ID: 1163164709

View in Genome Browser
Species Human (GRCh38)
Location 19:15487932-15487954
Sequence ATGCCTATGCTGCTGCTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 180}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163164706_1163164709 -8 Left 1163164706 19:15487917-15487939 CCCGCCTGGATTCAAATGCCTAT 0: 1
1: 0
2: 1
3: 27
4: 328
Right 1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1163164705_1163164709 -4 Left 1163164705 19:15487913-15487935 CCAGCCCGCCTGGATTCAAATGC 0: 1
1: 0
2: 4
3: 56
4: 430
Right 1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1163164707_1163164709 -9 Left 1163164707 19:15487918-15487940 CCGCCTGGATTCAAATGCCTATG 0: 1
1: 0
2: 1
3: 15
4: 412
Right 1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1163164701_1163164709 6 Left 1163164701 19:15487903-15487925 CCCTGCCGAGCCAGCCCGCCTGG 0: 1
1: 0
2: 0
3: 17
4: 217
Right 1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1163164703_1163164709 5 Left 1163164703 19:15487904-15487926 CCTGCCGAGCCAGCCCGCCTGGA 0: 1
1: 0
2: 0
3: 21
4: 250
Right 1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1163164704_1163164709 1 Left 1163164704 19:15487908-15487930 CCGAGCCAGCCCGCCTGGATTCA 0: 1
1: 0
2: 1
3: 13
4: 182
Right 1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1163164699_1163164709 30 Left 1163164699 19:15487879-15487901 CCTTTTAATACAAACTTTGCTGA 0: 1
1: 0
2: 5
3: 43
4: 431
Right 1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG 0: 1
1: 0
2: 1
3: 16
4: 180
1163164700_1163164709 7 Left 1163164700 19:15487902-15487924 CCCCTGCCGAGCCAGCCCGCCTG 0: 1
1: 0
2: 2
3: 76
4: 1090
Right 1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG 0: 1
1: 0
2: 1
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163164709 Original CRISPR ATGCCTATGCTGCTGCTTAC TGG Intronic
902831468 1:19016144-19016166 ATGCTGATGCTGCTGGTTCCAGG - Intergenic
904601896 1:31677776-31677798 AAGCCGAGGCTGCTGCTCACAGG - Intronic
904973610 1:34438417-34438439 ATGCCAATGCTGCTGGTTCAAGG + Intergenic
907553981 1:55328794-55328816 TTGCCTATGCTGCTGGTCCCAGG + Intergenic
910507959 1:87971729-87971751 ATGCCTGTGCTGCTGCTCCATGG - Intergenic
912248339 1:107984584-107984606 ATGCCTGTACTGCTACTTACTGG - Intergenic
913177552 1:116288777-116288799 ATTCCAATGCTGCTGGTTCCTGG - Intergenic
913364613 1:118023028-118023050 ATGCCTAAGCTGCTGTTTTAGGG - Intronic
916064359 1:161124070-161124092 ACGCCTATGCTGCTCCTTCCTGG + Intronic
916703994 1:167327657-167327679 ATGTCTTTGCTGCCGTTTACTGG + Intronic
917442515 1:175079897-175079919 ATGCTGATGCTGCTGGTTAGAGG + Intronic
919017703 1:192061648-192061670 ATGCCTAAGTTGCTGCTGTCAGG - Intergenic
919625675 1:199907799-199907821 ATGCCTATGCTCCTAGCTACTGG + Intergenic
923541737 1:234893164-234893186 ATGCCCCTGCTGCTGGTTCCTGG + Intergenic
1063935568 10:11074309-11074331 ATGACTGTTCTGCTGCTTAAGGG + Intronic
1064713026 10:18145906-18145928 CTGCCTGTGCTCCTCCTTACTGG + Intronic
1065628572 10:27654937-27654959 ATGCACCTGCTGCTGCTTATTGG - Intergenic
1068721036 10:60246587-60246609 AAGCATTTGCTGCTGCTTCCTGG - Intronic
1068934312 10:62621383-62621405 ATGGCTATACTGGTGCATACTGG - Intronic
1069840689 10:71337545-71337567 CTGCCTCTGCTGCTGCTTCCTGG + Intronic
1070190574 10:74108337-74108359 TTGCCTATGTAGCTGCTTTCTGG + Intronic
1072273389 10:93799502-93799524 TAGCATATGATGCTGCTTACAGG - Intergenic
1073093144 10:100961343-100961365 ATGCCAATGCTGCTGCTTCAGGG + Intronic
1076001779 10:126918336-126918358 ATGCCGCTGCCGCTGCCTACTGG + Intronic
1077311722 11:1891758-1891780 ATGCCTATGTTCCAGCTTCCTGG + Exonic
1079229079 11:18634178-18634200 ATGCCCCAGCTGCTACTTACCGG + Exonic
1079635421 11:22733058-22733080 ATGCCTATACTGCTGGTCTCTGG + Intronic
1079765433 11:24386624-24386646 ATGCCAATGCTGCTGGTTCTGGG + Intergenic
1082841240 11:57691921-57691943 AAGCTTATAGTGCTGCTTACAGG + Intronic
1084365146 11:68692899-68692921 CTGCCGCTGCTGCTGCTCACTGG + Intergenic
1085941010 11:81207105-81207127 ATGCTAATGCTGCTGGTTTCTGG - Intergenic
1088285904 11:108187323-108187345 GTGCCTGTGCTGCTGGCTACTGG + Intronic
1088607972 11:111549446-111549468 ATGCGTGTGGTTCTGCTTACTGG + Intronic
1088840052 11:113618914-113618936 ATGCCCATGCTGCTGGTTTGAGG - Intergenic
1094039458 12:26107730-26107752 ATGCCAATGCTGCTGGTTCATGG + Intergenic
1096259811 12:50083408-50083430 AGGCCAATGCAGCTGCTCACAGG - Exonic
1097604010 12:61730652-61730674 CTGCCTCTGCTGCTTCATACAGG + Intronic
1098159364 12:67634580-67634602 GTTCCCATGCTGCTGTTTACTGG - Intergenic
1098586449 12:72160274-72160296 ATGCTTATGCTGCTGTTTTGTGG - Intronic
1102913945 12:116738965-116738987 ATGAAGATGCTGCTGCTGACCGG + Intronic
1107554533 13:41506129-41506151 ATGCCCATTCTCCTGCTTCCAGG + Intergenic
1108188937 13:47917408-47917430 CTGCCTCTGCTGCTTCTTACAGG - Intergenic
1108626481 13:52233743-52233765 AGGCCTGTGCTGCTTCTAACTGG - Intergenic
1108659586 13:52572745-52572767 AGGCCTGTGCTGCTTCTAACTGG + Intergenic
1108733925 13:53262683-53262705 ATGCCTATGATGCTGGTCCCAGG - Intergenic
1111408158 13:87837134-87837156 ATGCTAATGCTGCTGGTTCCAGG + Intergenic
1112078676 13:95941374-95941396 ATACCTGTGCTGCTGCTTAAAGG - Intronic
1113512990 13:110870524-110870546 ATGCCAATGCCGTTCCTTACTGG + Intergenic
1113561808 13:111287290-111287312 ATGCCTGCTCTGTTGCTTACTGG + Intronic
1114371995 14:22099950-22099972 AAGCCAATGCTGCTGCTTTGTGG - Intergenic
1114770491 14:25425264-25425286 ATTCTTATGCTGCTGCTGATGGG - Intergenic
1118470070 14:66067321-66067343 ATGCCGATGCTGCTGGTCTCTGG - Intergenic
1118896296 14:69948603-69948625 TTGCCTATGCTGCAGCTCACAGG - Intronic
1119483094 14:74971788-74971810 ATGCCAATGCTGCTGGTCCCCGG - Intergenic
1120115063 14:80606282-80606304 ATACCTTTGTTGCTGCTTAATGG - Intronic
1120635988 14:86951609-86951631 ATGCCTGGGCTGCAGCTTTCAGG - Intergenic
1122285970 14:100653156-100653178 ATGGCAATGCTGCTGCATATGGG + Intergenic
1129416765 15:75387762-75387784 GTGCTTATGTTGCTGATTACAGG - Intronic
1131711333 15:95059568-95059590 CTGCCTTTGCTGCTTCATACAGG + Intergenic
1131783044 15:95880899-95880921 GAGCCTTTTCTGCTGCTTACTGG - Intergenic
1132608890 16:805342-805364 ATGGCCCTGCTGCTGCTTCCGGG + Intergenic
1136901890 16:34049514-34049536 ATCCCTAGGCTGCTGGTTTCAGG - Intergenic
1137536223 16:49328574-49328596 ATGCATATTCTACTGCTTGCTGG - Intergenic
1137817938 16:51417024-51417046 ATGCCTATGCTGCTGGTCCATGG + Intergenic
1139044710 16:63042484-63042506 ATGTATATCCTGCTGCCTACAGG + Intergenic
1139395780 16:66637792-66637814 AAGCCTATGCCGCTGCTTCCAGG + Intronic
1143982745 17:10883935-10883957 TTGCCTCTGTTGCTGCTTCCTGG + Intergenic
1144054620 17:11528684-11528706 ATGCCTGTGCTGCTGTCTCCTGG - Intronic
1147801544 17:43093753-43093775 TTGCTTATACTGCTGCTTATAGG + Exonic
1153677322 18:7467412-7467434 CTGCCTATGCTGCTGCATTGGGG - Intergenic
1155998926 18:32362614-32362636 ATGACTAAGCTGGTGTTTACTGG + Intronic
1156353985 18:36325533-36325555 ATGGCTATTCTGCTGCTTCCTGG - Intronic
1157788395 18:50507372-50507394 CTGCCTAGGCTGCTGTTTCCTGG + Intergenic
1159955339 18:74515048-74515070 ATGTCTGTGCTCCTGCTGACCGG - Intronic
1160811520 19:1014933-1014955 ACACCCATGCTGCTGCTTGCAGG - Intronic
1163164709 19:15487932-15487954 ATGCCTATGCTGCTGCTTACTGG + Intronic
1164168789 19:22705382-22705404 ATGCAAATGCTGGGGCTTACTGG + Intergenic
927620906 2:24657225-24657247 ATGCTTTTGCTGCTGTTTATAGG + Intronic
929125812 2:38521821-38521843 ATGCTTATGCTGTTGGTTCCAGG + Intergenic
929130533 2:38565202-38565224 ATGCATATGCTTTTCCTTACAGG - Intronic
929851296 2:45592794-45592816 ATGCTTATGCTGCTGGTTTGGGG - Intronic
930031076 2:47058429-47058451 AGGCCTCTCCTGCTGCCTACTGG + Intronic
932823473 2:74920724-74920746 ATGCCTCTGCTACTGCTAAATGG - Intergenic
933720931 2:85397234-85397256 ATGTCTGTGCTGCTGGTTCCAGG - Intronic
935633892 2:105235099-105235121 AGGCCTGTGCTGCTGCTGGCAGG - Intergenic
935939371 2:108222204-108222226 ATGCCTAAGCTGCTGATCGCAGG - Intergenic
937593968 2:123650650-123650672 ATGCTTATGCTGCTGTTTCATGG - Intergenic
937928438 2:127185879-127185901 TTGCCTTTCCTGCTGCTCACCGG - Exonic
938561470 2:132476012-132476034 ATCCCTCTGCTGCTGCTAAGTGG - Intronic
938712935 2:133991048-133991070 ATGCCAATGCTGCTGGTTCAGGG + Intergenic
939036145 2:137133577-137133599 ATGCCTATGCTGTTGCTCCATGG + Intronic
939647310 2:144716597-144716619 AGGCCTATGCTGCTGCCCACAGG + Intergenic
941097852 2:161261092-161261114 ATGCCTCTGGTGCTGTTTAGTGG - Intergenic
946512628 2:220375732-220375754 ATGCCAATGCTGCTGATTCAAGG - Intergenic
946705065 2:222450344-222450366 ATGGCTATGCTGCTGCTAAAAGG - Intronic
948708456 2:239810397-239810419 ATGCTGATGCTGCTGGTTCCTGG + Intergenic
1169619212 20:7486313-7486335 ATGCATATGCTGCTGCTCTTAGG + Intergenic
1169992184 20:11515631-11515653 ATGCCTGTGTTGCTCCTTCCTGG + Intergenic
1170851545 20:20009311-20009333 ATGCTGATACTGCTGCTTATTGG + Intergenic
1170851749 20:20011174-20011196 ATGCTGATACTGCTGCTTATTGG + Intergenic
1171327085 20:24304237-24304259 ATGCCTATGCAGCTGGTACCCGG - Intergenic
1173304489 20:41835389-41835411 CTGCCACTGCTGCTGCTTAAAGG - Intergenic
1174917438 20:54668506-54668528 GTTCCTGTTCTGCTGCTTACAGG + Intergenic
1180720057 22:17901373-17901395 TGGCCCAGGCTGCTGCTTACAGG - Intronic
950575522 3:13829982-13830004 ATGTCTGTGCTGCTGCTGCCTGG + Intronic
951082383 3:18467382-18467404 AAGCCTATGCTGCTAGTTTCTGG - Intergenic
951191013 3:19771637-19771659 ATGCCCATGCTGCTGGTTCCCGG - Intergenic
954290394 3:49646875-49646897 ATGCCTAAGCTCCTTCTTTCTGG - Intronic
955681771 3:61509037-61509059 ATGCCTCTGGTGCTGCTGAAGGG + Intergenic
957906461 3:86562321-86562343 AGGCCAGTGCTGCTGCTTAGTGG + Intergenic
961936140 3:130585903-130585925 ATGCCAGTGCTGCTGCTTCAAGG + Intronic
962457914 3:135582310-135582332 ATGCCAATGCTGCTGGTTCATGG - Intergenic
962982340 3:140501900-140501922 ATGCCTGTGCTGCTGGTTCATGG + Intronic
965061061 3:163786509-163786531 CTGCCTCTGCTGCTTCATACAGG + Intergenic
965655561 3:170980022-170980044 ATGCGTATTCTGCTGCTAAAGGG + Intergenic
970225528 4:13852673-13852695 ATGCCGATGCTGCTGATTCCAGG - Intergenic
971803926 4:31329707-31329729 ATTACTATGCCACTGCTTACTGG - Intergenic
972442760 4:39112453-39112475 GTCCCAATTCTGCTGCTTACTGG + Intronic
973017619 4:45161001-45161023 ATGCCTACGATGCTGCTTACTGG - Intergenic
973936601 4:55853035-55853057 ATGCCAATGTTGCTGGTTGCAGG - Intergenic
975928726 4:79492091-79492113 CTGCCTCTGCTGCTTCCTACAGG + Intergenic
976555122 4:86441825-86441847 AAGCCTCTCCTGCTGCTTCCTGG + Intronic
977634376 4:99280173-99280195 AACCCTATGCTGCTACTGACTGG - Exonic
977637054 4:99311550-99311572 AACCCTATGCTGCTACTGACTGG - Exonic
977639499 4:99340604-99340626 AACCCTATGCTGCTACTGACTGG - Exonic
980533194 4:134081281-134081303 ATTCCTCTGCAGCTGCTTTCGGG - Intergenic
981442556 4:144799514-144799536 CTGCCTTTGCTGCTTCATACAGG + Intergenic
982047649 4:151464871-151464893 ATGCCTATGCTGCTAGTCAGGGG - Intronic
982288469 4:153758350-153758372 ATGCCTTGGCTGCTGGTTCCTGG + Intronic
983368243 4:166823989-166824011 GTCCCTAAGCTGCTGCTTCCAGG + Intronic
987636171 5:20545197-20545219 CAGCCTCTGCTGCTGCTTTCAGG + Intronic
988702484 5:33689276-33689298 ATGCTGGTCCTGCTGCTTACTGG - Intronic
991626192 5:68603494-68603516 ATGCCTGTGCTGCTGGTTTGGGG - Intergenic
994608672 5:102007386-102007408 ATGCTTATGCTGTTGTTTAAAGG + Intergenic
999053721 5:148551211-148551233 ATGCAGAAGCTTCTGCTTACAGG + Intronic
999098492 5:149003046-149003068 ATGCTGATGCTGCTGGTTAGTGG + Intronic
1000138907 5:158382139-158382161 ATGGCTATGCAGATGCTGACTGG - Intergenic
1001053819 5:168433317-168433339 AGGCCAATGCTGCTGGTTCCTGG + Intronic
1001698276 5:173688798-173688820 GTGCCCATGCTGCTGGTTTCTGG - Intergenic
1002818105 6:697484-697506 ATGGTTATGCAGCTGCTTCCTGG - Intergenic
1003095116 6:3136424-3136446 CTGCCTTTGCTTCTGCTGACTGG - Intronic
1004855239 6:19743069-19743091 GTGAGTATGCTGCTGCTGACAGG - Intergenic
1005770191 6:29062043-29062065 ATGCATATTCTGCTGATTAGGGG + Intergenic
1007241122 6:40425904-40425926 ATGCCTCTGCTCCTCCTTCCTGG + Intronic
1008013189 6:46490834-46490856 ATGCACCTGCTGCTGCTTCCAGG + Intronic
1011597394 6:89029034-89029056 ATGGCTTTGGTGCTGTTTACTGG + Intergenic
1012279273 6:97309868-97309890 ATGCCAATGCTGCTGGTCTCTGG - Intergenic
1012965605 6:105669604-105669626 TTGCCTCTGCTGCATCTTACAGG - Intergenic
1013068332 6:106705022-106705044 ATGCTGATGCTGATGCTTAAGGG - Intergenic
1016663714 6:146610861-146610883 GTGCCCATGCTGCTGGTTGCAGG + Intronic
1019054659 6:169214322-169214344 ACGCTGATGCTGCTGCTCACAGG - Intergenic
1019187160 6:170227501-170227523 ATGCCTTCGCTGCTGGTTACAGG - Intergenic
1021191789 7:17628956-17628978 ATGCTGATGCTGCTGTTTCCTGG + Intergenic
1021436373 7:20621454-20621476 GTGCCTATGCTGCTGCTCTTGGG + Intronic
1023658578 7:42450716-42450738 ATGCCAATGCTGCTGCTGGTTGG + Intergenic
1023669624 7:42561835-42561857 CTGCCTCTGCTGCTTCATACAGG - Intergenic
1024804553 7:53122188-53122210 ATCCCTAGGCTGCTGATTTCAGG + Intergenic
1027613063 7:80386953-80386975 ATTCTGATGCTGCTGCTTTCTGG + Intronic
1027866473 7:83654100-83654122 ATGGCGATTATGCTGCTTACTGG - Intergenic
1028782846 7:94757128-94757150 CTGCCTATGCTGCTTTGTACAGG - Intergenic
1029795198 7:102887177-102887199 ATGCCTATGCTGCTGGTCTATGG - Intronic
1031681711 7:124682808-124682830 ATGCCCATGCTGCTGATTCAAGG + Intergenic
1032668978 7:134066182-134066204 TTGCCTAAGCTGCTGCTTCATGG + Intronic
1036771369 8:11580522-11580544 ATGCCCATGCTCCTGCCTCCAGG + Intergenic
1037825353 8:22157101-22157123 ATGCCCATGATGCTGCCTAGGGG - Intronic
1039553888 8:38463045-38463067 ATGAGTATGCTCGTGCTTACTGG - Intronic
1039642350 8:39237629-39237651 CTGCCTCTGCTGCTTCATACAGG - Intronic
1040820128 8:51546897-51546919 ATGCCTCTGCTGCTTCATTCAGG - Intronic
1041312315 8:56529557-56529579 CTGCCTGTGCTTCTGCCTACTGG - Intergenic
1041437100 8:57854125-57854147 ATGCCTGTCCTGCTGCTTTCTGG + Intergenic
1041622342 8:59987291-59987313 ATGCATATTCTGCTGCTGAATGG + Intergenic
1043025663 8:75065061-75065083 ATGCCTATAATGCAGCTTATTGG + Intergenic
1044329061 8:90895053-90895075 TTGACTAAGCTGCTGCTTATGGG + Intronic
1045156597 8:99481722-99481744 GTGCCTATACTGCTTCTAACTGG - Exonic
1045875774 8:106979158-106979180 AAGGTTATGCTGCTGCTAACTGG - Intergenic
1046162999 8:110391575-110391597 ATTCCTCTGTTGCTGCTTTCAGG - Intergenic
1046604639 8:116357485-116357507 ATGCAGATGCTGCTGGTTAGAGG + Intergenic
1047218699 8:122900783-122900805 ATGGCAATCCTGCTGCTTCCTGG - Intronic
1048888052 8:138924485-138924507 AAGCCTACGGTGCTGCTTCCTGG - Intergenic
1055845167 9:80553645-80553667 ATGCCCATCCTGCTTCTTACAGG - Intergenic
1057095892 9:92309020-92309042 CTGGCTGTGCTGCTGCTTGCAGG + Intronic
1058711687 9:107684466-107684488 CTGCTTATGCTTCTTCTTACAGG + Intergenic
1058837504 9:108871590-108871612 CTGCCTTTGCTGCTGCCTCCTGG + Intronic
1187564436 X:20434462-20434484 ATGCTGATGCTGCTGGTTCCTGG + Intergenic
1187712084 X:22064560-22064582 ATGCCCATGCTGCTGGTTTGGGG + Intronic
1188613290 X:32125892-32125914 ATGCTGATGCTGCTGGTTCCAGG - Intronic
1189244176 X:39550514-39550536 ATGCCTATGCCAGTGCTTTCTGG + Intergenic
1190247638 X:48700939-48700961 ATGGCCATGCTGGTGGTTACAGG + Intronic
1192635095 X:72808358-72808380 TTTCCTTTGCTGCTGCTTCCTGG + Intronic
1192646620 X:72912445-72912467 TTTCCTTTGCTGCTGCTTCCTGG - Intronic
1193771525 X:85593312-85593334 CTGCCTCTGCTGCATCTTACAGG - Intergenic
1194154291 X:90367313-90367335 ATGTATATTCTGCTGCTTTCGGG + Intergenic
1194515957 X:94854581-94854603 CTGCCTCTGCTGCTTCATACAGG - Intergenic
1195479700 X:105330016-105330038 ATGCCAATGCTGCTGGTTCATGG - Intronic
1195613817 X:106896983-106897005 ATGCCTTTTCTGCTGCATGCTGG - Intronic
1196136315 X:112213148-112213170 ATGCCTAGGCAGCTACTTGCGGG + Intergenic
1196750096 X:119108252-119108274 ATTCCTACTCTGCTACTTACTGG - Intronic
1197772867 X:130100541-130100563 ATGCCTTTGCTGCTCCTTTTTGG + Intronic