ID: 1163153284

View in Genome Browser
Species Human (GRCh38)
Location 19:15427287-15427309
Sequence GCCCTGGCCAAGATGATGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 0, 3: 14, 4: 190}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163153284_1163153295 4 Left 1163153284 19:15427287-15427309 CCGCCCATCATCTTGGCCAGGGC 0: 1
1: 1
2: 0
3: 14
4: 190
Right 1163153295 19:15427314-15427336 GGGCTTGGCCCTGGTGGGTTGGG 0: 1
1: 1
2: 3
3: 37
4: 300
1163153284_1163153299 16 Left 1163153284 19:15427287-15427309 CCGCCCATCATCTTGGCCAGGGC 0: 1
1: 1
2: 0
3: 14
4: 190
Right 1163153299 19:15427326-15427348 GGTGGGTTGGGAGGTCCACCAGG 0: 1
1: 0
2: 1
3: 21
4: 210
1163153284_1163153301 27 Left 1163153284 19:15427287-15427309 CCGCCCATCATCTTGGCCAGGGC 0: 1
1: 1
2: 0
3: 14
4: 190
Right 1163153301 19:15427337-15427359 AGGTCCACCAGGCCGAGACTGGG 0: 1
1: 0
2: 0
3: 5
4: 111
1163153284_1163153292 -2 Left 1163153284 19:15427287-15427309 CCGCCCATCATCTTGGCCAGGGC 0: 1
1: 1
2: 0
3: 14
4: 190
Right 1163153292 19:15427308-15427330 GCTTTTGGGCTTGGCCCTGGTGG 0: 1
1: 1
2: 1
3: 14
4: 223
1163153284_1163153291 -5 Left 1163153284 19:15427287-15427309 CCGCCCATCATCTTGGCCAGGGC 0: 1
1: 1
2: 0
3: 14
4: 190
Right 1163153291 19:15427305-15427327 AGGGCTTTTGGGCTTGGCCCTGG 0: 1
1: 1
2: 0
3: 22
4: 216
1163153284_1163153294 3 Left 1163153284 19:15427287-15427309 CCGCCCATCATCTTGGCCAGGGC 0: 1
1: 1
2: 0
3: 14
4: 190
Right 1163153294 19:15427313-15427335 TGGGCTTGGCCCTGGTGGGTTGG 0: 1
1: 0
2: 4
3: 32
4: 385
1163153284_1163153293 -1 Left 1163153284 19:15427287-15427309 CCGCCCATCATCTTGGCCAGGGC 0: 1
1: 1
2: 0
3: 14
4: 190
Right 1163153293 19:15427309-15427331 CTTTTGGGCTTGGCCCTGGTGGG 0: 1
1: 0
2: 1
3: 12
4: 181
1163153284_1163153296 7 Left 1163153284 19:15427287-15427309 CCGCCCATCATCTTGGCCAGGGC 0: 1
1: 1
2: 0
3: 14
4: 190
Right 1163153296 19:15427317-15427339 CTTGGCCCTGGTGGGTTGGGAGG 0: 1
1: 3
2: 6
3: 47
4: 368
1163153284_1163153300 26 Left 1163153284 19:15427287-15427309 CCGCCCATCATCTTGGCCAGGGC 0: 1
1: 1
2: 0
3: 14
4: 190
Right 1163153300 19:15427336-15427358 GAGGTCCACCAGGCCGAGACTGG 0: 1
1: 0
2: 1
3: 11
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163153284 Original CRISPR GCCCTGGCCAAGATGATGGG CGG (reversed) Exonic
900425444 1:2576307-2576329 GCCCTGGCCAAGGGGAAGGCCGG - Intergenic
900473614 1:2866169-2866191 GCCTTGGCCAAGCAGATGGGGGG - Intergenic
900690357 1:3977113-3977135 ACCTTGGCCAAGAAGTTGGGTGG + Intergenic
901512549 1:9724683-9724705 GCCCTTGCCCTGATAATGGGTGG - Intronic
901624912 1:10618364-10618386 GCCCTGGCCATCATCATGGCAGG + Exonic
902367998 1:15989949-15989971 GCACTGGCCCAGATGCTGGCTGG + Intergenic
902813587 1:18903159-18903181 GTCCTGGCCAAGAAGCTGGAAGG - Intronic
904489941 1:30852343-30852365 GCCCTGGGCAGGGTTATGGGAGG + Intergenic
905481593 1:38265641-38265663 GCCCAGGCCAAGAAGATTTGGGG + Intergenic
905792763 1:40799048-40799070 GCCCTGGCCAAGACAGAGGGAGG - Intronic
907029655 1:51158008-51158030 ACCCTGGCAGAGATGCTGGGGGG - Intergenic
909085452 1:71165474-71165496 GTCCTGGGAAACATGATGGGTGG - Intergenic
910674143 1:89800237-89800259 ACTCTAGCCAAGATGATGGCAGG + Intronic
912370711 1:109172019-109172041 CCCCTGGCCAAGGTGGAGGGTGG + Intronic
912451058 1:109768123-109768145 GCCCAGGCCAGGGTGGTGGGAGG - Intronic
912512326 1:110197944-110197966 TGCCTGGCCAGGATGGTGGGAGG + Intronic
915276623 1:154793291-154793313 TTCCTGGCCAAGAGGAGGGGTGG - Intronic
915510898 1:156386459-156386481 GCCCTTGCTAAGAGGAAGGGAGG + Intergenic
915601816 1:156927351-156927373 GCCCTTGCCGAGATGGTAGGGGG - Intronic
916576651 1:166072929-166072951 GCTCTGGGCAGGAAGATGGGAGG - Intronic
919596539 1:199570746-199570768 GCCCTGGCTAAGAGGAAGGAAGG - Intergenic
922774063 1:228207011-228207033 GCCCTGGCCAGGAAGAAGTGTGG - Intronic
923096213 1:230777329-230777351 AGCCTGCCCAAGGTGATGGGTGG + Intronic
923553146 1:234980045-234980067 GCTCTGGCCAAGCAAATGGGAGG + Intergenic
923553162 1:234980117-234980139 CCCCTGTCCAAGGTGATGGAGGG + Intergenic
1063384306 10:5606528-5606550 GCACTGGGTAAGATGGTGGGTGG - Intergenic
1073476411 10:103756679-103756701 GCCCTGGCCAAGATGGCAGAAGG - Intronic
1074523579 10:114246071-114246093 CCCCCGCCCAAGATGATTGGAGG + Intronic
1077109691 11:856642-856664 GTCCAGGCCCAGATGCTGGGTGG + Intronic
1077311386 11:1890427-1890449 GCCCGGAAGAAGATGATGGGAGG - Exonic
1079160871 11:17993122-17993144 GCACTGGCCAAGAAGATGGCTGG + Intronic
1079689634 11:23404509-23404531 GCCCTGGCCAAGATGATGGACGG + Intergenic
1084731296 11:71075411-71075433 GCGCTTGCCCAGATGGTGGGTGG - Intronic
1088110807 11:106259229-106259251 GCCCTGGAGAACATGAAGGGAGG - Intergenic
1090078338 11:123593665-123593687 GCTCTGGGCAACATCATGGGGGG + Intronic
1090208015 11:124896471-124896493 GCCCAGGCCAGGATGAAGTGTGG + Intronic
1090381795 11:126332549-126332571 TCCCTGGCCCAGAAGAAGGGAGG + Intronic
1090395025 11:126413438-126413460 GCGCTGGCAGAGATGATGGTGGG + Intronic
1091101348 11:132876717-132876739 GCCCTGCCCAAAACGATGTGCGG + Intronic
1092921076 12:13232413-13232435 GCCCTGGCCAAGATCTTGACTGG + Intergenic
1096263015 12:50104581-50104603 GCCATCGCCAAGATCGTGGGTGG + Exonic
1097712883 12:62934693-62934715 GCCGTGGCCAATTTCATGGGCGG - Exonic
1097872323 12:64611211-64611233 GCCCGGGCCAGGAAGAGGGGAGG - Intronic
1098279793 12:68850901-68850923 TCCATGGACAAGATGATGGATGG - Intronic
1098506058 12:71251751-71251773 TCTCTGGCCAAGATGACTGGTGG + Intronic
1101492101 12:105219073-105219095 GACATGGCACAGATGATGGGAGG + Intronic
1102042649 12:109810532-109810554 CCCCTGGCGAAGAGGAAGGGAGG - Intronic
1103414808 12:120736980-120737002 GCCCAGGTGAAGAAGATGGGCGG + Exonic
1104196465 12:126543795-126543817 GCCCTGCCCCAGCTGCTGGGAGG + Intergenic
1105952862 13:25246954-25246976 GCCCTTGCCAACTTGATGGAAGG - Exonic
1111581630 13:90230564-90230586 GGCCTGGCCATGAGGATGGCGGG + Intergenic
1112495301 13:99899252-99899274 CCTCTGGCCAAAATGGTGGGGGG - Intergenic
1113873659 13:113580962-113580984 GCTCTGGCTAAGATGATGTCAGG - Intergenic
1122406534 14:101504338-101504360 GCTCAGTCCAAGATGCTGGGAGG + Intergenic
1122695326 14:103549572-103549594 GCTCTGGCCTAGGTGAGGGGTGG - Intergenic
1124690499 15:31817734-31817756 GCCCAGGCCAAGGGCATGGGTGG - Intronic
1125159585 15:36627745-36627767 GCCCTGGCCCTGGTGATGGTTGG - Intronic
1126340741 15:47638273-47638295 GCCTTGGTAAAGAAGATGGGAGG + Intronic
1127360239 15:58238699-58238721 GTCCTGGCCAAGGTGGTGTGAGG - Intronic
1127482645 15:59391546-59391568 GCCCTCTCCAAGATGATTTGAGG + Intronic
1127853521 15:62935723-62935745 GCCATGGCCAAGACTATGGCTGG - Intergenic
1128145255 15:65329303-65329325 CCCGTGGCCAAGGTGAAGGGGGG + Intronic
1129393285 15:75231202-75231224 GACCATGCCAAGATGATGGAGGG - Intergenic
1130149090 15:81297769-81297791 GCCCTGTGCTAGATGCTGGGGGG + Intronic
1131507436 15:93030489-93030511 GCCCTGGCGATGAGGATGGGCGG + Intergenic
1133051591 16:3120254-3120276 GCCCTGGCCATGCTGATGCTGGG + Exonic
1135970893 16:27071074-27071096 GCACAGGCCAAGTTGCTGGGAGG - Intergenic
1136398124 16:30004112-30004134 GCCCTGGGCTAGATGCTGAGTGG - Intronic
1137578558 16:49620267-49620289 GCCCTGGCCAACCTGGAGGGAGG - Intronic
1139699141 16:68696530-68696552 AGCCTGGCCAACATGGTGGGAGG + Intronic
1140020656 16:71235229-71235251 GTCCTGGGCAAGAACATGGGTGG + Intergenic
1140285235 16:73596556-73596578 GCCCTGGGCAACATGTTTGGAGG - Intergenic
1140896606 16:79330481-79330503 GCTCTGGCCATGATCATGGCTGG + Intergenic
1142140305 16:88469822-88469844 GCCCTGGCCAAGGTGATGTCTGG - Intronic
1143100782 17:4503604-4503626 GCCCTGGCCTTGTTTATGGGTGG + Intronic
1144614478 17:16756819-16756841 GCTCTGGCATTGATGATGGGTGG + Intronic
1144731295 17:17527970-17527992 GCCCTGGGCCAGGTGGTGGGGGG - Intronic
1144898226 17:18558855-18558877 GCTCTGGCATTGATGATGGGTGG - Intergenic
1145134143 17:20386860-20386882 GCTCTGGCATTGATGATGGGTGG + Intergenic
1149472809 17:56932813-56932835 GGCCAGGCCAACATGATGGTAGG + Intergenic
1151072001 17:71225286-71225308 GCCATGGCCAAGGAGGTGGGTGG + Intergenic
1151656962 17:75500669-75500691 GGCCTGGGCAGGATGGTGGGTGG + Exonic
1152521328 17:80858462-80858484 TCCCTGGCCTAGATGATTGAGGG - Intronic
1155077602 18:22374297-22374319 GTGCTGGCCAAGACGATGGCTGG - Intergenic
1155342515 18:24826978-24827000 GCACTGGCCTAGTTGCTGGGAGG - Intergenic
1156490253 18:37491805-37491827 GCTGTGGCCAAGAAGGTGGGCGG + Intronic
1160004040 18:75055023-75055045 GCCCTGGCCAATGGGAAGGGGGG - Intronic
1161016414 19:1985849-1985871 GCCCTGGCCCAGGTGGTGAGCGG - Exonic
1161055946 19:2190687-2190709 GCCTTGGCCCAGAGGAGGGGTGG + Intronic
1161162100 19:2767354-2767376 GCCCAGGGCCACATGATGGGGGG - Intronic
1162602056 19:11676861-11676883 GCCCTGTCCAGGAGGAAGGGAGG - Intergenic
1163153284 19:15427287-15427309 GCCCTGGCCAAGATGATGGGCGG - Exonic
1163665927 19:18604123-18604145 GCCCAGGCCAAGCTGGCGGGTGG - Intronic
1163762024 19:19142454-19142476 GTCCTAGACAAGATGATGGGCGG - Intergenic
925408868 2:3627289-3627311 ACACTGGGCACGATGATGGGGGG + Intronic
925995591 2:9290140-9290162 TCCCTGGACAAGGTGACGGGAGG - Intronic
927797906 2:26067503-26067525 GCCATGGCACAGATGATGGATGG + Intronic
928197215 2:29224584-29224606 GCCCTGGCCCATGTGTTGGGGGG - Intronic
928201886 2:29252596-29252618 GCCCTGGCCCAGAGGCTGGGAGG + Intronic
929606745 2:43239804-43239826 GGACTGGCCAAGGTGTTGGGTGG + Intronic
935131322 2:100263233-100263255 GCTCTGTGCAAGATAATGGGGGG + Intergenic
938062319 2:128263157-128263179 GCGCTGGCCACGAGGCTGGGTGG + Intronic
940335186 2:152519336-152519358 GCCCTGTGCAACATGCTGGGTGG - Intronic
944850491 2:203714362-203714384 ACCCTGCCCAACATTATGGGCGG + Intronic
947629804 2:231644762-231644784 GCACTGGCCAGGATGGTTGGGGG - Intergenic
947973502 2:234344383-234344405 GCCCTGGCCAGGGTGAATGGGGG - Intergenic
948452137 2:238082400-238082422 GCCATGGCAGGGATGATGGGGGG + Intronic
1169067533 20:2702456-2702478 TCCCTGATCAAGATGAGGGGAGG - Intronic
1170632127 20:18074690-18074712 GCCATGGCCAAGATGGTGGAGGG - Intergenic
1171334440 20:24370825-24370847 GCCCTGGGCCAGCTGCTGGGTGG - Intergenic
1171480616 20:25453276-25453298 GCCCTGGGCAAGATGGAGGTGGG - Exonic
1172619185 20:36307993-36308015 GCCCTGGCCTGGCCGATGGGTGG + Intronic
1172779391 20:37426815-37426837 GCCCTGGTCAAGCTCATAGGTGG + Intergenic
1173384513 20:42575208-42575230 CCCTTGGTCAAGGTGATGGGGGG + Intronic
1173554148 20:43953663-43953685 GCCCTGTGGAAGATGGTGGGAGG + Intronic
1173639251 20:44588188-44588210 GCACTGGGCAAGGTGATAGGTGG + Intronic
1175218510 20:57404116-57404138 GCTCTGGCCCCGATGATGTGGGG + Intronic
1175865531 20:62174241-62174263 GCCCTCGCCATGCTGGTGGGGGG + Intronic
1179979043 21:44887029-44887051 CCCCTGGCCATGGTGATGGATGG - Intronic
1180140316 21:45889531-45889553 GCCCTGGCCATGAGGAGGGGAGG - Intronic
1180835639 22:18928237-18928259 GCCCTGGGCATGATGAGGGGTGG - Intronic
1180936051 22:19625940-19625962 GCCCTGGCCCAGGTGGCGGGAGG - Intergenic
1181044910 22:20209909-20209931 GCCCTGGCCTAGGTGCTCGGTGG - Intergenic
1181957275 22:26597092-26597114 GACCTGTCCAAGATTATGTGAGG + Intergenic
1182741540 22:32571463-32571485 GCCCTGGCCAAAATGATAGATGG - Intronic
1183165946 22:36147528-36147550 GTCCTGTCCAAGATGAGGAGAGG - Intronic
1183172273 22:36197218-36197240 GTCCTGTCCAAGATGAGGGGAGG - Intronic
1183180983 22:36259526-36259548 GTCCTGTCCAAGACGAGGGGAGG + Intronic
1183409566 22:37646946-37646968 GCCCTGGGCAGGAGGTTGGGGGG + Intronic
1183454178 22:37912481-37912503 GTCCTGGCCAAGGTGAGAGGGGG + Exonic
1203285728 22_KI270734v1_random:153536-153558 GCCCTGGGCCTGATGAGGGGTGG - Intergenic
950239028 3:11351320-11351342 GGCCTGACCTAGATGAGGGGTGG + Intronic
950744168 3:15073792-15073814 ACCCTGGCCAAGCAGAAGGGGGG - Exonic
951667778 3:25146331-25146353 GTCGTGGCCAAGATGATATGTGG - Intergenic
952258587 3:31716657-31716679 GCTCTGGCCTAGATGCTAGGGGG + Intronic
952962631 3:38602318-38602340 GCCCTGGCCCATCTGAAGGGTGG - Intronic
953701362 3:45198412-45198434 GTCCTGGCCAGGAGGAGGGGTGG + Intergenic
954299041 3:49689548-49689570 GCCGTAGCCAAGAGGTTGGGCGG + Exonic
954657624 3:52206002-52206024 ACCCTGGCTAAGATGATGCCAGG + Exonic
958727984 3:97929447-97929469 AACCTGGGCAGGATGATGGGGGG - Intronic
962330417 3:134473040-134473062 TTCCTGGCCCAGATGATGGATGG - Intergenic
962446476 3:135470376-135470398 GCCCTGGGCAAGATGAAGACAGG + Intergenic
963290641 3:143483630-143483652 GCCCTGTCCAAGATCCTGAGAGG - Intronic
964653958 3:159045410-159045432 CCCCTGGGCAAGAGGCTGGGTGG + Intronic
965544765 3:169904051-169904073 GGCCTGGCCATGGGGATGGGCGG - Intergenic
967778916 3:193414503-193414525 CCTCTGGCCAATATGATGGGAGG - Intronic
968052370 3:195663756-195663778 GCCATGGTCGAGGTGATGGGCGG + Intergenic
968301743 3:197622176-197622198 GCCATGGTCGAGGTGATGGGCGG - Intergenic
968654112 4:1771320-1771342 GGCCTGGCCATGGCGATGGGGGG + Intergenic
969618663 4:8268129-8268151 GCCCTGGCCAAGGTTGAGGGAGG + Intergenic
969946992 4:10793573-10793595 GCCCAGGCCAAGAGAATCGGGGG + Intergenic
969955336 4:10884059-10884081 GTCCTGGCCAAGTAGATGGATGG + Intergenic
980017503 4:127668976-127668998 GCCCTGACAAAGATAATGGTTGG + Intronic
980625638 4:135371720-135371742 GACCTTGCCAAGATCATGGCAGG - Intergenic
981604724 4:146528945-146528967 GCGGTGGCCAAGAGTATGGGCGG + Intergenic
984588649 4:181591648-181591670 GCCCCGGCTGAAATGATGGGAGG - Intergenic
985247933 4:187995671-187995693 ACCCTGGCGGAGCTGATGGGTGG + Intergenic
985498580 5:225551-225573 GCCGTGGTCGAGGTGATGGGCGG + Exonic
988900708 5:35729423-35729445 ACTCTGGCCAAGAAGATGGAGGG + Intronic
990374501 5:55155756-55155778 GCCTTGGCCAGCATGATGGAAGG - Intronic
996393113 5:122985269-122985291 GCCCTGGGCCAGAGGATGAGGGG + Intronic
997645592 5:135479485-135479507 GGCCTGGCTAGGATGAAGGGAGG - Intergenic
999191181 5:149748637-149748659 GAGCTGGCCAACATGATGGGAGG + Intronic
999391824 5:151198957-151198979 CCACTGGCCAAGGTGGTGGGGGG - Intronic
1001517893 5:172369405-172369427 CCCCTGGCCTAGAACATGGGTGG + Intronic
1002321755 5:178380683-178380705 GCCCTGGCTAAGAGGACGGCCGG + Intronic
1002535540 5:179873613-179873635 GCCCTGGCCAAGAAGATTCAGGG + Intronic
1002613626 5:180436980-180437002 GACCTGGCCAAGCGGATGGAAGG - Intergenic
1003301097 6:4883515-4883537 GCCATGGCCATGAGTATGGGTGG - Intronic
1003871253 6:10404804-10404826 GCCCTGGCCGGGATGAGGGCCGG - Intronic
1015401654 6:132794758-132794780 GGCCTGGCCAACATGGTGGACGG + Intronic
1016449975 6:144172467-144172489 GCTTTGACCAAGAGGATGGGAGG - Intronic
1016553810 6:145312754-145312776 CTCCTGTCCAAGATGATGCGGGG + Intergenic
1018273909 6:162109464-162109486 GCCCTGGCCAGGACGATGAGGGG + Intronic
1018424674 6:163669710-163669732 ACCCTGGCCAATAAGATGGAGGG - Intergenic
1019791024 7:3014083-3014105 GCCCAGGCCAAGAGGAAGGCAGG + Intronic
1020014028 7:4820714-4820736 GCCCTGGCCATGAGGTTGTGGGG - Intronic
1022010311 7:26302853-26302875 AGCATGGCCAACATGATGGGAGG + Intronic
1025079712 7:55970877-55970899 TCCCAGGCCAAGCTGATGGTGGG + Intronic
1025912800 7:65841280-65841302 GGCCTGGACAGGCTGATGGGAGG - Intergenic
1026787046 7:73308420-73308442 CACCTGGCCAAGGTGAGGGGAGG - Exonic
1029437763 7:100572519-100572541 ACCCTGGCAGACATGATGGGGGG + Exonic
1033188263 7:139250425-139250447 AGCCTGGCCAAAATGACGGGAGG - Intronic
1033410422 7:141112818-141112840 ACCCTGGCCAAGTGGATGAGTGG - Intronic
1033419091 7:141189937-141189959 GCTCTGCCCAGGATGATGTGGGG - Intronic
1035223993 7:157423745-157423767 GCCCTGACCAACCTGATGGAGGG - Intergenic
1036239560 8:7070605-7070627 GCGGTGGCCAAGAGTATGGGCGG + Intergenic
1036816893 8:11909011-11909033 GCGGTGGCCAAGAGTATGGGTGG - Intergenic
1039708745 8:40034079-40034101 GCCCTGGCAAACATTATGGCCGG + Intergenic
1042323601 8:67504655-67504677 GCCCTGGGCATGAGGATGTGTGG - Intronic
1042567702 8:70129277-70129299 GTCCAGGCCAATATGATTGGTGG - Intronic
1043856405 8:85270074-85270096 GGGCTGGCCAATCTGATGGGTGG + Intronic
1048887297 8:138918593-138918615 GCCCTGTCCACCATGGTGGGTGG - Intergenic
1049276663 8:141723483-141723505 GCCCTGGGCAGGGTGGTGGGCGG - Intergenic
1049423129 8:142525571-142525593 GCCTTGGCCAGCCTGATGGGTGG - Intronic
1052610980 9:30773627-30773649 GGCCTGGCCACGAGGATGGCCGG + Intergenic
1054894153 9:70288386-70288408 GCCCTGGCAAATATGATAAGGGG - Intronic
1058472866 9:105298995-105299017 GGCCTGGCCAGGAAGAGGGGTGG + Intronic
1060033908 9:120238694-120238716 GCTCTGAGCAAGATGATGGTGGG - Intergenic
1060484100 9:124036422-124036444 GCTCTGTCCACCATGATGGGAGG + Intergenic
1060822809 9:126671373-126671395 GCCCGGGCCCAGCTGCTGGGAGG - Intronic
1061711294 9:132489786-132489808 GCCCAGGCCAGGATGAGAGGTGG - Intronic
1188870133 X:35362238-35362260 GCACTGGCAAAGAAGATGAGTGG + Intergenic
1189155706 X:38754981-38755003 GCCCTGGTCAGGATCTTGGGTGG - Intergenic
1192227497 X:69239107-69239129 GCCCTTGCCAAGCTGAGTGGAGG + Intergenic
1199429353 X:147741295-147741317 GCCCTGGGAAAGGTGATGAGTGG - Intergenic