ID: 1163158817

View in Genome Browser
Species Human (GRCh38)
Location 19:15452988-15453010
Sequence TCGCTGTGCTGTGTGACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 296}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163158817_1163158820 6 Left 1163158817 19:15452988-15453010 CCTGGGGTCACACAGCACAGCGA 0: 1
1: 0
2: 2
3: 33
4: 296
Right 1163158820 19:15453017-15453039 TACTTGAACCCAGACTTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163158817 Original CRISPR TCGCTGTGCTGTGTGACCCC AGG (reversed) Intronic