ID: 1163152366

View in Genome Browser
Species Human (GRCh38)
Location 19:15422918-15422940
Sequence CGCCCTGGCTGTAGTGTGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163152356_1163152366 22 Left 1163152356 19:15422873-15422895 CCCAGAGTCCTCGGGCTGGGGGA 0: 1
1: 0
2: 1
3: 20
4: 206
Right 1163152366 19:15422918-15422940 CGCCCTGGCTGTAGTGTGCCCGG 0: 1
1: 0
2: 0
3: 9
4: 131
1163152349_1163152366 30 Left 1163152349 19:15422865-15422887 CCTGTGGCCCCAGAGTCCTCGGG 0: 1
1: 0
2: 0
3: 22
4: 244
Right 1163152366 19:15422918-15422940 CGCCCTGGCTGTAGTGTGCCCGG 0: 1
1: 0
2: 0
3: 9
4: 131
1163152354_1163152366 23 Left 1163152354 19:15422872-15422894 CCCCAGAGTCCTCGGGCTGGGGG 0: 1
1: 0
2: 0
3: 20
4: 296
Right 1163152366 19:15422918-15422940 CGCCCTGGCTGTAGTGTGCCCGG 0: 1
1: 0
2: 0
3: 9
4: 131
1163152360_1163152366 14 Left 1163152360 19:15422881-15422903 CCTCGGGCTGGGGGAAGGGCAGC 0: 1
1: 0
2: 7
3: 83
4: 650
Right 1163152366 19:15422918-15422940 CGCCCTGGCTGTAGTGTGCCCGG 0: 1
1: 0
2: 0
3: 9
4: 131
1163152357_1163152366 21 Left 1163152357 19:15422874-15422896 CCAGAGTCCTCGGGCTGGGGGAA 0: 1
1: 0
2: 2
3: 12
4: 184
Right 1163152366 19:15422918-15422940 CGCCCTGGCTGTAGTGTGCCCGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163152366 Original CRISPR CGCCCTGGCTGTAGTGTGCC CGG Exonic
900428943 1:2592998-2593020 GCCCCTGGCTGCACTGTGCCTGG + Intronic
902795020 1:18795469-18795491 TGCCCTGGAGGGAGTGTGCCTGG - Intergenic
903701069 1:25248387-25248409 CGCCCAGGCTGGAGTGTGGTGGG + Intronic
906117501 1:43366404-43366426 CGCCCCTGCTGTACTGTGCAGGG + Intronic
908796282 1:67833534-67833556 CGCCCTGGCTGTGCTGTCCCGGG + Intergenic
909183297 1:72451060-72451082 GGCACTGGCAGTAGTGAGCCAGG - Intergenic
916247685 1:162705205-162705227 GGCCCTGGCTGTAGTGAGATTGG - Intronic
917838391 1:178958651-178958673 CGCCCTGGCTGGAGTGATGCAGG + Intergenic
918015742 1:180631312-180631334 CACCCAGGCTGAAGTGTCCCTGG - Intergenic
918124971 1:181575244-181575266 GGCCCTGGCTGCAGTGTGGTTGG + Intronic
922817208 1:228458369-228458391 AGCGCTTGTTGTAGTGTGCCAGG - Exonic
923741430 1:236658429-236658451 CGCCCAGGCTGAAGTGTGAGTGG - Intergenic
1063682755 10:8205561-8205583 CGCCCAGGCTGTAGTGCGGGTGG - Intergenic
1064409892 10:15096242-15096264 GGCGCTGGCTGGAGTGAGCCAGG + Exonic
1065494498 10:26314842-26314864 AGCACTGGCTGCAGGGTGCCGGG - Intergenic
1067220350 10:44339658-44339680 CACCCTGGCTGGGGTGTGCTGGG - Intergenic
1070306683 10:75243779-75243801 CTCCCCGGCTGTATTGTTCCTGG + Intergenic
1070373863 10:75810297-75810319 CACACTGGCTGCAGTGTGCAGGG + Intronic
1076931478 10:133534578-133534600 CAGCCTGGCTGGAGAGTGCCGGG + Intronic
1078692346 11:13594884-13594906 GGCCCTGGATGTAGTTTGGCAGG - Intergenic
1083801456 11:65048509-65048531 AGGCCTGGCTGCAGGGTGCCAGG - Intronic
1084411076 11:69006216-69006238 AGCCCCGGCTGTAGAGTTCCGGG + Exonic
1084499347 11:69525589-69525611 GGCCCTGGCTGGAGTGGGGCAGG - Intergenic
1085285832 11:75360172-75360194 CACCCAGGCTGGAGTGTGCAAGG + Intergenic
1092094419 12:5829451-5829473 CGCCATGTTTGCAGTGTGCCTGG + Intronic
1092245899 12:6864070-6864092 CTGCCTGGCTCTAGTGGGCCGGG + Exonic
1092812720 12:12286688-12286710 CGCCCAGGCTGGAGTGTGGTGGG + Intergenic
1094631408 12:32178863-32178885 TGCCCGGCCTGCAGTGTGCCAGG - Intronic
1102549401 12:113680431-113680453 CTCCCTGGCTGTAGTGGTCCAGG - Intergenic
1103323232 12:120103594-120103616 CACCCTGGCTGGAGTCTGGCCGG - Intronic
1106547463 13:30743000-30743022 CACCCTGTCTTTAGTGTGGCAGG - Intronic
1106862344 13:33923420-33923442 GCTCCTGGCTGTAGTGTGGCTGG + Intronic
1113566969 13:111325084-111325106 CACCCTGGCTGAGGGGTGCCAGG - Intronic
1113567026 13:111325330-111325352 CGTCCTGGCTGTGGTGTGGGGGG + Intronic
1118785099 14:69038990-69039012 TGCCCTGGCTGTGGTGGTCCAGG + Intergenic
1119649633 14:76374552-76374574 CTCCCTGGCTGCTGTGTGCCTGG + Intronic
1119817057 14:77579009-77579031 CGGCCAATCTGTAGTGTGCCTGG - Exonic
1119859768 14:77927742-77927764 CCCCTTGGCTTGAGTGTGCCTGG - Intronic
1125598182 15:40900705-40900727 CACCCTGGCTGTAGTTCACCAGG - Exonic
1128428758 15:67571113-67571135 TGCCCTGTCTGTAATGTGCTAGG + Intronic
1129468257 15:75736314-75736336 CTCCCTGTCTGTGGTGTGCAGGG + Intergenic
1129719141 15:77868353-77868375 CTCCCTGTCTGTGGTGTGCAGGG - Intergenic
1132380136 15:101360566-101360588 CCCCCGGGCAGGAGTGTGCCTGG - Intronic
1132380163 15:101360656-101360678 CCCCCGGGCAGGAGTGTGCCTGG - Intronic
1132380177 15:101360701-101360723 CCCCCGGGCAGGAGTGTGCCTGG - Intronic
1132959094 16:2612347-2612369 AGCTCTGGCTGGAGTGTTCCGGG + Intergenic
1132972154 16:2694322-2694344 AGCTCTGGCTGGAGTGTTCCGGG + Intronic
1134453401 16:14377128-14377150 CATCCTGGCTGTAGCCTGCCAGG - Intergenic
1138063565 16:53916820-53916842 CTCCCTAGCTATAGTGTCCCAGG - Intronic
1139528361 16:67529748-67529770 TGCCCTGGCTGCAGTCTGCGGGG + Exonic
1139658735 16:68405503-68405525 CACCCAGGCTGAAGTGTGCAGGG - Intronic
1141211623 16:81986051-81986073 CGCCCAGGCTGGAGTGTGGTGGG - Intergenic
1141593954 16:85086329-85086351 CTCGCTGCCTGTAGAGTGCCTGG + Intronic
1142007767 16:87697898-87697920 GGCCCTGGCTCTCGTGTGCATGG + Exonic
1144767816 17:17742273-17742295 AGCCCTGTCTGTGGTGAGCCTGG - Intronic
1144785971 17:17831789-17831811 TGCCCTGGCTATAGTGTCCCTGG - Intronic
1149600448 17:57889886-57889908 GGCCATGGCTGTGGTGTGCCTGG + Intronic
1150729456 17:67679210-67679232 CGCCCAGGCTGGAGTGTGGTTGG - Intronic
1150790541 17:68197980-68198002 CGCCCCGGCTCCAGTGTGTCAGG - Intergenic
1152295479 17:79464748-79464770 GGCCCTGGCCTCAGTGTGCCTGG - Intronic
1155507396 18:26547288-26547310 CGCCCTCGCTGCAGTGGTCCCGG + Intronic
1156264185 18:35470945-35470967 CCCCCTTGCTGTAGGGTGACAGG + Intronic
1156602350 18:38624275-38624297 CCACCTGACTTTAGTGTGCCAGG + Intergenic
1163152366 19:15422918-15422940 CGCCCTGGCTGTAGTGTGCCCGG + Exonic
1165718637 19:38063316-38063338 CTTCCTGGCTGTGGTGTTCCGGG + Intronic
1166210818 19:41305687-41305709 CTCCCTGGTTGTAGGGTGGCTGG - Exonic
1166549329 19:43654771-43654793 AGCCTTGGCTGTAGGGTGGCAGG + Intronic
925329140 2:3044787-3044809 CACCCTGGCTGGGGTGTGTCAGG + Intergenic
927956528 2:27211409-27211431 CGCCCTGACTGAAGGGCGCCAGG - Intronic
928660168 2:33493679-33493701 ATCCCTGGCTGTTGGGTGCCGGG - Intronic
932700057 2:73985653-73985675 CGCCCTGGCTGGAGGCCGCCGGG - Intergenic
933775170 2:85767361-85767383 CTCCCAGGCTGTGGTGTGGCAGG - Intronic
934756316 2:96827199-96827221 CCCCCTGGCTGTGGTGCACCAGG - Intronic
936007929 2:108906779-108906801 GGCCCTGGCTGAAGAGTCCCGGG + Intronic
937913637 2:127088321-127088343 TGCCCTGGTGGCAGTGTGCCTGG + Intronic
938390179 2:130898869-130898891 CGGCCTGGCTGCAGTGCACCAGG + Intronic
939346344 2:140970807-140970829 CGTCCAGGCTGCAGTGAGCCAGG - Intronic
946199864 2:218065217-218065239 TGCCCTGCCTGCAGTGGGCCAGG - Intronic
946752839 2:222909935-222909957 TTCCCTAGCTGTAGTGTCCCTGG - Intronic
947905689 2:233760284-233760306 CGCCATGGCTGTGGAGTCCCAGG + Exonic
1169141780 20:3230729-3230751 CACCCTGGATGTAGAGCGCCAGG + Exonic
1174413793 20:50353623-50353645 TGCACAGGCTGTAGCGTGCCTGG + Intergenic
1175745221 20:61451770-61451792 CTCCCTGGCCGTGGTGTGCCAGG + Intronic
1176206442 20:63891217-63891239 GGGCCTGCCTGTGGTGTGCCCGG + Exonic
1179661726 21:42880088-42880110 CGCCCTGGCTGGAGTGCAGCGGG - Intronic
1182764248 22:32747008-32747030 CTCCCTGGCTGGAGGGAGCCTGG + Intronic
1184075449 22:42174414-42174436 GGCCCTTGCTGAAGTGTGCTCGG + Intronic
1184080505 22:42216126-42216148 TGCCCAGGCTGGAGTGTGCAGGG + Intronic
1184245876 22:43235507-43235529 AGCCCTGGCTGTGGCCTGCCTGG + Intronic
1184475592 22:44719615-44719637 CACCCTGGCTGTATTCTGCACGG - Intronic
1185039207 22:48495822-48495844 CGCCCTGAGTGTGGTGAGCCAGG - Intronic
950053095 3:10006892-10006914 CGCCCAGGTTGTCGTCTGCCCGG + Intronic
963132290 3:141869491-141869513 CACCCTGGCTGGAGTGTGGTGGG + Intergenic
966379959 3:179335165-179335187 CTCCCGGGCTGTAGTCTCCCAGG + Exonic
967189338 3:186972285-186972307 CACCCAGGCTGGAGTGCGCCTGG + Intronic
967950347 3:194835549-194835571 CGTCCAGGCTGTAGTGTAGCTGG - Intergenic
968828150 4:2914800-2914822 CGCCCTGCCTGCAGCCTGCCTGG + Intronic
970651737 4:18186175-18186197 CCCCCTGCCTGTAGCCTGCCTGG - Intergenic
978221220 4:106276836-106276858 TGCCCAGGCTGGAGTGTGCCTGG - Intronic
980273080 4:130612090-130612112 CGCCCAGGCTGGAGTGCCCCTGG - Intergenic
986006406 5:3672412-3672434 GGCCATGGCTGGAGTGTGCAGGG + Intergenic
986342799 5:6805573-6805595 CCCCCTGGCTGGAGTTTGGCCGG - Intergenic
986345405 5:6830228-6830250 CTCTCTGGCTCTAGCGTGCCTGG - Intergenic
986517460 5:8579397-8579419 TGCCCTGGCAGTTGTGTGCAGGG + Intergenic
988535419 5:32063570-32063592 CGCCCTGGCTGGAGGGAGACAGG - Intronic
990748863 5:58990145-58990167 CGCCCTAGCTGTATGGTGTCAGG + Intronic
993916653 5:93751949-93751971 CTGCCTGACTGTGGTGTGCCTGG - Intronic
997514481 5:134477265-134477287 CTCCCAGGCTGGAGTGTGGCAGG + Intergenic
1000442687 5:161282174-161282196 AGCCCTGGCAGGAGTGTGTCTGG + Intergenic
1002257782 5:177971347-177971369 CGCCCGGGCTGGAGCGTCCCCGG + Intergenic
1002342631 5:178526998-178527020 CGTCCTGGCTGTAATTGGCCTGG - Intronic
1002520912 5:179792954-179792976 CGCCCTGCCTGGAGTGCCCCTGG - Intronic
1003112524 6:3261631-3261653 CTCACTGGCCGCAGTGTGCCTGG + Intronic
1004427682 6:15517344-15517366 CGGCCTGGCAGTTCTGTGCCTGG + Intronic
1006204741 6:32330709-32330731 CGCCCAGGCTGGAGTGTGGTAGG + Intronic
1015764294 6:136699558-136699580 AGCCCAGGCTGTAGTGGGCGAGG - Intronic
1017008830 6:150048616-150048638 CGCCCAGGGTGTAGTGTACTGGG + Intergenic
1017743168 6:157424953-157424975 CCCTCTGGCTGCAGTGTGGCTGG - Intronic
1020266472 7:6563815-6563837 TGCCCAGGCTGGAGTGCGCCCGG + Intergenic
1020413176 7:7915644-7915666 GGCCCTGGATGTAGACTGCCTGG + Intronic
1021949916 7:25764549-25764571 CGCCCAGGCTGGAGTGTGATGGG - Intergenic
1025236301 7:57237022-57237044 GGCCCTGGGTGGAGTGTGCTGGG - Intergenic
1025654666 7:63508985-63509007 CACCCAGGCTGGAGTGTGGCGGG + Intergenic
1035023074 7:155809995-155810017 CGGGCTCGCTGTAGTGTCCCCGG - Intronic
1037744364 8:21631043-21631065 GGCCCTGTGTGTAGTGAGCCAGG - Intergenic
1037946975 8:22995838-22995860 CGCAGAGGCTGTAGTGTTCCAGG + Intronic
1039981426 8:42412203-42412225 CGGCCAGGCTGTCGTGTGCCAGG + Intergenic
1044995818 8:97837229-97837251 CGCCCAGGCTGTGGAGTGCGTGG + Intronic
1048276795 8:133072154-133072176 AGCCCTGGTTGCAGTCTGCCTGG + Intronic
1049917332 9:330889-330911 TGCCCTGGCTGCAGTGGGCAAGG - Intronic
1051720849 9:20035689-20035711 CGTCCAGGCTGCAGTGAGCCAGG + Intergenic
1053198586 9:36137622-36137644 AGCCCTTCCTGTAGTGGGCCGGG + Intronic
1053545216 9:39016061-39016083 CGCCCAGGCTGGAGTGTGGTTGG - Intergenic
1055960783 9:81818280-81818302 CGCCCAGGCTGCAGTGTGAGGGG + Intergenic
1056649828 9:88449166-88449188 TGGCCTGGCTGCAGTGTGCCAGG + Intronic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1060547893 9:124471358-124471380 GGCCCAGGCTGGACTGTGCCAGG + Intronic
1186301590 X:8205204-8205226 CTCGCTTGCTGTAGTGAGCCAGG + Intergenic
1189828725 X:44948257-44948279 CGTCCTGGCTGTTTTATGCCTGG + Intronic
1195410782 X:104566387-104566409 CACACTGGCTGTAGGGTTCCCGG + Exonic
1197764795 X:130053096-130053118 CGCCCAGGCTGGAGTGTAGCAGG - Intronic