ID: 1163168532

View in Genome Browser
Species Human (GRCh38)
Location 19:15514554-15514576
Sequence CCTCAGCCTCCCGAGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 901262
Summary {0: 99957, 1: 284367, 2: 226920, 3: 125442, 4: 164576}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163168532_1163168540 16 Left 1163168532 19:15514554-15514576 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1163168532_1163168537 2 Left 1163168532 19:15514554-15514576 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1163168537 19:15514579-15514601 GACAATTGCTTGAACCTGGGAGG 0: 202
1: 21801
2: 65665
3: 137024
4: 182849
1163168532_1163168536 -1 Left 1163168532 19:15514554-15514576 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1163168536 19:15514576-15514598 GCAGACAATTGCTTGAACCTGGG 0: 4
1: 847
2: 2528
3: 4599
4: 33940
1163168532_1163168535 -2 Left 1163168532 19:15514554-15514576 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1163168535 19:15514575-15514597 GGCAGACAATTGCTTGAACCTGG 0: 11
1: 1601
2: 1920
3: 4368
4: 47307
1163168532_1163168538 15 Left 1163168532 19:15514554-15514576 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1163168538 19:15514592-15514614 ACCTGGGAGGCAGAAGTTGCAGG 0: 19
1: 284
2: 892
3: 1798
4: 5190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163168532 Original CRISPR CCTCAGCCTCCCGAGTAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr