ID: 1163154172

View in Genome Browser
Species Human (GRCh38)
Location 19:15431147-15431169
Sequence GGAAAACGCAATGGTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 1, 2: 2, 3: 10, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163154172_1163154177 -3 Left 1163154172 19:15431147-15431169 CCATGGCCACCATTGCGTTTTCC 0: 1
1: 1
2: 2
3: 10
4: 138
Right 1163154177 19:15431167-15431189 TCCTCAGAACCCAGGCCTGTGGG 0: 1
1: 0
2: 2
3: 22
4: 362
1163154172_1163154180 2 Left 1163154172 19:15431147-15431169 CCATGGCCACCATTGCGTTTTCC 0: 1
1: 1
2: 2
3: 10
4: 138
Right 1163154180 19:15431172-15431194 AGAACCCAGGCCTGTGGGTTGGG 0: 1
1: 0
2: 1
3: 31
4: 289
1163154172_1163154184 10 Left 1163154172 19:15431147-15431169 CCATGGCCACCATTGCGTTTTCC 0: 1
1: 1
2: 2
3: 10
4: 138
Right 1163154184 19:15431180-15431202 GGCCTGTGGGTTGGGGAGACAGG 0: 1
1: 0
2: 5
3: 61
4: 670
1163154172_1163154181 3 Left 1163154172 19:15431147-15431169 CCATGGCCACCATTGCGTTTTCC 0: 1
1: 1
2: 2
3: 10
4: 138
Right 1163154181 19:15431173-15431195 GAACCCAGGCCTGTGGGTTGGGG 0: 1
1: 0
2: 3
3: 27
4: 311
1163154172_1163154176 -4 Left 1163154172 19:15431147-15431169 CCATGGCCACCATTGCGTTTTCC 0: 1
1: 1
2: 2
3: 10
4: 138
Right 1163154176 19:15431166-15431188 TTCCTCAGAACCCAGGCCTGTGG 0: 1
1: 0
2: 3
3: 34
4: 298
1163154172_1163154179 1 Left 1163154172 19:15431147-15431169 CCATGGCCACCATTGCGTTTTCC 0: 1
1: 1
2: 2
3: 10
4: 138
Right 1163154179 19:15431171-15431193 CAGAACCCAGGCCTGTGGGTTGG 0: 1
1: 0
2: 6
3: 39
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163154172 Original CRISPR GGAAAACGCAATGGTGGCCA TGG (reversed) Intronic
901648044 1:10727160-10727182 GGAAAAGGGAGAGGTGGCCAGGG + Intronic
905267960 1:36768038-36768060 GGAAATCGCAGTCGTGCCCAAGG + Intergenic
905476583 1:38233047-38233069 GGAAGAAGCAATGGGGGACAAGG - Intergenic
909712810 1:78672296-78672318 GCAATACCCAATGGTGGACAGGG + Intergenic
911375535 1:97046434-97046456 GGAGAATGCCATGGTGGCAAAGG - Intergenic
911748301 1:101465979-101466001 TGAAATCAAAATGGTGGCCAGGG + Intergenic
911871735 1:103108134-103108156 GGAAAACGAAACGGTGGCTCTGG - Exonic
912688229 1:111783963-111783985 GGAAAAATAAATGGTTGCCAGGG + Intronic
915908819 1:159899760-159899782 GGAAAAAGCACTGGTGGGCCGGG - Intronic
919704131 1:200660167-200660189 GGAAGAAATAATGGTGGCCAAGG - Intronic
920003557 1:202815871-202815893 AGAAAAAACAATGGTTGCCAAGG + Intergenic
921066137 1:211623206-211623228 AGAAGAGGCAATGGTGGCCTTGG + Intergenic
923019378 1:230151171-230151193 GGAAAAGACAACGGTGGCCACGG - Intronic
923792729 1:237126266-237126288 AGAAAACCCTGTGGTGGCCATGG + Intronic
1069849766 10:71397208-71397230 GGAAGACGCGGCGGTGGCCAGGG + Intronic
1069964007 10:72098633-72098655 AGGAAAAGCAATGGTGGCCAAGG - Intronic
1070362036 10:75699900-75699922 GGAAAAGGCATTTGTGACCATGG + Intronic
1075486710 10:122828633-122828655 GGAAAACTGAACGGTGGCCATGG - Intergenic
1077111179 11:862889-862911 GGAAGACCCAACAGTGGCCAGGG - Intronic
1079689443 11:23403634-23403656 GGAAAAGGCAATGGTGGCCATGG + Intergenic
1081248564 11:40800370-40800392 GGGGAATTCAATGGTGGCCATGG + Intronic
1085781527 11:79413365-79413387 GGAAAAGGCTATGGAGTCCAAGG - Intronic
1086495455 11:87400002-87400024 GGCAAACCCAATAGTGGCCATGG - Intergenic
1087501652 11:98962839-98962861 GCAAAACACAATGGTGGCATAGG + Intergenic
1090884137 11:130861492-130861514 GGAAAAGGCAGTGTAGGCCAAGG - Intergenic
1092693548 12:11143960-11143982 GGAACATGCACTGGTGTCCAAGG - Intronic
1094388663 12:29923735-29923757 AGAAAATGCAATGGTGGCCAGGG + Intergenic
1095173059 12:39057532-39057554 GGAAAATGCAGTGGTGACCGTGG - Intergenic
1095625705 12:44312018-44312040 GGAAAAGGTCATGGAGGCCAAGG + Intronic
1098105764 12:67068604-67068626 GGACAACGCGAGGGTGGCCGCGG + Intergenic
1102588976 12:113943057-113943079 GGTAAAAGCCATGGAGGCCAAGG - Intronic
1105052123 12:133064060-133064082 TGAAAAGGACATGGTGGCCAGGG - Intergenic
1107510983 13:41084706-41084728 GGAAAACCCCATAGTGGTCATGG - Intergenic
1108644815 13:52417068-52417090 GGAAGAGGAAATGGTGGCCTCGG - Exonic
1112904177 13:104396942-104396964 GGGAAACGCAAGGTGGGCCAAGG - Intergenic
1113597784 13:111546914-111546936 GGAAAGTGCAATTGTGGACAAGG + Intergenic
1117647436 14:57866252-57866274 GGAGAAGGCGACGGTGGCCAGGG + Intronic
1118995013 14:70827735-70827757 GGAAAACACCATGGTGTCCAAGG - Intergenic
1122070220 14:99201168-99201190 GGAAAACGCAACCCTCGCCAGGG + Intronic
1124787823 15:32698499-32698521 GGAAATAGCAATGTTGGACAAGG + Intergenic
1127664985 15:61137099-61137121 GAAAAAAGCAAGGGTGTCCAGGG + Intronic
1136417532 16:30113026-30113048 GGAGAACACCATGGAGGCCATGG - Exonic
1136643573 16:31589126-31589148 GGAAAAAGCAATGGTTTCCCAGG + Intergenic
1136662034 16:31771684-31771706 GGAAAAAGCAATGGTTTCCCAGG - Intronic
1137350533 16:47710405-47710427 GGAAAACAGAATGGGGGCAACGG + Intergenic
1139590569 16:67930785-67930807 GGACAACAAAATGGCGGCCAGGG + Exonic
1139704954 16:68734881-68734903 GGAGAAGGTGATGGTGGCCATGG + Intergenic
1142863265 17:2776371-2776393 GGAAGATGCAATGGGGGCAATGG - Intergenic
1147339740 17:39746289-39746311 GGGAGACGCACTGGGGGCCAGGG - Intronic
1148334574 17:46832703-46832725 GGAAAAGGCAGGGGTGGCCCTGG + Intronic
1148344381 17:46893824-46893846 GGAAAAAGCCAAGGTGGCCAGGG + Intergenic
1148727952 17:49809555-49809577 GGAAAAGTCACTGGTGGCCTTGG - Intronic
1149277827 17:55064340-55064362 GGAAAAAGCAGTGGTGGGAAGGG - Intronic
1203168180 17_GL000205v2_random:118474-118496 GAAAATCGCAATAGTGGCCTAGG - Intergenic
1158008032 18:52695631-52695653 GGAAAACACAGTTGTGGCTATGG + Intronic
1159533467 18:69685043-69685065 GGAAAAGGCAAGGGTGCTCAGGG + Intronic
1159732865 18:72053403-72053425 GGAGAACTCAATGGAAGCCAAGG - Intergenic
1159813662 18:73046937-73046959 GGAAACCCCAATAGAGGCCATGG + Intergenic
1163154172 19:15431147-15431169 GGAAAACGCAATGGTGGCCATGG - Intronic
1166592785 19:44015772-44015794 GGACAACTCAAAGTTGGCCATGG + Intergenic
1166933736 19:46318275-46318297 GGTAAACGGAATGCTGGGCATGG + Intronic
925024730 2:598843-598865 TAAAACCGCACTGGTGGCCACGG + Intergenic
925070685 2:964985-965007 AGGAAAAGCAAAGGTGGCCAAGG - Intronic
925844415 2:8022610-8022632 TGAGAAAGCAATGGTGGTCAAGG - Intergenic
925856308 2:8133028-8133050 GGAAAACGCCCTGGAGGCCCAGG + Intergenic
925937911 2:8785216-8785238 GTAAAAAGAAATGGTAGCCAGGG + Intronic
927411631 2:22832412-22832434 GGAAAACAGAATTGTTGCCAAGG - Intergenic
929114873 2:38435492-38435514 GGATAATGCAATAGAGGCCATGG - Intergenic
930493016 2:52100553-52100575 GAAAAAATCAATGGTTGCCATGG - Intergenic
931914886 2:66943237-66943259 AGAAAACGCAAAGGGAGCCAAGG + Intergenic
932100980 2:68898659-68898681 GGAAGGGGCGATGGTGGCCATGG + Intergenic
933499772 2:83096308-83096330 TAAGAACGCAATGTTGGCCAAGG + Intergenic
934661369 2:96145351-96145373 GGAAGAGGCACCGGTGGCCATGG - Exonic
935356747 2:102208420-102208442 GGAAAAACCAATGCTGGCCTGGG - Intronic
936475316 2:112834595-112834617 GGAAGAGGCAATGGGGGCAAAGG + Intronic
937209358 2:120258467-120258489 GGAAAAGGCCACGGAGGCCACGG + Intronic
946024981 2:216666218-216666240 GGAAAACGAAGTGGTGGGAAAGG - Intergenic
946966180 2:225041009-225041031 GTGAAACGAATTGGTGGCCAGGG - Intronic
946994508 2:225376015-225376037 GGAAAAAGCAATGAAGACCACGG + Intergenic
947256043 2:228164638-228164660 GGAATACCCAATGGTCCCCAAGG + Intronic
1170800566 20:19586630-19586652 GGAGAATGCAATGGTGGACCCGG - Intronic
1171085109 20:22231270-22231292 GGAAAGTGCAATGCTGGCCTAGG + Intergenic
1172955120 20:38751099-38751121 GGAGAACACAGTGGTGGCCTAGG - Intronic
1173070457 20:39759522-39759544 GGAAAATGCAAAGGTAACCAGGG + Intergenic
1173401966 20:42733909-42733931 GGAAAAGGCCTTGGTGGCAATGG + Intronic
1176325551 21:5445799-5445821 GAAAATCGCAATAGTGGCCTAGG - Intergenic
1176333368 21:5572158-5572180 GAAAATCGCAATAGTGGCCTAGG + Intergenic
1176394389 21:6248794-6248816 GAAAATCGCAATAGTGGCCTAGG - Intergenic
1176403577 21:6340663-6340685 GAAAATCGCAATAGTGGCCTAGG + Intergenic
1176433580 21:6648441-6648463 GAAAATCGCAATAGTGGCCTAGG - Intergenic
1176467030 21:7067380-7067402 GAAAATCGCAATAGTGGCCTAGG + Intronic
1176490591 21:7449158-7449180 GAAAATCGCAATAGTGGCCTAGG + Intergenic
1176510051 21:7689225-7689247 GAAAATCGCAATAGTGGCCTAGG - Intergenic
1178215441 21:30592485-30592507 AGAAACTACAATGGTGGCCATGG + Exonic
1180288519 22:10775372-10775394 GGAAAAAAAAATAGTGGCCACGG + Intergenic
1181044605 22:20208613-20208635 GGACAAGGGGATGGTGGCCATGG + Intergenic
1182398339 22:30053843-30053865 GGAAACATCAATGGTTGCCAGGG + Intergenic
1183310403 22:37106617-37106639 GGAAGACGCAATGGAGGCAGGGG - Intronic
1184891447 22:47381919-47381941 GGAGAACGCATTGCAGGCCAAGG + Intergenic
1185277690 22:49956889-49956911 GAAAAAGACCATGGTGGCCAAGG + Intergenic
949932768 3:9092106-9092128 GGGAAAGGAAATGCTGGCCACGG - Intronic
955195486 3:56801786-56801808 GGCAGCCGCCATGGTGGCCAAGG - Intronic
959047023 3:101485379-101485401 GGAAAAGGCATTGGTATCCACGG + Intronic
964338103 3:155679032-155679054 GGTAAAAGCAATGGTTTCCATGG + Intronic
969568222 4:7992692-7992714 GGAAAAAGCAGTGGTGGCAGTGG + Intronic
975109654 4:70609219-70609241 GGCAAACACCAAGGTGGCCAGGG + Intergenic
976907831 4:90262620-90262642 GCAATACCCAATGGTGGGCAGGG + Intronic
983408809 4:167370053-167370075 GCAAAACACAGAGGTGGCCATGG + Intergenic
986030307 5:3887233-3887255 GGAGGAGGCAATGTTGGCCATGG - Intergenic
992117695 5:73557368-73557390 GGAAAAGGCAACGGTGGTAAAGG + Intronic
992319967 5:75604120-75604142 GGAAGACAGAATGGTGGCTAAGG + Intergenic
992608063 5:78481884-78481906 GGAACATCCAATGCTGGCCAAGG - Intergenic
997368028 5:133338321-133338343 GGAGAACACAAGAGTGGCCATGG + Intronic
997376796 5:133403300-133403322 GGAGAAAGCAATGGGGGCCAGGG - Intronic
998422775 5:142002851-142002873 AGAAAACGCAATGTGGTCCAAGG - Intronic
1005379458 6:25218355-25218377 AGAAAACGCAGCGGTGGTCACGG + Intergenic
1006113996 6:31765705-31765727 GGAAAAGGCAGGGGTGGCCGTGG + Exonic
1011170575 6:84500199-84500221 TGAAAAAGAAAGGGTGGCCACGG - Intergenic
1017718069 6:157225703-157225725 GGAAAACGCAATGGTGTCCCAGG - Intergenic
1023513649 7:40979073-40979095 GGAAAAGGCATGGGGGGCCAGGG - Intergenic
1024661598 7:51500481-51500503 GGAAAATGCAATGTTGACCCCGG + Intergenic
1027893831 7:84014876-84014898 GGAGAATTCAAGGGTGGCCAGGG - Intronic
1031422358 7:121566844-121566866 GGAAGACGCAAAGGTGGCTTTGG + Intergenic
1034241893 7:149617256-149617278 GGAGACCACAATGGTGGGCATGG + Intergenic
1034628088 7:152509488-152509510 GGTAAAGGCAAAGGTGGCAAGGG + Intergenic
1034699845 7:153086417-153086439 GGAGAAGGAAAGGGTGGCCAGGG + Intergenic
1034906849 7:154956698-154956720 GGACAAAGCAATGTTGGCCACGG - Intronic
1036210891 8:6840539-6840561 GGAGAAAGCCATGGTTGCCAAGG + Intergenic
1038354824 8:26818140-26818162 AGAAAACTCAGTGGTTGCCAAGG + Intronic
1039531705 8:38268812-38268834 GGAAAACGCACAGGTGCCCGCGG + Intronic
1039667551 8:39551365-39551387 GGAAAACCCACTGGTTTCCAGGG + Intergenic
1040023346 8:42759920-42759942 TGGAAACCCCATGGTGGCCAAGG - Intronic
1040902782 8:52433946-52433968 GTAAAGCGCCATGGTGGGCAGGG - Intronic
1042042187 8:64604397-64604419 CCAAAACGTAATAGTGGCCAAGG + Intronic
1047968254 8:130063485-130063507 GGAAGAGGCAAGGCTGGCCAGGG + Intronic
1056310658 9:85337826-85337848 GGACACGGCAATGGTGGCCAGGG + Intergenic
1057783757 9:98071683-98071705 GGAAAATGAAATGGTGGCCCAGG - Intronic
1058949334 9:109888894-109888916 GGAAAGGGCAATGGTGCCCCTGG - Intronic
1060330669 9:122666343-122666365 AGCAAACGCACTGGTGCCCAGGG - Intergenic
1062723699 9:138059048-138059070 GGAATAGGCACTGTTGGCCATGG - Intronic
1203428329 Un_GL000195v1:63064-63086 GAAAATCGCAATAGTGGCCTAGG - Intergenic
1203437956 Un_GL000195v1:160229-160251 GAAAATCGCAATAGTGGCCTAGG + Intergenic
1186611751 X:11144469-11144491 GGAAAAGGCAATGATGGAGAAGG + Intronic
1193199484 X:78671553-78671575 TTAAAAAGCAATGGTGTCCAGGG + Intergenic
1194144103 X:90242193-90242215 GCAATACCCAATGGTGGGCAGGG - Intergenic
1194598771 X:95893728-95893750 GGAAAACTTGATGGTAGCCACGG + Intergenic
1196160304 X:112475395-112475417 AGAAAATGAGATGGTGGCCAAGG + Intergenic
1199799004 X:151230937-151230959 GGAAACCCCAATGATAGCCATGG - Intergenic
1200255569 X:154580719-154580741 CTAAAACGCCATGGAGGCCATGG - Intergenic
1200262200 X:154623685-154623707 CTAAAACGCCATGGAGGCCATGG + Intergenic
1200489866 Y:3811494-3811516 GCAATACCCAATGGTGGGCAGGG - Intergenic
1200677758 Y:6171901-6171923 TGAAAACTCCATGGTGGTCAGGG - Intergenic