ID: 1163153411

View in Genome Browser
Species Human (GRCh38)
Location 19:15427844-15427866
Sequence CACCCACATCTGCCCCTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 3, 3: 19, 4: 232}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163153411_1163153412 -6 Left 1163153411 19:15427844-15427866 CCAGACAGGGGCAGATGTGGGTG 0: 1
1: 0
2: 3
3: 19
4: 232
Right 1163153412 19:15427861-15427883 TGGGTGCTCTGCACACTAAAAGG 0: 1
1: 0
2: 0
3: 18
4: 179
1163153411_1163153414 13 Left 1163153411 19:15427844-15427866 CCAGACAGGGGCAGATGTGGGTG 0: 1
1: 0
2: 3
3: 19
4: 232
Right 1163153414 19:15427880-15427902 AAGGCAGGATCTCCCCACCTTGG 0: 1
1: 0
2: 3
3: 39
4: 383
1163153411_1163153413 -2 Left 1163153411 19:15427844-15427866 CCAGACAGGGGCAGATGTGGGTG 0: 1
1: 0
2: 3
3: 19
4: 232
Right 1163153413 19:15427865-15427887 TGCTCTGCACACTAAAAGGCAGG 0: 1
1: 0
2: 1
3: 9
4: 117
1163153411_1163153418 27 Left 1163153411 19:15427844-15427866 CCAGACAGGGGCAGATGTGGGTG 0: 1
1: 0
2: 3
3: 19
4: 232
Right 1163153418 19:15427894-15427916 CCACCTTGGCCTTCATTCTCAGG 0: 1
1: 0
2: 0
3: 22
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163153411 Original CRISPR CACCCACATCTGCCCCTGTC TGG (reversed) Intronic
900122676 1:1055543-1055565 CACCCAGATCGGCCCTGGTCTGG - Exonic
900149356 1:1171433-1171455 CATCCCCATCAGCTCCTGTCAGG + Intergenic
901942356 1:12673041-12673063 AACACACATCAGCGCCTGTCAGG + Intergenic
902210600 1:14901790-14901812 CCCCCACAGCTGCCTCTCTCTGG + Intronic
903331104 1:22597645-22597667 CCTCCACACCTGCCCCTCTCGGG + Intronic
903453379 1:23470348-23470370 CACCCCCTTCTGCCCCAGCCTGG - Intronic
903659723 1:24969730-24969752 CAGCCAGATCAGCCCCTCTCCGG + Intergenic
903768417 1:25749320-25749342 AACCCACCTCTTCTCCTGTCAGG - Exonic
904255534 1:29252173-29252195 CACCCACATCTCACCATTTCAGG + Intronic
904334453 1:29787690-29787712 CTCGCTCATCTCCCCCTGTCTGG + Intergenic
905240184 1:36576273-36576295 CACCCCCATCAGCTCCTATCTGG - Intergenic
905380579 1:37558922-37558944 TACACACATCTGCCTCTTTCTGG + Intronic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
907364360 1:53946534-53946556 CACCTACCTGTGCCCCTGCCCGG - Exonic
908682239 1:66675133-66675155 CACCTACATCTGCCCGTTTAAGG + Intronic
911949410 1:104153728-104153750 CTCCTACATCTGCCTCTGTCTGG - Intergenic
913246248 1:116872710-116872732 CCCCCAGATCTGCCCATTTCAGG + Intergenic
915513958 1:156402052-156402074 CCGCCCCTTCTGCCCCTGTCTGG + Intergenic
922781453 1:228256300-228256322 CTCCCGCTTCTGCCACTGTCAGG - Intronic
1062984944 10:1759946-1759968 CACCCACCTCTTCACCTGTGTGG - Intergenic
1063331262 10:5161738-5161760 CACTCAAATCTGCCTCTCTCAGG + Intergenic
1064352426 10:14588557-14588579 CACCCACATCTGGCTCTTTGTGG + Intronic
1065183132 10:23146444-23146466 AACCCACTTCTGCCCCAGCCAGG - Intergenic
1066461103 10:35613048-35613070 CCCTCCCATCTGCCCCTCTCAGG - Intergenic
1069890070 10:71647023-71647045 CACCCCCAGCTGCCCATGGCTGG + Intronic
1070397015 10:76020158-76020180 GACCCACATCTGGTCCAGTCTGG - Intronic
1075170098 10:120105209-120105231 CACCCTCATCTGTCCCTGAGAGG - Intergenic
1076187829 10:128462682-128462704 CGCCCGCAGCTGCCCCTGCCAGG + Intergenic
1076601439 10:131659217-131659239 CACCCACACCTGCACCTGCCAGG - Intergenic
1076809461 10:132879067-132879089 CACCCAAAACTGCCTCTGCCTGG - Intronic
1077046857 11:550505-550527 AACCCACATATGCACCTGTGAGG + Intronic
1077050156 11:562901-562923 CCCCCATATCTGCCCACGTCAGG - Intronic
1077050211 11:563073-563095 CCCCCATATCTGCCCACGTCAGG - Intronic
1080581834 11:33650749-33650771 CACACGCACCTGCCCCTCTCCGG + Intronic
1083571866 11:63765431-63765453 CACCCACACCTCCCCCAGACTGG + Intronic
1083732466 11:64660260-64660282 GACCCACACCTGCCTCTGTCTGG - Intronic
1085050109 11:73376033-73376055 GAGCCACCTCTGCCCCTTTCTGG - Intergenic
1085274635 11:75290414-75290436 CAGCCACATCTACCCCCGGCTGG + Intronic
1088326487 11:108606267-108606289 CCCCCACACCAGTCCCTGTCAGG + Intergenic
1089359670 11:117877341-117877363 CATCCACCTCTGGCCCTGCCAGG + Intronic
1090080627 11:123609882-123609904 CTCCCAAAACTGCCACTGTCAGG + Exonic
1090349332 11:126097523-126097545 CGGCCACATCAGCCACTGTCAGG + Intergenic
1090385634 11:126356186-126356208 CTCCCACAACTACCCCGGTCAGG + Intronic
1091592961 12:1856190-1856212 CACCCAGACCTGGCCCTGGCCGG - Exonic
1091696815 12:2633329-2633351 CACCCACTCCTGCCCCTGGTGGG + Intronic
1096777769 12:53974368-53974390 CCCCCACCTCTCCCCCTCTCTGG - Intronic
1097147990 12:56954752-56954774 CACCCTCATCTTCCTCTTTCTGG - Intronic
1097949880 12:65415856-65415878 CCCTCACTTCTGCCCCTGGCAGG + Intronic
1099483822 12:83202230-83202252 TACCCACATCTGCTCGTGTTGGG + Intergenic
1104328294 12:127820637-127820659 CACCTGCATCTGCTCCTTTCCGG - Intergenic
1104713437 12:131001753-131001775 CACCCTTCTCTGCCCCTGCCTGG - Intronic
1105203789 13:18202319-18202341 CCCCCACCTCTGCCCCTGCAGGG - Intergenic
1106552891 13:30787086-30787108 CACCAACCTCTCCCCCTGCCAGG - Intergenic
1107570352 13:41650901-41650923 CACTCACATTGGCCCCTGCCTGG - Intronic
1108004838 13:45935843-45935865 AACCCACAACTGCCACAGTCAGG + Intergenic
1112581132 13:100677148-100677170 CACCCACACCGGGGCCTGTCAGG - Intergenic
1113465793 13:110512149-110512171 CACACACATCAGCCGCTGCCAGG + Exonic
1113969463 13:114177363-114177385 CACCCACAGCTGCCACCCTCAGG - Intergenic
1116396753 14:44455740-44455762 CTCCCACATGTGCCCCCGTCAGG + Intergenic
1118310644 14:64690249-64690271 CACCCTCATCTGCCCCGGTGCGG + Intergenic
1118590557 14:67397679-67397701 CACCATCACCTGCCCCTGCCTGG - Exonic
1121507972 14:94490885-94490907 CCACCACTCCTGCCCCTGTCGGG + Intronic
1122239029 14:100349647-100349669 GACCCAGCTCTGCCCCTGCCTGG - Intronic
1123662211 15:22574386-22574408 CAGCCACAGCAGCCTCTGTCTGG - Intergenic
1124262007 15:28201121-28201143 CAGCCACAGCAGCCTCTGTCTGG + Intronic
1124316013 15:28668668-28668690 CAGCCACAGCAGCCTCTGTCTGG - Intergenic
1124345925 15:28921551-28921573 CATCCACACCTGCCCCTCTGTGG + Intronic
1124652143 15:31482262-31482284 CCCCCACACCTGCATCTGTCTGG - Exonic
1125338638 15:38653038-38653060 CAGCCTCCTCTGCCCTTGTCTGG + Intergenic
1125749646 15:42019839-42019861 GAGCTGCATCTGCCCCTGTCAGG - Intronic
1127840937 15:62831059-62831081 CTCCCACATCTTCCGCTGCCTGG - Intronic
1128793295 15:70448577-70448599 CACCCACCTGGGCCCCTGTCAGG - Intergenic
1129653870 15:77510085-77510107 CACCCGCAGATGCCCCTGTGGGG - Intergenic
1129720161 15:77873492-77873514 CTCCCAATCCTGCCCCTGTCTGG + Intergenic
1130905027 15:88234174-88234196 CAATCACATCTGCCCCTCTCAGG + Intronic
1134603740 16:15553518-15553540 TACTCACCTCTGCCACTGTCGGG + Intronic
1135656018 16:24250183-24250205 AACCCACAGCTGCCCCTTCCAGG - Intergenic
1135917070 16:26614755-26614777 GACTCCCATCTGGCCCTGTCTGG - Intergenic
1136103227 16:28010640-28010662 CATTCACATCTGCCTCTGACAGG + Intronic
1137519920 16:49183891-49183913 GGCCCACATCTGCCCCTGGCTGG - Intergenic
1138246035 16:55467916-55467938 CACCCAGATCTGCCTCTGATTGG - Intronic
1141663103 16:85452371-85452393 CCCCCACCTCTCCCTCTGTCTGG + Intergenic
1142187706 16:88702266-88702288 CAGCCACATCTGGCCTTGTGAGG + Intronic
1142379450 16:89723152-89723174 CTCCCTCCTCTGCCCCTGTTGGG - Exonic
1142432913 16:90040207-90040229 CTCCCACCTCTGCACCTGCCTGG - Intronic
1143474629 17:7195685-7195707 CCTCCACTTCTGTCCCTGTCTGG - Intronic
1144762434 17:17714975-17714997 CACCCACATCACCCTCTGTTAGG + Intronic
1144839155 17:18174987-18175009 CACCCCAATCTGCTCCTGCCTGG + Intronic
1146438071 17:32870012-32870034 CACCCACATCTGGCTCTATTTGG + Intronic
1146913799 17:36665275-36665297 TCCCCACCTCTGTCCCTGTCCGG + Intergenic
1147040036 17:37711382-37711404 CATCCACATCTGCCTGTGTGTGG - Intronic
1148619436 17:49023133-49023155 CCCCCACATCTACCCTTGTGAGG - Intronic
1151664154 17:75535877-75535899 CACCCACGTCTGCACCTGGCCGG - Intronic
1153056246 18:949526-949548 CACCCTCATGTGCCACTGTGGGG - Intergenic
1154383416 18:13872282-13872304 CACCCACACCTCTCGCTGTCTGG - Intergenic
1156517063 18:37688968-37688990 CACCTCCATCTGCCACTGTAAGG + Intergenic
1158684759 18:59603393-59603415 CACTCACCTCTACCCCTGTGAGG + Intronic
1160328238 18:77969406-77969428 CACCAGCATCTGCCCCTGGGAGG - Intergenic
1160328255 18:77969470-77969492 CACCAGCATCTGCCCCTGGGAGG - Intergenic
1160328315 18:77969700-77969722 CACCAGCATCTGCCCCTGGGAGG - Intergenic
1161494563 19:4580395-4580417 CCCCCACCTCTGCCCCGGCCGGG - Intergenic
1162381735 19:10335407-10335429 CACCCTCATCCCCCCCAGTCAGG + Intronic
1163153411 19:15427844-15427866 CACCCACATCTGCCCCTGTCTGG - Intronic
1164792634 19:31001370-31001392 GTCCCACAGCTGCCTCTGTCCGG + Intergenic
1166520631 19:43477934-43477956 CACCCGCAGCTTCTCCTGTCAGG - Intronic
1167142155 19:47659338-47659360 CACCCACCTCCACCCCTGTTGGG - Intronic
1167502781 19:49856992-49857014 CCCCCACATCTCCCCCTGTGAGG + Exonic
1167825797 19:51971851-51971873 CACCCAATTCTGTCCCTGTTTGG - Intronic
925637830 2:5959343-5959365 CTCCCCCAGCTGCCTCTGTCAGG - Intergenic
928296316 2:30087135-30087157 CCCCCCCATCTGTCCCTGGCTGG - Intergenic
929758885 2:44790094-44790116 CACTCCCATCAGCCCCTTTCTGG - Intergenic
929868875 2:45741344-45741366 CACCCAGATCTGACACTTTCTGG + Intronic
934138666 2:89022933-89022955 CCCCCACACCTGCCTCTGCCTGG + Intergenic
936051095 2:109224131-109224153 CTCCCACTTCTGCCCCTGCTTGG + Intronic
937369803 2:121289307-121289329 CAACCACATCTGTCCATGACTGG - Intergenic
939928298 2:148201199-148201221 CACACACATCTCCTCCTGCCAGG - Intronic
940762097 2:157749909-157749931 CGCCCAGTGCTGCCCCTGTCAGG + Intronic
942251278 2:174049433-174049455 CACCCACATCTGTGCCTTCCTGG + Intergenic
943180202 2:184530847-184530869 TCCCAACATCTGCCCATGTCTGG + Intergenic
943908714 2:193534577-193534599 CACCCACATCTCACTCTGTGGGG + Intergenic
944222046 2:197311966-197311988 CAGCCCCATGTGCCCCTGGCAGG + Intergenic
946076032 2:217074415-217074437 CACACACACCTGCCCCTGGCAGG + Intergenic
947587501 2:231365595-231365617 TCCCCACCTCTGCCCCTTTCTGG - Intronic
947876877 2:233473582-233473604 CCCCCAGGTCTGCCCCTGCCCGG - Intergenic
948197923 2:236108797-236108819 CACACACAGCGGCCCCTGTGAGG + Intronic
948757145 2:240166410-240166432 CATCCCCACCTGCCCCTGCCTGG - Intergenic
1168957637 20:1845820-1845842 CAGCCACATTTGCTCTTGTCAGG - Intergenic
1171002186 20:21425897-21425919 CACCCACATGTGCCCCTCAGGGG - Intergenic
1171147527 20:22798583-22798605 CACCCACTTCTGCCTCAGGCAGG - Intergenic
1172838991 20:37890769-37890791 CACCCACTTCTGCTCCTGGACGG + Intergenic
1173828005 20:46059310-46059332 CAGCCACACCTGACGCTGTCTGG - Intronic
1174544343 20:51314160-51314182 TGCCCACATATGCCCCTGTTAGG - Intergenic
1175929252 20:62485867-62485889 CACTCTCGTGTGCCCCTGTCTGG - Intergenic
1176714179 21:10335767-10335789 CCCCCACCTCTGCCCCTGCAGGG + Intergenic
1178766038 21:35451829-35451851 CACCAACATCTGCATTTGTCTGG + Intronic
1179329783 21:40388501-40388523 CACCCACATCTTAACCTGGCAGG + Intronic
1179979558 21:44889025-44889047 CACCCGCATCTGCCCCACTTGGG - Intronic
1180073206 21:45449023-45449045 CTGCCACCTCTGCCCCTGACAGG - Intronic
1180761242 22:18209661-18209683 CCCCCACCTCTGCCCCTGCAGGG + Intergenic
1180774425 22:18414958-18414980 CCCCCACCTCTGCCCCTGCAGGG - Intergenic
1180807578 22:18725775-18725797 CCCCCACCTCTGCCCCTGCAGGG - Intergenic
1181070539 22:20333966-20333988 CCCCCACCTCTGCCCCTGCAGGG - Intergenic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1181193524 22:21161908-21161930 CCCCCACCTCTGCCCCTGCAGGG - Intergenic
1181215921 22:21330690-21330712 CCCCCACCTCTGCCCCTGCAGGG + Intergenic
1182468310 22:30531870-30531892 CACCCACCCATGCCCCTGGCGGG + Intronic
1182718136 22:32376475-32376497 CACCCACTTCTTCCCAGGTCTGG + Intronic
1183032433 22:35116224-35116246 CTCCCACCTCTGCCCCTCTCAGG + Intergenic
1183100894 22:35583455-35583477 CACCTGCGTCTGCCCCTGACTGG - Intergenic
1183346197 22:37309750-37309772 CCCTCAAATCTGCCCCTGGCTGG - Intronic
1183377139 22:37471929-37471951 CACCCAAATCCGCTCCTGACTGG - Intronic
1184019852 22:41813640-41813662 GGCCCACATCTGCCCAAGTCAGG + Intronic
1184130991 22:42516248-42516270 CAGCCACATCTGCCCAAGCCGGG + Intronic
1184141161 22:42578073-42578095 CAGCCACATCTGCCCAAGCCGGG + Intergenic
1184162251 22:42703938-42703960 GACCCACCTCTGCCCCTCCCTGG + Intronic
1184607261 22:45581314-45581336 CAGCCACATCTGTGTCTGTCTGG + Intronic
1185096052 22:48806634-48806656 CACCACCACCTGCCCCAGTCAGG - Intronic
1185276947 22:49953931-49953953 CACCCACAGGTGCCCCTTCCTGG + Intergenic
950656625 3:14440832-14440854 CACCCACCTCTCCACCTGTGGGG - Intronic
950712033 3:14819746-14819768 AACCCTCATCTGCCCCTGCTGGG - Exonic
951989598 3:28662037-28662059 GACCCTCTTCTGCCCCTGTCTGG - Intergenic
953666789 3:44931244-44931266 CACCCCCATGTGCTCCTGCCAGG - Intronic
955216534 3:56988894-56988916 CACCCGCATCTGCTGTTGTCTGG - Intronic
956195974 3:66653188-66653210 GACCCACATCTACCACTTTCTGG - Intergenic
958929060 3:100189845-100189867 CACCCAAGTCTCCGCCTGTCTGG - Intronic
961379470 3:126487696-126487718 CTCCCAGCTCTGCCCCTGCCCGG - Intronic
962573103 3:136731112-136731134 CTCCAACATCTACCCTTGTCTGG + Intronic
966316989 3:178658457-178658479 CACCCACATTTTACGCTGTCAGG + Intronic
966637347 3:182150564-182150586 CCCCCACCTCTACCCCTGACAGG + Intergenic
967875427 3:194265440-194265462 CACCTCCTTCTGCCCCAGTCTGG + Intergenic
968549216 4:1213796-1213818 CTCCCACACCCGCCGCTGTCAGG - Intronic
968596696 4:1489636-1489658 CACCCTCTCCTGCCCCTGCCAGG + Intergenic
969179259 4:5424505-5424527 TCCCAACATCTGCCCCAGTCTGG - Intronic
969494318 4:7517314-7517336 CACAAACAACTGCCCCTCTCTGG - Intronic
974794792 4:66734727-66734749 CACCACCATCTGCTCCTATCAGG - Intergenic
976741084 4:88358287-88358309 CACCCACCCCTGCCCCAGTGGGG + Intergenic
981239382 4:142457881-142457903 CTACCATACCTGCCCCTGTCTGG + Intronic
981410176 4:144420681-144420703 CACCCCCACCTTCCCCTGACAGG + Intergenic
985181761 4:187272418-187272440 CAACCACATCTTCCATTGTCTGG - Intergenic
985937335 5:3107014-3107036 CACCCCCATGTGCCCCTATGAGG + Intergenic
986094754 5:4543602-4543624 AAGCCAGATCTGCCCCAGTCTGG - Intergenic
986223127 5:5788260-5788282 CACCGACTTCTGCCCCTACCAGG - Intergenic
986280937 5:6321854-6321876 CACCTGCAGCTGCCCCTGCCAGG + Intergenic
988600082 5:32631615-32631637 TACCCACGTGTGCCCCTCTCTGG - Intergenic
988837151 5:35044700-35044722 CAGCCACAACTGCCCCTGTGTGG - Intronic
989120459 5:37999417-37999439 CTCCCTCATCTGCCCATGTTAGG + Intergenic
990125861 5:52517597-52517619 CACACACATCTGTCCCTCTAGGG - Intergenic
993691483 5:91006247-91006269 AACCTGCATCTGCCCCTGTAAGG - Intronic
994490827 5:100441075-100441097 CACCAACATCTGCTTCTGGCAGG - Intergenic
995988913 5:118211826-118211848 CACCCACAGCTGTCCTTGACTGG + Intergenic
997441052 5:133908893-133908915 CACCCAGCTCTGCTCCTGTGTGG - Intergenic
999194116 5:149770429-149770451 CACCCACATCTTCCCCTATCTGG - Intronic
1002316642 5:178348384-178348406 CACCCTAAACTGCCCCTGGCAGG + Intronic
1002676950 5:180924591-180924613 CACCCACATCTGCCTGTCTGAGG + Intronic
1005682213 6:28218428-28218450 CCCGCACATCTTCCACTGTCAGG + Intergenic
1006334033 6:33411168-33411190 CTCCTACGTCTGCCCCTGCCCGG + Exonic
1007229823 6:40340348-40340370 CTCCGACATCTGTACCTGTCAGG - Intergenic
1010973090 6:82283953-82283975 CACCCACAACAGCCCCTTTCCGG + Intergenic
1011610640 6:89146710-89146732 CACACACACCTGCCCCGGGCGGG - Intronic
1014470803 6:121812438-121812460 CACCCATACCTGCCCCTGCAGGG - Intergenic
1014561093 6:122891607-122891629 CACACACACCTGGGCCTGTCAGG - Intergenic
1014997124 6:128161648-128161670 CACCCACATATACCCTTGTCTGG - Intronic
1017809604 6:157975366-157975388 CATCCAGGTCTCCCCCTGTCAGG - Intergenic
1019184144 6:170211233-170211255 CAGCCGCGTCTGCCCCTCTCTGG + Intergenic
1019508081 7:1403514-1403536 CACCTTCATGTGCACCTGTCGGG + Intergenic
1021178429 7:17477258-17477280 TACCCAGATCTGTCACTGTCAGG + Intergenic
1022258751 7:28684256-28684278 CAACCACATTTGCCGCTGTCAGG + Intronic
1022508279 7:30920331-30920353 CACCCACACTTGCACCTGTGAGG - Intronic
1023822922 7:43990092-43990114 CACCCACGTCTGTCCCAGGCTGG + Intergenic
1024046842 7:45590901-45590923 CACCCCCACCTGACCCTGTGGGG - Intronic
1024664856 7:51536354-51536376 CACCCACAGCTGCCCCTTCCCGG + Intergenic
1026674923 7:72420371-72420393 CAGCAAAATCTGCCCCTGTTTGG - Intronic
1027352630 7:77327374-77327396 CACACACACATGCCCGTGTCTGG + Intronic
1029537798 7:101166198-101166220 TCCACCCATCTGCCCCTGTCAGG - Intergenic
1029751186 7:102543522-102543544 CACCCACGTCTGTCCCAGGCTGG + Intronic
1029769138 7:102642627-102642649 CACCCACGTCTGTCCCAGGCTGG + Exonic
1030048663 7:105519848-105519870 CACACACATCTTTTCCTGTCTGG - Intronic
1033358914 7:140624010-140624032 CACTCACATATGGCCCTGCCGGG - Intronic
1035663897 8:1366052-1366074 AAGGCACATCTGCCCCTGCCCGG - Intergenic
1037513108 8:19603458-19603480 CACCCACTTCCGCCTCTGCCTGG + Intronic
1038865765 8:31437228-31437250 CACCCCCCTCTGCTGCTGTCAGG - Intergenic
1039753445 8:40497960-40497982 CTGCCACGTCTGCCCCTGCCAGG + Intergenic
1039797007 8:40924332-40924354 CACCCACTTCAGCTGCTGTCAGG - Intergenic
1042672021 8:71274829-71274851 CACATACTTATGCCCCTGTCTGG - Intronic
1042805256 8:72764246-72764268 CTCCCATATCTGCTCCAGTCAGG - Intronic
1046503718 8:115111339-115111361 TCCCCTCATCTGCCCCAGTCTGG + Intergenic
1048948188 8:139470215-139470237 AGCCCACATCTGCCACTGTGGGG + Intergenic
1049426410 8:142539856-142539878 CACTCACTTCTGCCCCTGCTGGG - Intronic
1052330392 9:27261417-27261439 CACCAACATCTGCTCCTTTCTGG - Intergenic
1052627098 9:30989945-30989967 CAGGAACATCTGCCCCTGTGAGG + Intergenic
1053564374 9:39232874-39232896 CACTCACATTTGCTCCAGTCAGG + Intronic
1053830157 9:42070775-42070797 CACTCACATTTGCTCCAGTCAGG + Intronic
1054132776 9:61386162-61386184 CACTCACATTTGCTCCAGTCAGG - Intergenic
1054600401 9:67116677-67116699 CACTCACATTTGCTCCAGTCAGG - Intergenic
1056765589 9:89442826-89442848 GACTCACATCTGCCCGGGTCTGG - Intronic
1057340911 9:94200504-94200526 CACCAACAGCTGCTCCTGTGAGG + Intergenic
1058426188 9:104876874-104876896 CACCTGCATCTGCTCCTGCCAGG - Intronic
1059657623 9:116370283-116370305 CACACACATATGTCCCTATCAGG + Intronic
1059768046 9:117402481-117402503 TACCCACATCTTCCCATCTCAGG - Intronic
1060183173 9:121547697-121547719 TACCCACATCTGCACCTCTGAGG - Intergenic
1061057730 9:128233246-128233268 CAGCCACATCTGCCCGGCTCTGG - Intronic
1061451783 9:130670844-130670866 CCCCCACATCTGCCTCAGCCTGG - Intronic
1185547951 X:960948-960970 CATCCACATGTGCACCTGCCAGG + Intergenic
1185627474 X:1492893-1492915 CGCCCACCTCTGCCTCTTTCTGG + Intronic
1185700396 X:2227116-2227138 CACCCACATCTGTACATGCCAGG + Intronic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1187707782 X:22024992-22025014 CTCCCACATATGGCCCTGTGTGG + Intergenic
1192183001 X:68927991-68928013 CACACAGATCTTCCCCTCTCTGG - Intergenic
1194254992 X:91624355-91624377 CACCCACATCTGTCACTGTCAGG - Intergenic
1195129786 X:101840701-101840723 CACCCACAGGTGCCACTGCCTGG + Intronic
1195176450 X:102319122-102319144 CACCCACAGGTGCCACTGCCTGG - Intronic
1195182414 X:102367971-102367993 CACCCACAGGTGCCACTGCCTGG + Intronic
1196225844 X:113165719-113165741 CACCCACACCTACTACTGTCTGG + Intergenic
1197643448 X:128992588-128992610 CACCCACATCTGCCACCTGCAGG - Intergenic
1200573777 Y:4863958-4863980 CACCCACATCTGTCACTGTCAGG - Intergenic