ID: 1163157929

View in Genome Browser
Species Human (GRCh38)
Location 19:15449397-15449419
Sequence CACTGCCCGCGGGGAACGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163157921_1163157929 0 Left 1163157921 19:15449374-15449396 CCTGCGGTTGTCCACTGGGTGGG No data
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG No data
1163157911_1163157929 24 Left 1163157911 19:15449350-15449372 CCCTACCCAGGCCCGGAGGAAGC No data
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG No data
1163157912_1163157929 23 Left 1163157912 19:15449351-15449373 CCTACCCAGGCCCGGAGGAAGCA No data
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG No data
1163157913_1163157929 19 Left 1163157913 19:15449355-15449377 CCCAGGCCCGGAGGAAGCACCTG No data
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG No data
1163157916_1163157929 13 Left 1163157916 19:15449361-15449383 CCCGGAGGAAGCACCTGCGGTTG No data
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG No data
1163157914_1163157929 18 Left 1163157914 19:15449356-15449378 CCAGGCCCGGAGGAAGCACCTGC No data
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG No data
1163157917_1163157929 12 Left 1163157917 19:15449362-15449384 CCGGAGGAAGCACCTGCGGTTGT No data
Right 1163157929 19:15449397-15449419 CACTGCCCGCGGGGAACGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163157929 Original CRISPR CACTGCCCGCGGGGAACGGG CGG Intronic