ID: 1163168540

View in Genome Browser
Species Human (GRCh38)
Location 19:15514593-15514615
Sequence CCTGGGAGGCAGAAGTTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4891
Summary {0: 18, 1: 262, 2: 800, 3: 1509, 4: 2302}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163168534_1163168540 15 Left 1163168534 19:15514555-15514577 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302
1163168532_1163168540 16 Left 1163168532 19:15514554-15514576 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1163168540 19:15514593-15514615 CCTGGGAGGCAGAAGTTGCAGGG 0: 18
1: 262
2: 800
3: 1509
4: 2302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163168540 Original CRISPR CCTGGGAGGCAGAAGTTGCA GGG Intronic
Too many off-targets to display for this crispr