ID: 1163168374

View in Genome Browser
Species Human (GRCh38)
Location 19:15513125-15513147
Sequence TGTGGTCCATATGGAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 2, 2: 2, 3: 18, 4: 111}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163168374_1163168378 30 Left 1163168374 19:15513125-15513147 CCAGGCTTTCCATATGGACCACA 0: 1
1: 2
2: 2
3: 18
4: 111
Right 1163168378 19:15513178-15513200 TCATTTTTATTTTTTTGAGACGG 0: 10
1: 1077
2: 9204
3: 109711
4: 91047

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163168374 Original CRISPR TGTGGTCCATATGGAAAGCC TGG (reversed) Intronic
907274682 1:53310653-53310675 TGTGGCCCCTGTGGCAAGCCTGG + Intronic
910665997 1:89726465-89726487 TGTGGTCCACCTCGAAAGTCAGG - Intronic
912727207 1:112068852-112068874 TGTGGCTCACAAGGAAAGCCTGG - Intergenic
913152629 1:116060371-116060393 TGTAGCCCATTTGGGAAGCCTGG - Intronic
915145567 1:153794222-153794244 TGGGGGCCATAGGGAAAGCCAGG + Intergenic
917747529 1:178025259-178025281 TGTAGTCCAAGTGGAAAGCCAGG - Intergenic
921825820 1:219670895-219670917 TGTCGGCCATTTGGAAAGCCAGG + Intergenic
921974516 1:221187443-221187465 TGTGGTTCATATGCAAAAACTGG + Intergenic
1064886921 10:20122235-20122257 TGTGGTGCGTATTGACAGCCAGG - Intronic
1068987184 10:63118241-63118263 TGAGGTCCAGATGGAAAGATAGG - Intergenic
1069084996 10:64128662-64128684 TGTGGTCCAGATGCAAAGTCAGG - Intergenic
1078700559 11:13677605-13677627 TTTGGTTCATGTGGAAAGGCTGG + Intronic
1080931346 11:36814681-36814703 TCTGGTCCATATGGAACTCTTGG + Intergenic
1081515185 11:43821965-43821987 TGTGGTGCCTATGGAAAGGTGGG + Intronic
1084266264 11:68006897-68006919 TGTGGCCCAGCTGGAAAGCATGG + Intergenic
1095246814 12:39932922-39932944 TGTGGACCATGTGAAAAGCCAGG + Intronic
1104269248 12:127267519-127267541 AGTGGGGCAGATGGAAAGCCAGG + Intergenic
1104408395 12:128537846-128537868 TGTGGTCCATTGTCAAAGCCAGG - Intronic
1105292726 13:19062816-19062838 TGTGGTCCACCGGGAAAGCAGGG + Intergenic
1108033343 13:46260165-46260187 TGTCATCCATAGTGAAAGCCTGG + Intronic
1110721858 13:78770639-78770661 TGTGGTCCATATGGGAAGAGCGG - Intergenic
1111528492 13:89505839-89505861 ATGGGTCTATATGGAAAGCCTGG + Intergenic
1112079586 13:95954678-95954700 TTTGGTACATCTGGAAAGGCAGG - Intronic
1112345904 13:98589297-98589319 TGTGGTCCCAATCAAAAGCCTGG - Intergenic
1113882226 13:113633682-113633704 TGTGTTCCAGAAGGAGAGCCGGG - Intronic
1113886296 13:113660321-113660343 TGGAGACCATATGGAAAGCCAGG + Intergenic
1117105456 14:52393807-52393829 TGTGGTTCTTAAGGAAAGGCTGG - Intergenic
1123987067 15:25655300-25655322 CGTGGGCCCTATGGAGAGCCAGG + Intergenic
1125295320 15:38196715-38196737 TGAAGTCCATTTGGAAAGACAGG + Intergenic
1126424844 15:48516239-48516261 TGAGGTCCAGGAGGAAAGCCAGG + Exonic
1131969896 15:97881502-97881524 TGCGGAGCATATGGAAAGCCTGG - Intergenic
1134875849 16:17697888-17697910 TGTGGGGCATCTGGAAAGCATGG + Intergenic
1135887488 16:26324310-26324332 TGTGGACCAGATTGAGAGCCTGG + Intergenic
1136661376 16:31766044-31766066 TGTTTTCTATGTGGAAAGCCAGG - Intronic
1138508703 16:57494693-57494715 TGTAGACCACATGGGAAGCCTGG - Intergenic
1140041321 16:71410147-71410169 TGTGGGCCAGATGGAAAGCCAGG - Intergenic
1141218581 16:82047792-82047814 CATGGTCCATCTGGAAATCCAGG - Intronic
1141506979 16:84484190-84484212 TGTTCTCCATAGGGAAAGCCAGG + Intronic
1142172388 16:88629735-88629757 TGGGGCCCAGATGGAAAGACAGG + Intronic
1147233024 17:39033045-39033067 AGTGCTACATATAGAAAGCCAGG - Intergenic
1149598020 17:57875420-57875442 TGTGGTCCTGAAGGAAGGCCAGG + Intronic
1149695243 17:58611414-58611436 TGAGGATCATATGGAAAGACTGG - Intronic
1150784046 17:68148628-68148650 AGTGCTACATATAGAAAGCCAGG + Intergenic
1155687804 18:28577042-28577064 TTTGGTCCATATGGAGAGTGTGG - Intergenic
1155891348 18:31273983-31274005 TGTGTTCCATATTCAAAGTCTGG - Intergenic
1158686448 18:59619269-59619291 TGTTTTCCAAATTGAAAGCCAGG + Intronic
1163168374 19:15513125-15513147 TGTGGTCCATATGGAAAGCCTGG - Intronic
1163169432 19:15520537-15520559 TGTGGTCCGTATGGAAAGCCTGG - Intronic
926536310 2:14117322-14117344 TGAGGTCAAGATGGAAATCCAGG - Intergenic
926802517 2:16671541-16671563 TGTGGTCCAGATGTAAATCTGGG + Intergenic
928712246 2:34020204-34020226 TGTTTTCCACCTGGAAAGCCAGG - Intergenic
933630524 2:84651262-84651284 TGTAGACCATATGGGAAGCCTGG - Intronic
934036017 2:88088919-88088941 TGTGTTCCATCTGGTAGGCCAGG + Intronic
939306563 2:140418988-140419010 TTTAGTCCATAGGCAAAGCCAGG - Intronic
940438218 2:153680713-153680735 TGTGGGCCATATGGACAGAGAGG - Intergenic
942328262 2:174794016-174794038 GGTGGTCCTAATGGACAGCCAGG + Intergenic
945040468 2:205739749-205739771 TCTGGGCCATCTGGAAAGCCAGG + Intronic
946151414 2:217774634-217774656 TCTGGTTCAAATAGAAAGCCTGG - Intergenic
946380962 2:219348678-219348700 TGTGGACCATATAAGAAGCCTGG + Intergenic
948629412 2:239292433-239292455 TGTGCTCCAGATGGACAGCGGGG - Intronic
1171342730 20:24443472-24443494 TGGGGTGCATTTGGAAATCCTGG - Intergenic
1172004531 20:31809740-31809762 TGAAGTCCACATGGAAACCCAGG - Intergenic
1173020047 20:39259577-39259599 TTTGGGCCATATGCCAAGCCTGG + Intergenic
1173446596 20:43124478-43124500 TGGGGTCCAAATGCACAGCCAGG - Intronic
1174238477 20:49113634-49113656 TGTGGTCCGTATGGAAAGCCTGG - Exonic
1177808435 21:25899190-25899212 TGTGGTCTTTGTGGAAAGCTGGG - Intronic
1179610864 21:42548920-42548942 TGTGATTCATATGGAAAGAAGGG + Intronic
1182526494 22:30923551-30923573 AGAAGCCCATATGGAAAGCCAGG - Intergenic
1185127517 22:49019802-49019824 TGTGGTTCAGGAGGAAAGCCCGG + Intergenic
950586959 3:13899617-13899639 TGTGGACAATATTGAATGCCAGG + Intergenic
952157683 3:30660946-30660968 TGTGGTTCACCTGGAAAGCCAGG + Intronic
953556786 3:43952358-43952380 GCTGGGCCAGATGGAAAGCCCGG + Intergenic
953661840 3:44896813-44896835 TATGGTAGGTATGGAAAGCCTGG + Exonic
954449515 3:50564075-50564097 TGGGGCCCATATGGCAACCCTGG + Intronic
955719242 3:61864274-61864296 TGGGGTACATATAGAAATCCTGG - Intronic
959620636 3:108395367-108395389 TTTTGTCCTTATGGAAAGCCAGG + Intronic
960345288 3:116522756-116522778 TGTAGGCCATATGGAAAGCATGG - Intronic
960851509 3:122059619-122059641 TGTGTTCAACATGGAAAGCTTGG - Intronic
961604231 3:128082037-128082059 GGTGGTGGATATGGAGAGCCAGG - Intronic
962365209 3:134774484-134774506 TCTTGTCCACATGGGAAGCCTGG + Intronic
962937745 3:140096695-140096717 TGTGGCCCATATGGGAAGCCTGG + Intronic
965837981 3:172871914-172871936 TGTGGTCAAGAGGGAAAGCCTGG + Intergenic
966004367 3:174990568-174990590 AGTTGTATATATGGAAAGCCGGG + Intronic
969393894 4:6908762-6908784 TGGGTTCCATGAGGAAAGCCGGG - Intergenic
972803323 4:42500658-42500680 TGTCGTCCAAAAGCAAAGCCAGG - Intronic
975719265 4:77234348-77234370 TGTGGTCAAAATGGAAGCCCAGG + Intronic
975841635 4:78480479-78480501 TGTGGTCCAGAGGGAGGGCCTGG + Intronic
982183092 4:152766654-152766676 TCAGGTCCAAATGGGAAGCCAGG + Intronic
982602740 4:157471829-157471851 TGTTTTCCTTATGGAAACCCAGG + Intergenic
985238473 4:187902745-187902767 TGTGGCCCATATGAAAAGGGTGG + Intergenic
987841964 5:23233716-23233738 TCTGATCCATCTAGAAAGCCAGG + Intergenic
990167624 5:53012089-53012111 TGTGGTGCAGAATGAAAGCCAGG - Intronic
992349599 5:75915674-75915696 TGTGGTCCACTTGGAGAGACAGG + Intergenic
992673117 5:79079439-79079461 TGAGGACAATATGGAAAGCAAGG + Exonic
992987196 5:82243756-82243778 TGTTGTCCATATGTATATCCTGG - Intronic
993106728 5:83608472-83608494 TGTGGTCCATCTTTATAGCCAGG + Intergenic
996732423 5:126728667-126728689 TGTGCTCCCACTGGAAAGCCAGG - Intergenic
1003501728 6:6708687-6708709 TGGGGTCCTTAGAGAAAGCCTGG + Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1008704493 6:54141763-54141785 GGTGGTCCATATGGAAATTAGGG + Intronic
1015824349 6:137295836-137295858 TGTGGTACATATGGACTGTCAGG + Intergenic
1017617408 6:156260005-156260027 TGTGGTCCATCTAGGAAGCTGGG - Intergenic
1017779267 6:157703729-157703751 TGTTGTGCATATTGACAGCCAGG - Intronic
1019005579 6:168793887-168793909 ATTGGTCCACATGGACAGCCAGG + Intergenic
1019083763 6:169455111-169455133 TGAGGTGCAGCTGGAAAGCCTGG + Intergenic
1019149604 6:169995863-169995885 TCTGTTGCATATGGACAGCCAGG - Intergenic
1020835461 7:13144709-13144731 TGAGGTCCATAGGGAAACCCTGG + Intergenic
1021989247 7:26126131-26126153 TGTGGGCCTTTTGGAGAGCCTGG + Intergenic
1023226400 7:37973988-37974010 TGTGGTCACCATGGAAAGACAGG + Intronic
1026535225 7:71233549-71233571 TGTTGGCCATATGGGAAGCCAGG + Intronic
1026885283 7:73938241-73938263 TGTGGGCCAGAGGGAAAGCAGGG - Intergenic
1030982105 7:116198303-116198325 TATTTTCCATATGGAAATCCTGG - Intergenic
1032274867 7:130445469-130445491 TGTGGGCCACATGGAACTCCTGG + Intergenic
1034226600 7:149489690-149489712 TGCGGGTCAGATGGAAAGCCAGG + Intronic
1034241657 7:149615942-149615964 TGCGGGTCAGATGGAAAGCCAGG + Intergenic
1034596269 7:152196436-152196458 TGTGCTCCATATGGAATTTCTGG - Intronic
1041507812 8:58620757-58620779 TGTGGACCATATGAAGAGGCTGG + Intronic
1044066565 8:87706250-87706272 TAGAGACCATATGGAAAGCCTGG - Intergenic
1046321307 8:112580480-112580502 TGGGCTCCAGATAGAAAGCCAGG - Intronic
1052407735 9:28083523-28083545 TGTGGCACAGAGGGAAAGCCAGG + Intronic
1053901089 9:42796144-42796166 TGTGGTGCATATAGGAAGTCTGG - Intergenic
1055410785 9:76027204-76027226 GGTGGTCCATATAGAAAGAATGG + Intronic
1055768499 9:79691138-79691160 TGTGGTCCAGAGGGAAATGCTGG - Intronic
1056856206 9:90131772-90131794 TGTGGACCATGTGGAATTCCAGG - Intergenic
1057471755 9:95363372-95363394 TGTGTTCCATTTGGAATGCAGGG - Intergenic
1059331614 9:113539122-113539144 TGTGGACCAGCTGGAAAGCCAGG - Intronic
1059654778 9:116347670-116347692 TGGGGACCATATTGAAACCCAGG + Intronic
1060538718 9:124414832-124414854 GGTGGTCTATAAGGTAAGCCGGG - Exonic
1061934521 9:133850012-133850034 TGGGATCTAGATGGAAAGCCAGG + Intronic
1191729496 X:64318129-64318151 TGGAGACCATATGGAAAGTCTGG - Intronic
1195355723 X:104038217-104038239 TGGGATCCATCTGGAAAGACTGG - Intergenic
1197829859 X:130630083-130630105 TGGGGTCAAGATGGGAAGCCAGG + Intronic
1197884375 X:131203106-131203128 GGTGATGCATGTGGAAAGCCTGG + Intergenic
1200841246 Y:7783709-7783731 TGTGGACCTTATGGAAACCAGGG + Intergenic