ID: 1163158716

View in Genome Browser
Species Human (GRCh38)
Location 19:15452558-15452580
Sequence CCGTGCTAGGCGTGGTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 45}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163158699_1163158716 18 Left 1163158699 19:15452517-15452539 CCTGGACAGACTTATTGGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1163158716 19:15452558-15452580 CCGTGCTAGGCGTGGTTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1163158709_1163158716 -7 Left 1163158709 19:15452542-15452564 CCAGGGTGGGGCTTGGCCGTGCT 0: 1
1: 0
2: 0
3: 15
4: 237
Right 1163158716 19:15452558-15452580 CCGTGCTAGGCGTGGTTTGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163158716 Original CRISPR CCGTGCTAGGCGTGGTTTGG GGG Intronic
904264990 1:29313042-29313064 GCGTGCTAGGCCTGGCCTGGGGG + Intronic
906147004 1:43566125-43566147 CCGGCCGAGGCGTGGTGTGGGGG + Intronic
1074206844 10:111290148-111290170 CCTTGCTTGGGGTGGTTTTGTGG + Intergenic
1078931135 11:15912849-15912871 CCATCCTAGGCCTGGTGTGGAGG - Intergenic
1088882702 11:113984127-113984149 CCAGGCTAGGTGTGGTTGGGGGG - Intronic
1091417919 12:306260-306282 CCATTCTAGGCTTGGTGTGGTGG - Intronic
1102392210 12:112558286-112558308 ACGTGCTTGGCATGGTTTGAAGG - Intergenic
1104467808 12:129004862-129004884 CTGAGGTAGGAGTGGTTTGGAGG + Intergenic
1104467865 12:129005094-129005116 CTGAGGTAGGAGTGGTTTGGAGG + Intergenic
1113788552 13:113015573-113015595 CCGTGCCAGCCATGGATTGGGGG - Intronic
1114522604 14:23348439-23348461 CCGGGCTAGGGCTAGTTTGGAGG + Intronic
1123192841 14:106587392-106587414 CTGTGCTGGGCTTGGTTCGGGGG - Intergenic
1132016362 15:98320819-98320841 CCGTGCCAGGCGTGGGGAGGTGG + Intergenic
1136622904 16:31442208-31442230 CCGCGCCAGGCGAGGCTTGGTGG - Intronic
1141005109 16:80344701-80344723 CCGTGCTAGGAGAGGGTAGGAGG + Intergenic
1149746979 17:59107973-59107995 CAGTGCTAGGCCTGGCGTGGTGG + Intergenic
1160793364 19:933059-933081 CCGAGCTGGGCTTGGGTTGGAGG + Intronic
1163158716 19:15452558-15452580 CCGTGCTAGGCGTGGTTTGGGGG + Intronic
1167287363 19:48606021-48606043 AAGTGCCAGGCGTGGTGTGGTGG + Intronic
927552461 2:24011304-24011326 ACTTGCTAGGCCTGTTTTGGGGG + Intronic
930771957 2:55138004-55138026 CCCTTCCAGGCATGGTTTGGAGG + Intergenic
938418319 2:131123065-131123087 CCATGCTAGGCGTGATGGGGAGG - Intronic
940384279 2:153052193-153052215 TCCTGCTATGCTTGGTTTGGTGG + Intergenic
1168736386 20:142419-142441 CTGTGCTAGGCATGCCTTGGGGG - Exonic
1174467829 20:50731246-50731268 CGGTGGTAGGCGGGGTTTTGAGG + Intergenic
1175527259 20:59643904-59643926 TCCTGCTTGGCGTTGTTTGGTGG + Intronic
1179029052 21:37703973-37703995 CCCTGCTGGGCCTGGTTTGTGGG + Intronic
953503688 3:43462517-43462539 GAGTGCTAGGCCTGGTATGGTGG - Intronic
995792023 5:115899003-115899025 CTGTGCAGGGCTTGGTTTGGAGG + Intronic
998407808 5:141883685-141883707 CCGGGCCAGGCGTGGTTTAGTGG - Intergenic
1003625325 6:7736275-7736297 CCATGCTAGGCAGGATTTGGGGG + Intronic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1006550040 6:34814911-34814933 CTGTGCCAGGTGTGTTTTGGGGG + Intronic
1013846500 6:114459241-114459263 CCTTGGTAGGCGTGGTTGGGAGG + Intergenic
1019324206 7:430062-430084 CGGTGCTGGGCCTGGTGTGGGGG - Intergenic
1019502044 7:1369366-1369388 CTGGGATAGGCGTGGTCTGGAGG - Intergenic
1019576619 7:1740679-1740701 CTGTGCTAGGAGGGGTTCGGGGG - Intronic
1028486036 7:91358541-91358563 CTGATCTTGGCGTGGTTTGGTGG + Intergenic
1029207718 7:98879129-98879151 CCGGGCTTGGCGGGGTCTGGGGG + Intronic
1035616068 8:1002843-1002865 CCATGCTGGGCATGCTTTGGGGG - Intergenic
1053478478 9:38398918-38398940 CCATGCTAGGCTTGGCTTGAAGG - Intergenic
1056441127 9:86622380-86622402 CCAGGCTGGGCGTGGTGTGGAGG - Intergenic
1056992852 9:91426571-91426593 CAGTGCTAGGGGTGGATTGAGGG + Intergenic
1057046383 9:91889436-91889458 GCATGCTAGACGTGGTTGGGGGG + Intronic
1061397167 9:130349473-130349495 CCGTGGTAGGCGGGGCTTGCAGG + Intronic
1190130598 X:47745354-47745376 CCAAGCTAGGCTTGGTTGGGTGG + Intergenic
1192042858 X:67641584-67641606 CCTTGCTAGCCTTGGTTTGTTGG + Intronic
1195050915 X:101096184-101096206 CCTTGTTAGGTGTGCTTTGGTGG + Exonic