ID: 1163158527

View in Genome Browser
Species Human (GRCh38)
Location 19:15451844-15451866
Sequence CTCCAAGACCCCCGCGTCCT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163158520_1163158527 13 Left 1163158520 19:15451808-15451830 CCATTGAGGCAGGGTGCTTTGAG 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1163158527 19:15451844-15451866 CTCCAAGACCCCCGCGTCCTTGG 0: 1
1: 0
2: 0
3: 10
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163158527 Original CRISPR CTCCAAGACCCCCGCGTCCT TGG Exonic
900266895 1:1761915-1761937 TTCCAAGAACCCCCCGTCCTGGG + Intronic
900458108 1:2787046-2787068 CTCCAAGACCCCCTGCTCCCAGG - Intronic
900867076 1:5276227-5276249 CTCCAAGACCCCAGGATCCTAGG + Intergenic
901066610 1:6497370-6497392 CTCCCAGTCCCCGGCGTCCCCGG - Intronic
901956916 1:12793090-12793112 CTCCATGACCCCTCCCTCCTTGG + Intronic
904349228 1:29894110-29894132 TTCCAAGGCTCCAGCGTCCTCGG - Intergenic
907909657 1:58815085-58815107 CTCCCAGACCCCGCCGTCCTGGG - Intergenic
907913422 1:58847004-58847026 CTCCACGACCTCCGCCTCCCAGG - Intergenic
910199576 1:84685193-84685215 CACCAAGAGCCCTGGGTCCTTGG + Intronic
911205355 1:95086763-95086785 CACCAACACCTCCGCCTCCTGGG - Intergenic
912854184 1:113152680-113152702 CACCACAACCCCCGCCTCCTGGG + Intergenic
916120599 1:161525137-161525159 CGCGATGGCCCCCGCGTCCTTGG - Exonic
916130362 1:161606769-161606791 CGCGATGGCCCCCGCGTCCTTGG - Intronic
917599468 1:176559956-176559978 CTCTAAGACCCCCGCATCTGGGG - Intronic
921374904 1:214463726-214463748 CTCCAAGAGCCCAGGGACCTAGG + Intronic
922585947 1:226735710-226735732 CTCCAAGGCCCCATCCTCCTGGG + Exonic
923638483 1:235725356-235725378 CACCAAAACCTCCGCCTCCTGGG - Intronic
1062994871 10:1856317-1856339 CTCTAAGACCCCACTGTCCTAGG - Intergenic
1063423614 10:5934115-5934137 CTCCAAAACACCCCCGTCCGTGG - Intronic
1064208800 10:13347309-13347331 CTCCAGGACGCCCGCGTCGGAGG + Intronic
1070204041 10:74238016-74238038 CACCATGACCTCCGCCTCCTGGG - Intronic
1070749421 10:78955212-78955234 CTCCAAGAGCCCCGGCCCCTGGG - Intergenic
1071413426 10:85419382-85419404 CTCCATGCCCCCCTGGTCCTGGG + Intergenic
1072049367 10:91688313-91688335 CACCAAAACCTCCGCCTCCTGGG + Intergenic
1072064679 10:91854825-91854847 CACCACAACCTCCGCGTCCTGGG - Intronic
1076751610 10:132546226-132546248 CGCCAAGACCCCCGCGGGCTGGG - Intronic
1076809558 10:132879561-132879583 CTCCAAGGACACCGCCTCCTCGG + Exonic
1077139995 11:1020093-1020115 CTCCAAGCCCACAGCCTCCTCGG - Exonic
1077291904 11:1800491-1800513 CACCAAGACCTCTGCCTCCTGGG - Intergenic
1078082405 11:8213718-8213740 CTCCAAGGCCTCTGCGTTCTGGG + Intergenic
1078121042 11:8509038-8509060 CACCAAAACCTCCGCCTCCTGGG - Intronic
1078444287 11:11392541-11392563 CACCACGACCTCCGCCTCCTGGG - Intronic
1079111990 11:17610262-17610284 CTCCAGGTCCCCCACCTCCTCGG + Exonic
1082037471 11:47657029-47657051 CACCAAAACCTCCGCCTCCTGGG + Intergenic
1083335360 11:61918657-61918679 CTCTAAGACCTCCACGTCCAGGG + Intronic
1083657139 11:64235003-64235025 CCCCGAGACGCCCGCGTCCAAGG - Intronic
1084149932 11:67283309-67283331 CTCCAAGGTCCCAGCCTCCTTGG + Intronic
1086458967 11:86986475-86986497 CTCCACAACCTCCGCCTCCTGGG - Intergenic
1089695485 11:120213565-120213587 CTCCAACTCCACCCCGTCCTAGG - Intronic
1091728963 12:2865726-2865748 CTCCACAACCACCGCCTCCTGGG + Intronic
1093449699 12:19301072-19301094 CACCATGACCTCCGCCTCCTGGG - Intronic
1094194599 12:27734316-27734338 CACCAAAACCTCCGCCTCCTGGG + Intronic
1094487786 12:30938639-30938661 GTCCAAGACCCCAGGGTGCTGGG - Intronic
1098556995 12:71830526-71830548 CACCAAAACCTCCGCTTCCTGGG + Intergenic
1101035512 12:100702201-100702223 CTCCACAACCTCCGCCTCCTGGG + Intergenic
1102453297 12:113056885-113056907 CTCCAGCACCGCCGCCTCCTGGG - Intronic
1103308925 12:119989336-119989358 CTCCATGACCCCCGGCTCCGCGG - Intergenic
1103339510 12:120213990-120214012 CTCCAAAACCCCCGCTCCCCAGG - Exonic
1103514901 12:121501023-121501045 CACCACAACCCCCGCCTCCTGGG - Intronic
1103595980 12:122024364-122024386 CTCCGAGAGCACCGCGCCCTGGG + Intronic
1103601918 12:122059816-122059838 CCCCAACACCTGCGCGTCCTTGG - Exonic
1111356056 13:87103629-87103651 CACCATGACCTCCGCCTCCTGGG - Intergenic
1112331354 13:98479229-98479251 TTCCAAGAGCCCAGCGGCCTTGG + Intronic
1113778799 13:112963940-112963962 CTCTGAGTCCCCTGCGTCCTTGG - Intronic
1113788540 13:113015510-113015532 TCCCAAGAGCACCGCGTCCTCGG - Intronic
1118453388 14:65924455-65924477 TTCCAAGACCCCCATATCCTGGG - Intergenic
1121789876 14:96690985-96691007 CTCCAATACCTCCCAGTCCTAGG + Intergenic
1122007922 14:98720905-98720927 CTCCAAGTCCCCAAAGTCCTAGG - Intergenic
1122993502 14:105249942-105249964 CTCGAAGACCACCGCCTCTTTGG - Exonic
1123998971 15:25738896-25738918 CTCCAAGACCACTGTGACCTTGG - Intronic
1127757071 15:62103086-62103108 CACCACAACCCCCACGTCCTGGG - Intergenic
1128843521 15:70870564-70870586 CACCAAAACCTCCGCCTCCTGGG + Intronic
1130431503 15:83852186-83852208 CACTATGACCCCCGCCTCCTGGG + Intronic
1131128978 15:89882429-89882451 CACCACAACCCCCGCCTCCTGGG + Intronic
1132869401 16:2109056-2109078 CTCCAACAGCCCCGCGGCCACGG + Exonic
1133168431 16:3965017-3965039 CTCTGAGACCCCCGAGGCCTGGG + Exonic
1134175943 16:12006438-12006460 CACCAAAACCTCCGCCTCCTGGG - Intronic
1134234541 16:12455188-12455210 CTCCAAGACGCCCTTCTCCTTGG + Intronic
1134718010 16:16366542-16366564 CTCCAACAGCCCCGCGGCCACGG - Intergenic
1134956741 16:18385617-18385639 CTCCAACAGCCCCGCGGCCACGG + Intergenic
1136609426 16:31357150-31357172 CTCCCAGCCCCCCGCGGCCCCGG - Intronic
1138272310 16:55704012-55704034 CTCCAAGACACCTGCCACCTGGG - Intronic
1139484771 16:67249251-67249273 CCCCAACACCCCCACCTCCTCGG + Intronic
1140661051 16:77191520-77191542 CTCCAAGTCCTCCGCGCCCCCGG - Exonic
1141694674 16:85613842-85613864 CCCCCACACCCCCGCTTCCTCGG - Intronic
1143016436 17:3893253-3893275 CGCCACGCCCCCGGCGTCCTGGG + Intronic
1143337257 17:6181178-6181200 CACCACAACCTCCGCGTCCTGGG + Intergenic
1143976699 17:10835656-10835678 CTCGGGGACCCCGGCGTCCTTGG - Intronic
1145001811 17:19310651-19310673 CCCTGAGACCTCCGCGTCCTGGG + Intronic
1145747387 17:27330551-27330573 CACCAAAACCTCCGCCTCCTGGG + Intergenic
1147566017 17:41536849-41536871 GTCCAAGACCCCTGCATCCGAGG - Intergenic
1151020440 17:70610542-70610564 CTCAGAGACCCCCCCTTCCTTGG + Intergenic
1151094414 17:71479681-71479703 CTTCAACACCCCTGCCTCCTGGG + Intergenic
1151166225 17:72205850-72205872 CTTCAGGACCCCCTCATCCTTGG - Intergenic
1152773107 17:82182759-82182781 CACCAAAACCTCCGCCTCCTGGG + Intronic
1155598782 18:27518984-27519006 CACCACGACCTCCGCCTCCTGGG + Intergenic
1157418552 18:47526306-47526328 CTCCCAGTCCCCCGCCCCCTTGG + Intergenic
1161135569 19:2617543-2617565 CTCCCAGACCTCCGCTTCCAGGG + Intronic
1161350136 19:3786540-3786562 CTCCAAGAACCCCGCTTCCCAGG - Intronic
1162003548 19:7763516-7763538 CTCCCAGACCCCTGGGTCCTGGG + Intronic
1163158527 19:15451844-15451866 CTCCAAGACCCCCGCGTCCTTGG + Exonic
1163678846 19:18669247-18669269 CCCCAAGACCCCCGGGACCCTGG + Exonic
1165488520 19:36109977-36109999 CTCTATGACCTCCGCCTCCTGGG - Intergenic
1166092657 19:40520189-40520211 CTGCAATCCCCCCGCGGCCTCGG - Intronic
1166224960 19:41389339-41389361 CACCACAACCTCCGCGTCCTGGG + Intronic
1166354298 19:42217798-42217820 CTCCAAGCCCCGCCCTTCCTGGG + Intronic
1166529471 19:43533990-43534012 CTCGAAGGCCCCCGCCCCCTGGG + Intronic
1166584911 19:43937285-43937307 CACCACAACCCCCGCGTCCTGGG + Intergenic
1166962717 19:46508605-46508627 CACCACGACCTCCGCCTCCTGGG + Intronic
1167158627 19:47754199-47754221 CACCACAACCCCCGCCTCCTGGG - Intronic
927151691 2:20199868-20199890 TTCCAAGACCCCAGCTCCCTGGG - Intergenic
929610949 2:43270269-43270291 CTCTAAAACCCTCGAGTCCTGGG + Intronic
930020263 2:46997628-46997650 GTCCAGGAGCCCTGCGTCCTGGG - Intronic
931394606 2:61875064-61875086 CACCACAACCCCCGCCTCCTGGG - Intronic
932330839 2:70897517-70897539 CGCTAAGTCCCCCGGGTCCTTGG - Intergenic
939333513 2:140794687-140794709 CACCACAACCCCCGCCTCCTGGG + Intronic
940530765 2:154873579-154873601 CTCCAAAACCGCCGAGGCCTTGG + Intergenic
946027315 2:216679642-216679664 CCCCAGGACCCCCTCCTCCTAGG - Intronic
947384270 2:229575634-229575656 CTCCAACACCACCGCAGCCTGGG + Intronic
947773673 2:232690883-232690905 CACCACAACCCCCGCCTCCTGGG + Intergenic
948067590 2:235092666-235092688 CTCCAAGGCCAGCGCGCCCTTGG - Intergenic
948681452 2:239637902-239637924 CTCCAACACCTCTGCTTCCTTGG - Intergenic
1169577896 20:6986267-6986289 CACCAAAACCTCCGCCTCCTGGG - Intergenic
1171011635 20:21512423-21512445 CTCCAAGTCCCCGGAGCCCTCGG - Exonic
1173856218 20:46252102-46252124 CCCCAAGACCCAGGCCTCCTTGG + Intronic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1175872780 20:62216353-62216375 CTCCAAGCCGTCGGCGTCCTCGG - Exonic
1175911387 20:62406973-62406995 CGCCAGGACCCCCGCGCCCCAGG - Exonic
1176241597 20:64078176-64078198 CCCCAATACCCCCGAGGCCTGGG + Intronic
1176622611 21:9069810-9069832 GTCCAAGAACCCCCCATCCTTGG + Intergenic
1179888761 21:44325592-44325614 CTGCAGGAAGCCCGCGTCCTGGG + Intronic
1182559903 22:31151459-31151481 CTCCCAGACCCCACAGTCCTAGG + Intergenic
1182583203 22:31327632-31327654 CTCAAAGACCCCCAACTCCTAGG + Intronic
1183195401 22:36350459-36350481 CACCACAACCCCCGCCTCCTGGG - Intronic
1185079520 22:48701924-48701946 CTCCAAGGCCCCCCAGTCCCCGG - Intronic
1185101784 22:48844535-48844557 CTCCAGGGCTCCCGCGTGCTAGG + Intronic
950400423 3:12765643-12765665 CTCCAAGCTCCCCACATCCTGGG + Intronic
951538358 3:23759992-23760014 CTCCAAAACCTCCACCTCCTGGG - Intergenic
952268188 3:31806913-31806935 CTCCCAGACCCCTGTTTCCTGGG - Intronic
953528440 3:43715234-43715256 CACCACAACCTCCGCGTCCTGGG + Intronic
954263486 3:49456525-49456547 CTCCAAGGCCTCTGTGTCCTGGG + Intergenic
954575068 3:51671385-51671407 CTCCGTGACCCCCGCGGCCCGGG + Exonic
964776353 3:160282203-160282225 CACCAAAACCTCCGCTTCCTGGG - Intronic
968701676 4:2060570-2060592 CTCCAGGACCCCCTCTTCCCAGG - Intronic
969331994 4:6479272-6479294 CTCCATGACCCCCAGGTCCCAGG + Intronic
976199910 4:82567743-82567765 CTCCACTACCTCCGCCTCCTGGG + Intergenic
982696923 4:158612684-158612706 CACCACAACCCCCGCCTCCTGGG + Intronic
983350908 4:166587187-166587209 CTGCAAAACCTCCGCCTCCTGGG + Intergenic
986690189 5:10307727-10307749 CCGCAGGATCCCCGCGTCCTCGG - Exonic
988119609 5:26943435-26943457 CACCAAAACCCCCGCCTCCCAGG - Intronic
988371337 5:30371694-30371716 CTGCAACACCTCCGCTTCCTGGG - Intergenic
988469715 5:31526854-31526876 CTCCATGTCCTCCTCGTCCTCGG + Exonic
991661936 5:68959258-68959280 CACCACGACCTCCGCCTCCTGGG - Intergenic
996884877 5:128342802-128342824 CACCAAAACCTCCGCTTCCTGGG + Intronic
1000036352 5:157451449-157451471 CACCACGACCTCCGCCTCCTGGG - Intronic
1002828064 6:791712-791734 CACCAAAACCTCCGCTTCCTGGG - Intergenic
1005365254 6:25070002-25070024 CTGCAAGACCCCGGGGTCCATGG - Intergenic
1005852099 6:29829544-29829566 CTCCACGAGCTCCACGTCCTGGG - Exonic
1005859469 6:29889455-29889477 CTCCACGAGCTCCGTGTCCTGGG - Intergenic
1005867033 6:29944248-29944270 CTCCACGAGCTCCGTGTCCTGGG - Exonic
1005932034 6:30491263-30491285 CTCCACGAGCTCCGTGTCCTGGG - Exonic
1006174686 6:32114863-32114885 CACCGAGACCCCCACTTCCTGGG + Intronic
1007522550 6:42462500-42462522 CTGCAAAACCTCCGCCTCCTGGG - Intergenic
1018309186 6:162491025-162491047 CACCACAACCCCCGCCTCCTGGG - Intronic
1019659639 7:2216956-2216978 CTCCCAGCCCTCCGCGTACTGGG + Intronic
1026818242 7:73529091-73529113 CACCACGACCTCCGCCTCCTGGG + Intergenic
1027255706 7:76429551-76429573 CTCCATGACCCCCGCCCCGTGGG + Exonic
1028621809 7:92834948-92834970 CTCCAGGGCCGCCGCGGCCTCGG + Intronic
1029212565 7:98920913-98920935 CACCAAAACCTCCGCCTCCTGGG + Intronic
1038348170 8:26750991-26751013 CTCCACAACCTCCGCCTCCTGGG - Intronic
1039768810 8:40661856-40661878 CTCTAAGACCCTCCCTTCCTGGG - Intronic
1041383880 8:57279180-57279202 CTCCGAGAGCTCCGCGTCGTGGG - Intergenic
1042611726 8:70607971-70607993 GCCCGAGCCCCCCGCGTCCTGGG + Intronic
1047568576 8:126073263-126073285 CTCCAAGCCCTCCAGGTCCTTGG + Intergenic
1048465893 8:134664388-134664410 GTCCAAGACCCCTGCTCCCTTGG - Intronic
1049644040 8:143728198-143728220 CTCCACGGCGCCCGCGCCCTCGG + Exonic
1049746284 8:144264671-144264693 CTCCAGGACCCCCGCCGCCCAGG + Intronic
1049804366 8:144532304-144532326 CTGGAAGACCCCCACGTCCCTGG - Exonic
1050329397 9:4530398-4530420 CTTCAAGATCCAAGCGTCCTGGG + Intronic
1050365851 9:4873224-4873246 CTCCAAGAGCCCAGCGCACTTGG + Intronic
1051622857 9:19069619-19069641 CTGCAACATCCCCGCCTCCTGGG - Intronic
1056171620 9:83990881-83990903 CACCACAACCCCCGCCTCCTGGG + Intronic
1057102592 9:92376967-92376989 CACCAAAACCTCCGCTTCCTGGG - Intronic
1057455344 9:95203946-95203968 CTTGAAGACCCCAGAGTCCTTGG + Intronic
1057872914 9:98731673-98731695 CTCCAGGACCCCCGCCAACTTGG - Intronic
1061412276 9:130428149-130428171 CTCCAAGGGACCCGAGTCCTTGG - Intronic
1062013579 9:134280173-134280195 CTCCCAGACTCCGGCGTCCTGGG + Intergenic
1062349884 9:136133412-136133434 CTCCCGGACCCCCGCGTGCTGGG + Intergenic
1203774469 EBV:65053-65075 CTCCAGGTCCCCGGCGTCCTTGG - Intergenic
1196823927 X:119725926-119725948 CACCACAACCCCCGCCTCCTGGG - Intergenic
1199700373 X:150371168-150371190 CTCCCAGACCCCCATTTCCTTGG + Intronic