ID: 1163168540 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:15514593-15514615 |
| Sequence | CCTGGGAGGCAGAAGTTGCA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4891 | |||
| Summary | {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1163168534_1163168540 | 15 | Left | 1163168534 | 19:15514555-15514577 | CCAGCTACTCGGGAGGCTGAGGC | 0: 94911 1: 257638 2: 218586 3: 135882 4: 139272 |
||
| Right | 1163168540 | 19:15514593-15514615 | CCTGGGAGGCAGAAGTTGCAGGG | 0: 18 1: 262 2: 800 3: 1509 4: 2302 |
||||
| 1163168532_1163168540 | 16 | Left | 1163168532 | 19:15514554-15514576 | CCCAGCTACTCGGGAGGCTGAGG | 0: 99957 1: 284367 2: 226920 3: 125442 4: 164576 |
||
| Right | 1163168540 | 19:15514593-15514615 | CCTGGGAGGCAGAAGTTGCAGGG | 0: 18 1: 262 2: 800 3: 1509 4: 2302 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1163168540 | Original CRISPR | CCTGGGAGGCAGAAGTTGCA GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||