702-72883724 GTCCAAACAGTCCTTCATCAGGG + Intronic
1141162320 16:81637834-81637856 GGCCAGGAAGTCCACCATCAAGG + Intronic
1142050792 16:87956886-87956908 GTCCCAGAAGCCCCCTCTCAGGG + Intronic
1142235732 16:88921637-88921659 GTCCAGGAAGTTCTGCCTTAAGG + Intronic
1143654239 17:8284209-8284231 GCTCAAGCAGTCCTCCCTCCTGG + Intergenic
1143810226 17:9465729-9465751 GTCCCGGAAGTCCTCCCTAAAGG - Intronic
1145029628 17:19494991-19495013 GTCCAAGAGGCCCACCCGCAGGG - Intergenic
1145826993 17:27884548-27884570 CTCCAGGAAGCCCTTCCTCACGG + Intronic
1148163645 17:45467178-45467200 GCTCAAGCAGTCCTCCCTCTTGG + Intronic
1148786709 17:50149347-50149369 CTCCGAGAAGTCCTCCTTCTTGG + Exonic
1150525333 17:65916777-65916799 CTCCAAGCAATCCTCCCTCCTGG + Intronic
1150975094 17:70076983-70077005 GTCAAAGAAGTCTTCACTAAGGG + Intronic
1153380814 18:4437369-4437391 GTCCTAGAACTACTCCCTTATGG - Intronic
1155701133 18:28745396-28745418 GCCCAAGTGGTCCTCCCTCCTGG - Intergenic
1161924051 19:7288124-7288146 GTTCAAGCAGTCTTCCCTCCTGG - Intronic
1162206360 19:9059098-9059120 GTCCCAGCTGTCCTCCCTCTAGG + Intergenic
1162839344 19:13344451-13344473 GTCCAAGAAGGCTTCTCTGATGG - Intronic
1163146243 19:15380576-15380598 GTCCAAGAAGTCCTCCCTCATGG - Exonic
1166503010 19:43354716-43354738 GTTCAAGAAGTTCTCCTGCAGGG + Intronic
1166507442 19:43380016-43380038 GTTCAAGAAGTTCTCCTGCAGGG - Intergenic
1168342774 19:55635250-55635272 ATCCAAGAAGCCCACCCTCAAGG - Intronic
925814329 2:7732875-7732897 GGTCATGAAGTCATCCCTCAAGG - Intergenic
926093209 2:10063803-10063825 GTCCCAGCAGTCCTGCCCCAGGG - Intronic
928433426 2:31238818-31238840 GTCCAGGGAGGCCTCCCTCATGG - Intronic
929449438 2:42027032-42027054 ATCCTAGAAGACCTCACTCAGGG + Intergenic
932835513 2:75032204-75032226 GTCCTAGAAATCCTCACTTAGGG - Intergenic
933162407 2:79040092-79040114 GATCAACAAATCCTCCCTCATGG + Intergenic
940090320 2:149909042-149909064 GTCCAAGGATTCCTTCCTGAAGG - Intergenic
943247424 2:185473385-185473407 GTCAAAGAAGTTCTCACTCTGGG - Intergenic
949010621 2:241676335-241676357 GTACAAGCAGTCCTCCCTCGTGG - Intronic
1170100055 20:12689012-12689034 TTCCAGGAAGTCTTCCCTCCTGG + Intergenic
1173149278 20:40551644-40551666 GGCAAAGAAGGCCTCCCACAGGG + Intergenic
1174803167 20:53582026-53582048 CTGCAGGAAGTCCTCCCTCGAGG + Exonic
1175562671 20:59944459-59944481 TCCCAAGAAGTCCTCCCACTCGG - Exonic
1175814849 20:61878002-61878024 GTCCACGAAGTCCTCCCTCTGGG - Intronic
1177477967 21:21648892-21648914 ATCCAAGGAGTCCGCCATCATGG - Intergenic
1177830046 21:26128000-26128022 GTGCAGGAAATCCTCTCTCAGGG - Intronic
1178507565 21:33175158-33175180 GTCCATGGAGATCTCCCTCAGGG - Intergenic
1178557252 21:33603575-33603597 GTCCCACAAGTCCTACCTCCTGG + Intronic
1183188931 22:36309117-36309139 GTCCGAGGAGCCCTCTCTCATGG + Intronic
1184464262 22:44659638-44659660 GTCCAAGCTGTCCACCCACAGGG - Intergenic
1184652179 22:45924490-45924512 CTCCAGGAAGCCCTACCTCAAGG - Intronic
949893119 3:8747990-8748012 GTCCAAGGAGTTCTCCCTCCAGG + Intronic
950552870 3:13677266-13677288 GGCCAAGCAGTGCTCGCTCATGG - Intergenic
952976118 3:38697994-38698016 GTCAAAGTCGTCCTCACTCAGGG + Exonic
954914540 3:54137506-54137528 GTGCAAGAATTGCTCCCTCAGGG + Intronic
956719788 3:72107726-72107748 TTCCAATAAGTCCTCACTCATGG + Intergenic
961325297 3:126105937-126105959 GTCCAGGAAGAACTCCCTGAGGG + Intronic
964084437 3:152798999-152799021 GTTCAAGCAATCCTCCCTCCTGG + Intergenic
964261768 3:154847604-154847626 CTCCACCAACTCCTCCCTCATGG - Intergenic
964675002 3:159268115-159268137 GTCCCAGAAATCCTCTTTCAGGG - Intronic
968554733 4:1241134-1241156 GTGCAGGAAGCCCTCCCTCGAGG + Intronic
974101772 4:57424782-57424804 GGCCAAGAGGTCCTGCCTCTGGG + Intergenic
976002252 4:80386947-80386969 GTGCAAGAAGTCCTCCCGGCGGG - Intronic
977244619 4:94616607-94616629 GTCAAAGACTGCCTCCCTCATGG - Intronic
980123636 4:128752431-128752453 GGCCAAGAAGTCCTAGGTCAAGG - Intergenic
982781310 4:159493823-159493845 CTACAAGAAGTCCTCACTTAGGG + Intergenic
983401760 4:167275143-167275165 GTCCAAGCAGTTCTGCCCCATGG + Intergenic
984852070 4:184162990-184163012 GTCCTAGAGGCCATCCCTCAAGG + Intronic
985377861 4:189360860-189360882 GCCCAGCAAGTCCTCGCTCAGGG - Intergenic
990172675 5:53071512-53071534 CTCCCAGAAGTCCTCCCAGAAGG - Intronic
992084732 5:73268036-73268058 GTCCAAGAAGTTTTCCTACAAGG - Intergenic
994051630 5:95368840-95368862 GACCATGAAGTCTTCCATCAAGG + Intergenic
995990763 5:118236394-118236416 GTACATGAACACCTCCCTCATGG + Intergenic
996614576 5:125425288-125425310 TTAAAAGAAGCCCTCCCTCAGGG + Intergenic
996924242 5:128804827-128804849 GTCCTAGAAGTCCTAACTAATGG - Intronic
997753688 5:136374517-136374539 GTCCATGTAGTCTTCCTTCAGGG - Intronic
999246854 5:150159716-150159738 GTCATAGAAGTCCACCATCAGGG + Intergenic
999302769 5:150501373-150501395 GACTCAGAAGTTCTCCCTCATGG + Intronic
1003581199 6:7342373-7342395 CTGCATGAAGTACTCCCTCATGG + Intronic
1004626587 6:17383039-17383061 GTCCAAGCAATCCTCCCTCTTGG + Intergenic
1004691919 6:17999405-17999427 CTTCAAGCAGTCCTCCCTAAGGG + Intergenic
1007721015 6:43885506-43885528 GTCCCAGGAGTCCCCCCTCAAGG - Intergenic
1010749511 6:79602334-79602356 GTCCAGGAAGACCTCCCTGAGGG + Intergenic
1015223540 6:130831122-130831144 ATCAAAGTAGTCCTCCCTGATGG + Intronic
1016667077 6:146654583-146654605 GCTCAAGCAGTCCTCCCACACGG + Intronic
1017039499 6:150296313-150296335 GACCAGAAAATCCTCCCTCAAGG + Intergenic
1017709596 6:157155412-157155434 GTCCACGAAGGGCTCTCTCAGGG - Intronic
1021624405 7:22578579-22578601 ATCCAAGATGACCTCACTCACGG + Intronic
1022510379 7:30931610-30931632 GGCCCAGAAATCCTCCCGCAGGG - Intergenic
1028829562 7:95312702-95312724 GTCCAGGAAGTTCTGCCCCAGGG - Intronic
1029495257 7:100893035-100893057 GTCCCAGAAGTCCTCCCTGAGGG - Intronic
1035432217 7:158830323-158830345 ATCCCAAAAGTCCTCCCTGAGGG + Intergenic
1035652183 8:1275632-1275654 GTCCAAGTAGTTCTCACTCTAGG + Intergenic
1037884751 8:22590032-22590054 CTCCAAGAAGCCCTCCCTGGAGG - Intronic
1039702012 8:39971656-39971678 TTGCAAGAAGTCAACCCTCATGG + Intronic
1040675487 8:49744255-49744277 GACCAGGAAGTCCTCCCAGAAGG - Intergenic
1042123545 8:65513688-65513710 ATCCAAGAAGTGCTCTCTCCAGG + Intergenic
1046111975 8:109736347-109736369 GCCCAAGAAGTCCCCCCAAATGG - Intergenic
1047677568 8:127220034-127220056 TTCCAAGAAGTTCTCCTCCAAGG + Intergenic
1047956196 8:129977863-129977885 ATACAAGATGTCCACCCTCAAGG - Intronic
1048211539 8:132458154-132458176 GCCCAACATGACCTCCCTCAAGG + Intronic
1048473728 8:134724884-134724906 GTCCAAGCAGTTCTCACCCATGG + Intergenic
1048937043 8:139366038-139366060 ATCCATGCTGTCCTCCCTCACGG - Intergenic
1049551947 8:143264103-143264125 GTCCAAGAAGGCTTCTCTAAGGG - Intronic
1056070908 9:82985660-82985682 GTGCAAGAATTTCTGCCTCAGGG - Intronic
1059001029 9:110349151-110349173 GACCAAGAACTGCTCCCACAAGG - Intergenic
1059038137 9:110781668-110781690 GTCCAAGAAGTCCAAGATCAAGG + Intronic
1059080050 9:111239184-111239206 GTCCAAGAACTGATCCCCCACGG + Intergenic
1060357606 9:122924887-122924909 GTTCAAGCAGTCTTCCCACAAGG + Intronic
1186872555 X:13786796-13786818 GTCCATAAAGACCTGCCTCAGGG + Intronic
1193487744 X:82107668-82107690 GTTCTAGAAGTACTCCCTGAGGG + Intergenic
1196797281 X:119512508-119512530 TTCCAAGAAGTCCTTCTTCCAGG - Intergenic
1201595032 Y:15658771-15658793 GGCCAAGCAGTCCTCCCACCTGG + Intergenic