ID: 1163157929

View in Genome Browser
Species Human (GRCh38)
Location 19:15449397-15449419
Sequence CACTGCCCGCGGGGAACGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 103}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163157917_1163157929 12 Left 1163157917 19:15449362-15449384 CCGGAGGAAGCACCTGCGGTTGT No data
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 103
1163157911_1163157929 24 Left 1163157911 19:15449350-15449372 CCCTACCCAGGCCCGGAGGAAGC 0: 1
1: 0
2: 1
3: 14
4: 184
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 103
1163157921_1163157929 0 Left 1163157921 19:15449374-15449396 CCTGCGGTTGTCCACTGGGTGGG No data
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 103
1163157916_1163157929 13 Left 1163157916 19:15449361-15449383 CCCGGAGGAAGCACCTGCGGTTG 0: 1
1: 0
2: 0
3: 9
4: 129
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 103
1163157912_1163157929 23 Left 1163157912 19:15449351-15449373 CCTACCCAGGCCCGGAGGAAGCA 0: 1
1: 0
2: 1
3: 23
4: 214
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 103
1163157913_1163157929 19 Left 1163157913 19:15449355-15449377 CCCAGGCCCGGAGGAAGCACCTG 0: 1
1: 0
2: 2
3: 26
4: 235
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 103
1163157914_1163157929 18 Left 1163157914 19:15449356-15449378 CCAGGCCCGGAGGAAGCACCTGC 0: 1
1: 0
2: 1
3: 25
4: 252
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163157929 Original CRISPR CACTGCCCGCGGGGAACGGG CGG Intronic
900175076 1:1287977-1287999 CACCGCCGGCGGGGAAGGCGTGG + Exonic
903813211 1:26046197-26046219 AAAAGCCCGCGGGGAAGGGGGGG + Intergenic
905631487 1:39521475-39521497 CACTGCCCGAGGGGTGCGGATGG - Exonic
905666267 1:39764696-39764718 CACTGCCCGAGGGGTGCGGATGG + Exonic
911219724 1:95234136-95234158 CACTGCCCGCGGCCACCCGGGGG - Exonic
914748444 1:150515870-150515892 CCCAGCCCACGGGGAGCGGGCGG + Intergenic
920003123 1:202812650-202812672 CCCTGCCCACGGGGATTGGGAGG + Intergenic
921432742 1:215082825-215082847 CACCCCCCGCGGGGCACGGAGGG + Intronic
922358241 1:224796521-224796543 CACTGCCTGAGGGGTAAGGGAGG + Intergenic
1062860663 10:806783-806805 CACTGGCCTCAGGAAACGGGAGG + Intergenic
1063655197 10:7981276-7981298 CACTGCCCGAGGGCAAGGGTGGG - Intronic
1067572423 10:47381234-47381256 CACTGCTTGGGGGGAGCGGGTGG - Intronic
1076639080 10:131901512-131901534 CCCGGCCCGCGGGGCACGGGCGG + Intronic
1076993794 11:288984-289006 CGCTGCCAGCGGGGACCGAGGGG + Intergenic
1077043532 11:534879-534901 CACCCCCGGCGGGGAACCGGGGG + Intronic
1079004834 11:16784190-16784212 CACTGTGGGCGGGGAACTGGAGG - Intronic
1083688591 11:64392585-64392607 CACTGCATGCTGGGAAGGGGAGG + Intergenic
1083855156 11:65389630-65389652 CACTGCCCATGGGGAAAGGTGGG + Intronic
1083999387 11:66288053-66288075 GCCTGCCCCCGGGGCACGGGTGG - Intronic
1084881286 11:72173283-72173305 CACTGCCCACAAGGAAGGGGAGG + Intergenic
1089525744 11:119095304-119095326 CACGGCCCACTGGGAACTGGAGG + Exonic
1091463342 12:662699-662721 CACTGCTGGAGGGGAAAGGGTGG - Intronic
1092172202 12:6380943-6380965 CCCTGCCCGCGGTGAACCTGTGG + Intronic
1092518352 12:9239884-9239906 CACTGCCCACGGTGGGCGGGCGG + Intergenic
1092796132 12:12111600-12111622 CACTGCCCACGGTGGGCGGGCGG - Intronic
1111522891 13:89428275-89428297 CATTCCCCGGGGGGAAGGGGTGG - Intergenic
1113145758 13:107205433-107205455 CACTGCCTGCAGGCAACGGAAGG - Intronic
1113936180 13:113996262-113996284 CCCTGCCCCGGGGGAGCGGGAGG - Intronic
1119780079 14:77271370-77271392 CAGTGCCCTCGGGGCTCGGGAGG - Intergenic
1121190722 14:92026993-92027015 CACTGCCCACGGTGGGCGGGCGG - Intronic
1121657936 14:95611821-95611843 CACTGCCAAGGGGGAAGGGGAGG - Intergenic
1123480683 15:20628734-20628756 CGCCGCCCGAGGAGAACGGGAGG - Intergenic
1123637326 15:22371633-22371655 CGCCGCCCGAGGAGAACGGGAGG + Intergenic
1126035006 15:44537376-44537398 CACTGCCGGCGGGGACCGCTGGG + Exonic
1130224586 15:82047090-82047112 CAGTGCGCGCGAGGAGCGGGCGG + Intergenic
1130895407 15:88166511-88166533 CACTGCCCAGGAGGAAAGGGAGG + Intronic
1132462055 16:60380-60402 CACAGCCCCCGGGGAAGGTGTGG + Intronic
1133097582 16:3458002-3458024 CGCTGCCGGCAGGGAGCGGGAGG + Intronic
1134746574 16:16593471-16593493 CAAAGCCCACGGGGAACTGGGGG - Intergenic
1134998899 16:18760209-18760231 CAAAGCCCACGGGGAACTGGGGG + Intergenic
1142744601 17:1949536-1949558 CACTGATCGCAGGGAAGGGGCGG - Intronic
1144947799 17:18978648-18978670 CAGTGCCCGCGGGCACCAGGGGG + Exonic
1147986089 17:44308558-44308580 CACTGGCCGAGGGGGGCGGGCGG + Exonic
1151954279 17:77372964-77372986 CCCTGCGCCCGGGGAAGGGGAGG + Intronic
1154170648 18:12047974-12047996 CACTGCCAGTGGGGGACGGGGGG - Intergenic
1154171993 18:12059341-12059363 CACTGCCCGCGGGGGCAGGTGGG - Intergenic
1157464245 18:47930623-47930645 CGCCGCCCGCGGGGAAGGAGGGG + Intronic
1157842022 18:50967898-50967920 CACTGCCCTCGCGGCCCGGGGGG + Intergenic
1162940429 19:14006004-14006026 CACAGTCCGGGGGGAAGGGGCGG - Intronic
1163118073 19:15200173-15200195 CTCTGGCCGCGGGGACCCGGAGG - Intronic
1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG + Intronic
1167619567 19:50553240-50553262 CGCTGCCCGTGGGGAACGCACGG - Intronic
928186371 2:29115080-29115102 CGCTGCCAGCAGGGAACTGGTGG + Intronic
928371648 2:30744347-30744369 CACTGCCCCAGGGGTATGGGAGG + Intronic
934290031 2:91684604-91684626 CATTCCCCCCGGGGACCGGGAGG - Intergenic
935396920 2:102619415-102619437 CCGAGCCCGCGGGGAACGCGGGG - Intergenic
946415874 2:219539358-219539380 CACGGCCCACGGGGACAGGGTGG + Exonic
947642161 2:231712960-231712982 CACTGCCCACGGTGGGCGGGCGG - Exonic
948807556 2:240459562-240459584 CACTGCCCCTGGGGACCAGGTGG + Intronic
1169437964 20:5610681-5610703 CACTGCCCGCAGGGGAACGGCGG - Intronic
1170484526 20:16803187-16803209 CACTGCCAGCCGAGAAAGGGTGG + Intergenic
1170623414 20:18012423-18012445 CACTGCCCTCGGTGGGCGGGTGG - Intronic
1175371399 20:58495517-58495539 CCCTGCCCTCGGGGCACAGGGGG - Intronic
1176096051 20:63345085-63345107 CACTGCCCGCGGGGACACAGCGG + Exonic
1176310094 21:5144908-5144930 CAGTGCCCGCGGGGACTTGGGGG - Intronic
1178913751 21:36695887-36695909 CCCATCCCGCGGGGAACGGCCGG + Intergenic
1179152571 21:38821569-38821591 CACTTCCTGCGGGGAGAGGGAGG - Exonic
1179658383 21:42859760-42859782 CAGCGCCCGCAGGGACCGGGAGG + Intronic
1179846962 21:44117124-44117146 CAGTGCCCGCGGGGACTTGGGGG + Intronic
1182289669 22:29267891-29267913 CGCGGGCCGCGGGGAATGGGTGG - Exonic
1182463959 22:30502992-30503014 CCCTGTCCTCGGGGAACTGGAGG + Intronic
1182697317 22:32205972-32205994 CACTGCCTGCGGTGGAGGGGTGG + Intergenic
1183674570 22:39292248-39292270 CACTGTGTGCGGGGAGCGGGCGG - Intergenic
954339255 3:49940018-49940040 CCCTGCGCGCGGGGCACGGCGGG + Exonic
964087543 3:152835593-152835615 CATGGCCCGCGGCGAACGCGGGG + Exonic
967891351 3:194366564-194366586 CACTGACCGCTGAGAACGAGAGG + Intronic
969431486 4:7157445-7157467 TACTGACCGTGGGGCACGGGAGG - Intergenic
980930057 4:139176693-139176715 GCCTGCCCGCGGGGAGCGCGGGG - Intronic
985669794 5:1201405-1201427 CACTGCCTTCGGGCAACCGGAGG - Intergenic
987358249 5:17083679-17083701 GCCTTCCCGCGGGGAAGGGGAGG + Intronic
1000220460 5:159209309-159209331 CGCCGCCCGAGGAGAACGGGAGG - Intronic
1000630644 5:163586977-163586999 CACTCCCAGTGGGGAATGGGAGG - Intergenic
1004427664 6:15517275-15517297 CCCTGCCCGCGGGGTAGGGCAGG + Intronic
1006132562 6:31878095-31878117 CACTGCTCGTGGGGATCTGGAGG + Intronic
1013106244 6:107028558-107028580 CACTGCCCGCGGGGGTGGGGAGG + Exonic
1014724921 6:124962474-124962496 CGCTGCCCGCGGGCGCCGGGTGG + Intergenic
1017146395 6:151239725-151239747 CCCTTCCCCCGGGGAACGGGGGG - Intergenic
1017810839 6:157982167-157982189 CCCTTCCCGAGGGGATCGGGCGG + Intronic
1018890106 6:167976993-167977015 CGATGCCGGCGGGGAGCGGGCGG + Intergenic
1019412392 7:911976-911998 CGCTGCCTGCGAGGAACGGCTGG + Intronic
1032700077 7:134371376-134371398 CACTGCCCTGGGGAAACTGGTGG + Intergenic
1033092985 7:138404031-138404053 CACTGCCCGCGGTGGGCGGTGGG + Intergenic
1034291749 7:149937935-149937957 CAGTCCCAGCGGGGAATGGGAGG + Intergenic
1034814336 7:154158963-154158985 CAGTCCCAGCGGGGAATGGGAGG - Intronic
1035401687 7:158570059-158570081 CCCTGCCTGGGGGAAACGGGTGG - Intronic
1037116747 8:15237022-15237044 CACTGCCCGCGGGCGGTGGGAGG + Intronic
1037517334 8:19645821-19645843 CACTGCCCTGGGGGAACCAGTGG - Intronic
1042871151 8:73400832-73400854 CACTGCACACGGAGAAGGGGTGG + Intergenic
1045459194 8:102412099-102412121 CACGGCCCGTGGGGGAGGGGAGG + Intronic
1049585387 8:143430479-143430501 CGCCGCCCGCGGGGAGCAGGGGG - Intergenic
1057245932 9:93453548-93453570 CACTGCCCGCGAGGAGATGGTGG + Exonic
1060584564 9:124777741-124777763 CACGGCCCGCTGGGGACTGGGGG + Intronic
1061517190 9:131096717-131096739 CACCGCGCGCGGGAAGCGGGCGG + Intronic
1061917732 9:133763926-133763948 CACTGCCCACAGGGATAGGGAGG - Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1192432014 X:71118914-71118936 CACTGACGGCTGGGAATGGGGGG + Intronic
1199525297 X:148785052-148785074 CACTGCCTTGGGGGAAGGGGGGG - Intronic
1199979983 X:152915529-152915551 CACTCCCTGCAGGGAATGGGTGG - Intronic