ID: 1163168607

View in Genome Browser
Species Human (GRCh38)
Location 19:15515089-15515111
Sequence CAGCTGCCTTTGGGGAAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 499
Summary {0: 1, 1: 1, 2: 6, 3: 59, 4: 432}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163168607_1163168614 -10 Left 1163168607 19:15515089-15515111 CCCTTCTTCCCCAAAGGCAGCTG 0: 1
1: 1
2: 6
3: 59
4: 432
Right 1163168614 19:15515102-15515124 AAGGCAGCTGGTATTGCGTAGGG 0: 1
1: 0
2: 1
3: 9
4: 68
1163168607_1163168615 -1 Left 1163168607 19:15515089-15515111 CCCTTCTTCCCCAAAGGCAGCTG 0: 1
1: 1
2: 6
3: 59
4: 432
Right 1163168615 19:15515111-15515133 GGTATTGCGTAGGGACAGCCAGG 0: 1
1: 0
2: 1
3: 2
4: 67
1163168607_1163168616 10 Left 1163168607 19:15515089-15515111 CCCTTCTTCCCCAAAGGCAGCTG 0: 1
1: 1
2: 6
3: 59
4: 432
Right 1163168616 19:15515122-15515144 GGGACAGCCAGGTCACCGAGTGG 0: 1
1: 1
2: 0
3: 15
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163168607 Original CRISPR CAGCTGCCTTTGGGGAAGAA GGG (reversed) Intronic
900359684 1:2282627-2282649 CAGCGGGCTTGGGGGAAGCAAGG - Intronic
900810407 1:4797546-4797568 CAGCTGCCTTTGGTGATGGCAGG - Intergenic
900888497 1:5432272-5432294 CAGCTGCCTGTGGTCAAGCAGGG - Intergenic
902225683 1:14995093-14995115 CAGCTGCCCTGGAGGAAGAGGGG + Intronic
902244901 1:15114468-15114490 CAGCTGCCCCTGGGGAAGATAGG + Exonic
902300046 1:15495207-15495229 CAGCTGCCTCTAGGGCAGACGGG + Intronic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
904787013 1:32990822-32990844 CATCTGCCTTGGAGGAAGAAGGG - Intergenic
904839941 1:33365944-33365966 CAGCTGCCTGTCAGGCAGAATGG - Intronic
905860473 1:41347475-41347497 CAGCTGCTGTTGGTGAAGACAGG + Intergenic
906245217 1:44268614-44268636 CACCTGCCTTGGAGGAAGAGTGG - Intronic
909100804 1:71345637-71345659 CAGAAGCCTTTAGGGCAGAATGG - Intergenic
909345430 1:74579779-74579801 CAGGAGCCTTAGGGGATGAAGGG - Intronic
909951306 1:81723206-81723228 CAGCTGCATTTGGGGGAGAAGGG - Intronic
909951320 1:81723300-81723322 CAGTTGCATTTGGGGGAGAGAGG - Intronic
910030524 1:82716284-82716306 CAGTTGGCTTTGGGGAAAAGGGG - Intergenic
910664336 1:89708163-89708185 CAGCTGCCTTTGGAGGAAAAAGG - Intronic
911244632 1:95503428-95503450 CTGCTGTATTTGGGGAATAAAGG + Intergenic
911822673 1:102440526-102440548 TAGCTTCCTCTGTGGAAGAAGGG - Intergenic
913408046 1:118517693-118517715 CAGCTTCCTTTGGCTAGGAAAGG + Intergenic
914049620 1:144120573-144120595 TAGGTCCCTTTGGGGAAGACTGG + Intergenic
914129562 1:144844878-144844900 TAGGTCCCTTTGGGGAAGACTGG - Intergenic
915458878 1:156057904-156057926 GAGAAGCCTTTGGGGAAGGAGGG + Intronic
916663782 1:166947539-166947561 CAGCTGGCTTTGGAGAAAAATGG + Intronic
916715351 1:167442784-167442806 CAGCTGCCTGGGGGCAAGAGGGG - Intronic
917266603 1:173227677-173227699 CAGCTTCCCTTGGGTAGGAAAGG - Intergenic
917764511 1:178201976-178201998 GAGGTCCCTTTGGGGAAGCAGGG - Intronic
920709170 1:208278648-208278670 CAGATGCCTTCTGGGAGGAAAGG + Intergenic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
920969398 1:210730283-210730305 CACCTGCCTTTTAGAAAGAAGGG - Intronic
920986732 1:210897699-210897721 CACCTGCCTTTGGGGAATGTAGG + Intronic
921050287 1:211506225-211506247 CAGGTGCCTTTGGGGACTGAGGG - Intergenic
922688092 1:227663753-227663775 CAGACTCCTTTGGGAAAGAATGG + Intronic
923051066 1:230391926-230391948 GGGCTCCCTTTGGGGGAGAAGGG - Intronic
923773126 1:236955173-236955195 CATCTGCCTGTGGGGAAAAGTGG + Intergenic
923977433 1:239279338-239279360 CAGGGGCCTTCGGGGGAGAATGG - Intergenic
924517611 1:244779746-244779768 CAGGTGCCATTGGGGCATAAAGG - Intergenic
1063234656 10:4100682-4100704 CAGCTGTCATTGGAGAAGATAGG + Intergenic
1063455526 10:6179804-6179826 CAGCAGCCTTTGGGGAAGGTGGG - Intronic
1065154123 10:22852318-22852340 CTGCTGAGTTTGAGGAAGAAGGG + Intergenic
1066539488 10:36429903-36429925 CAGCTGCCGTAGGAAAAGAAAGG - Intergenic
1067127637 10:43533387-43533409 CAGCTTCCTTTGGCTAGGAAAGG + Intergenic
1067182027 10:43995398-43995420 CACCTGCCATTGGGGGAGTAGGG + Intergenic
1067239756 10:44480523-44480545 CAGCTTCCTTTGGCTAGGAAAGG - Intergenic
1068523724 10:58105252-58105274 CACCAGCCTTTGAGGAAAAATGG - Intergenic
1068741161 10:60472975-60472997 GAGCTGCCTGTGGGGAAGGACGG - Intronic
1068914200 10:62410520-62410542 CAGGTGCCTATGGGGAGGGAGGG - Intronic
1069215710 10:65816543-65816565 CAGCTTCCTCTGTGGAAGAGTGG - Intergenic
1069515177 10:69071745-69071767 CCTCTGGCTTTGGAGAAGAATGG - Intergenic
1069770217 10:70893761-70893783 CAGCTGCCTCTGGGGCAGAGTGG + Intergenic
1070278609 10:75031745-75031767 CAGATTTCTTTGGGGAAAAAAGG + Exonic
1070773104 10:79094104-79094126 CAGCTGCCCTTTGGACAGAAAGG + Intronic
1071213436 10:83370930-83370952 CAGATGCCTTGGGCGAAGACAGG - Intergenic
1071427211 10:85571240-85571262 CAGCTGGCTTTGAGGAAAAGAGG + Intergenic
1073070117 10:100787934-100787956 CAGCTATCTTTGGGGAGGGAGGG + Intronic
1075659743 10:124185035-124185057 CACCTGCCTTAGGTGAAAAATGG + Intergenic
1075762727 10:124869225-124869247 GAGCTGCCGCGGGGGAAGAAAGG - Intergenic
1076270169 10:129145372-129145394 CAGGTGCCTGTGGGCAAGATGGG + Intergenic
1076640675 10:131914691-131914713 CAGCAGCTTTTGCAGAAGAACGG + Intronic
1078454902 11:11467376-11467398 CATCTGGCTCTGGGTAAGAAAGG - Intronic
1078861206 11:15248983-15249005 CAGCTGCAGTTGTGGCAGAAGGG + Intergenic
1079189134 11:18263225-18263247 CAGCTGCATTTGGGGGAGAGGGG - Intergenic
1079323801 11:19474535-19474557 CAGCTGCCTTTGGAGAGGACAGG + Intronic
1079701660 11:23556016-23556038 CCCCTGCCTTTGGTGAAGAAAGG - Intergenic
1080080711 11:28215297-28215319 AAGCTGGCTTTGGAGAAAAAAGG + Intronic
1080730497 11:34946834-34946856 CAGTTTCCTTTGGGGATTAAAGG - Intronic
1081377474 11:42377046-42377068 CAGCTTCCTTTGGCTAGGAAAGG - Intergenic
1081571558 11:44294497-44294519 CAGCAGCCTATGGGGAGGAGGGG + Intronic
1081688255 11:45057643-45057665 CAGCTGACACTGAGGAAGAAGGG - Intergenic
1082100396 11:48168468-48168490 CAGTGGACTTTGGGGAAGGAGGG - Intronic
1083256453 11:61498983-61499005 CAGCTGCCTTGGGAGGAGAGTGG + Intergenic
1083538608 11:63494812-63494834 CATCTGTATTTTGGGAAGAAAGG - Intergenic
1083660644 11:64250491-64250513 CAGCTGGCTCTGGGGGAGGAGGG - Intergenic
1084170511 11:67398702-67398724 CAGGTGAGTGTGGGGAAGAAAGG - Exonic
1084171047 11:67401303-67401325 CAGCTGCCTGTGGGCAAGGAGGG - Intronic
1085829924 11:79888737-79888759 CAGTATCCTTTGGTGAAGAAAGG - Intergenic
1087156967 11:94914275-94914297 CAGCTGCATTTGGGGGAGAGGGG - Intergenic
1087484831 11:98748093-98748115 CAGCTTCCCTTGGCTAAGAAAGG - Intergenic
1088046057 11:105452973-105452995 CAGGTGTATTTAGGGAAGAATGG - Intergenic
1088197694 11:107293932-107293954 CAGCTTCCATTGGGTAGGAAAGG - Intergenic
1089519590 11:119055054-119055076 CAGCTGCCTGAGGGGAAGGAAGG + Exonic
1089568366 11:119385169-119385191 CAGCTGACTGTGAGGATGAAGGG + Intergenic
1090405653 11:126474570-126474592 AGGCTGCCTCTGGGGATGAAGGG - Intronic
1091636694 12:2202626-2202648 GAGCTGCCTTCGAGGAGGAAGGG - Intronic
1092255674 12:6925783-6925805 CACCTGCCTTCAGGGAAGGAAGG - Intronic
1093030358 12:14282977-14282999 CAGTTCCCTTTGGGAAAAAAGGG - Intergenic
1093036105 12:14333924-14333946 GAGGTGACCTTGGGGAAGAATGG - Intergenic
1093199103 12:16165625-16165647 TAGCTGCATTTGAGGAAGAGTGG - Intergenic
1093540507 12:20277808-20277830 CACTTGCCTTTGGGGATAAAGGG - Intergenic
1094141683 12:27188247-27188269 CAGCTGCATTTGGGGAGGTGGGG - Intergenic
1094754824 12:33455607-33455629 CAGCTGCATTTGGGGTTGAGGGG - Intergenic
1096836063 12:54352105-54352127 CAGCTGGCTTTGGGGGTGATGGG - Intergenic
1097157286 12:57022251-57022273 TAGCTGGCCTTGGGGGAGAATGG - Intronic
1097297539 12:57983635-57983657 CAGCTGCATTCGGGGGAGAGGGG + Intergenic
1098068849 12:66650059-66650081 CAGCTGCCGTTGGGCACGACAGG - Intronic
1098749647 12:74278080-74278102 CAGGTCTCCTTGGGGAAGAATGG - Intergenic
1099379869 12:81940231-81940253 CAGCTCTCTTTGGGGAAGGGTGG + Intergenic
1099799748 12:87442443-87442465 CAGCTGGCTTTGGGGAAAAGGGG + Intergenic
1100440805 12:94615404-94615426 CAGCCCACGTTGGGGAAGAAGGG - Intronic
1100882579 12:99035197-99035219 TGGCTGGCTTTGGGGAAGAAGGG - Intronic
1101104423 12:101425873-101425895 TGGCTGGCTTTGGGGAAAAAGGG + Intergenic
1101578190 12:106017141-106017163 CAGCTGCATTTGGGGGAGAGGGG - Intergenic
1101914379 12:108884982-108885004 CAGCAGCCTGTGGGAAGGAAGGG - Exonic
1102183741 12:110932108-110932130 CTGGGGACTTTGGGGAAGAAGGG + Intergenic
1102615494 12:114150552-114150574 CAGATGCCTTTGGGGAGAATGGG - Intergenic
1103043473 12:117715395-117715417 CAGCTGCCTGTGAACAAGAAAGG + Intronic
1103175494 12:118859853-118859875 CAGTTGCCTCTGATGAAGAATGG + Intergenic
1103518350 12:121521696-121521718 CAGCAGCCTGTGGGGCAGAGTGG - Intronic
1105171222 13:17593996-17594018 CTGATGCCTTTGGTGAAAAAGGG + Intergenic
1105473424 13:20711738-20711760 CAGATGACATTGGGGAAGAGGGG + Intronic
1105847140 13:24302941-24302963 CAGCTGCCTTTGTGGAAGGGAGG + Exonic
1105892195 13:24689771-24689793 CAGGGGTTTTTGGGGAAGAAGGG - Intronic
1106131135 13:26940449-26940471 CATCTGGGTTTGGGGTAGAAAGG + Intergenic
1106286656 13:28323848-28323870 CAGGTTTCTTTGGGGAAGGAGGG + Intronic
1106387598 13:29302724-29302746 CTGCTGACTTTGGAGAAGACAGG + Intronic
1107155183 13:37157869-37157891 CATGTGTCTTTTGGGAAGAATGG + Intergenic
1108069169 13:46609876-46609898 CAGCTGCCTACGGGCAGGAAGGG + Intronic
1108255274 13:48603635-48603657 CAGGTCCCTTTGGGGATGACTGG + Intergenic
1108413445 13:50173321-50173343 CAGCTGCATTTGGGGGAGAGGGG - Intronic
1108530374 13:51322469-51322491 CAGCTGCCTCTGGGGTATAATGG - Intergenic
1111945601 13:94661807-94661829 CAGCTGCTTTGGGCAAAGAAGGG + Intergenic
1111966992 13:94871005-94871027 CAGCTTCCTTTGGCTAGGAAAGG - Intergenic
1112177742 13:97044249-97044271 AGGCTACCTTTGGGGAAGGAAGG - Intergenic
1112299397 13:98216509-98216531 CAGTTTCCTTTGGGGATGACTGG + Intronic
1112669522 13:101618558-101618580 CAGATGACCTTTGGGAAGAATGG + Intronic
1113113849 13:106853891-106853913 CACCTGCCTTTGGTGAAAAGAGG + Intergenic
1113751251 13:112777883-112777905 CATCTGGCGTTGGGGGAGAAAGG - Intronic
1114513875 14:23285443-23285465 CAGTGGCCTTTGGGAATGAAAGG - Intronic
1115364442 14:32541474-32541496 CACCTGCCTTTGGACAAGCAGGG - Intronic
1115507475 14:34106190-34106212 CATCTGCCTTTGTTGAAAAAGGG - Intronic
1116698930 14:48213114-48213136 CAGCTAGCTGTGTGGAAGAAAGG - Intergenic
1117101021 14:52347803-52347825 CAGCTGTCTCTGGGGACGGAGGG + Intergenic
1117797059 14:59405647-59405669 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
1119168440 14:72514805-72514827 CCGCTGCCCTTGGGGAGGAGCGG + Intronic
1119801528 14:77449492-77449514 ATGCTGTCTTTGGGGAAGAACGG - Intronic
1119861603 14:77940190-77940212 GACCTACCTTTTGGGAAGAAGGG - Intergenic
1119946744 14:78703316-78703338 CAGCTGCCTGAGGGAGAGAAGGG + Intronic
1121189548 14:92013928-92013950 CAACTGACTTTGAAGAAGAAAGG + Intronic
1121638940 14:95472593-95472615 CTGCTGCCTTTCAGGAAGGAGGG - Intronic
1121841558 14:97138602-97138624 CAGTTGGCTTTGGCGGAGAAGGG + Intergenic
1122065182 14:99168114-99168136 CAGCGGCCTTGGGAGAACAATGG + Intergenic
1122191719 14:100050160-100050182 TGGTTGTCTTTGGGGAAGAAAGG + Intronic
1122319483 14:100845251-100845273 CAGCTGCCTATGGAGCGGAAGGG - Intergenic
1122693699 14:103542955-103542977 CGGCTGCCTTTGGGAAGAAAGGG - Intergenic
1123419490 15:20119795-20119817 TAGGTCCCTTTGGGGAAGACTGG + Intergenic
1123446373 15:20333717-20333739 TAGGTCCCTTTGGGGAAGACTGG - Intergenic
1123528713 15:21126333-21126355 TAGGTCCCTTTGGGGAAGACTGG + Intergenic
1124233500 15:27967163-27967185 CTGCTGCCTGTGCGGAGGAAAGG - Intronic
1125042972 15:35213664-35213686 GAGATGGCTTTGGGGAAGCAAGG - Intergenic
1128166305 15:65468574-65468596 CAGCTTCCTGGGGGGAAAAAAGG - Intronic
1128752995 15:70162297-70162319 CAGATGCCTTTGGGGAGGGTGGG + Intergenic
1129514521 15:76148861-76148883 CTGCTGCCTTGCGGGAAGAGAGG - Intronic
1129994000 15:79989293-79989315 CAGAAGCCTTTGGGCATGAAGGG - Intergenic
1130006015 15:80099090-80099112 CAACTGCATTTAGGGAACAAGGG - Intronic
1130630839 15:85567546-85567568 CATGTGCTTTTGGGGAAGAGGGG + Intronic
1130959481 15:88650243-88650265 CAGCTGCCGTTGGAGAGGATGGG - Intronic
1131225163 15:90618554-90618576 CAGCTTCCCTCTGGGAAGAAAGG - Intronic
1131290601 15:91103644-91103666 CAGCTGTCCTTGGTGCAGAAGGG + Intronic
1132978878 16:2724799-2724821 CAGCTGCAGTGGGGGAAGCATGG + Intergenic
1134230789 16:12427831-12427853 CAGCTGACTTGGTGGGAGAAAGG + Intronic
1134369893 16:13613489-13613511 CATCTTCCTTTGGGAAATAAGGG - Intergenic
1135061867 16:19277894-19277916 TAGGTCCCTTTGGGGAAGGATGG + Intergenic
1137588491 16:49679235-49679257 CAGCTGCAGTTGGGGAGGCATGG + Intronic
1137653065 16:50136784-50136806 TAGGTCCCTTTGGGGAAGACTGG + Intergenic
1137681553 16:50350887-50350909 CAGAAGCTCTTGGGGAAGAAGGG + Intronic
1138323772 16:56143097-56143119 CAGCAGGCTTTGTGAAAGAATGG + Intergenic
1138553457 16:57759350-57759372 CAGCTGCCCCGGGGGTAGAAAGG - Intronic
1138877517 16:60970725-60970747 CAGTTGCCTATGAGGAAGCAGGG + Intergenic
1139752322 16:69116701-69116723 CTGCTGCTTTTGGGGAATGAGGG + Exonic
1139990040 16:70933163-70933185 CAGCTGGGGATGGGGAAGAAAGG + Intronic
1140410427 16:74737724-74737746 CACCTGCCCCTGGGGCAGAAGGG - Intronic
1140876522 16:79157873-79157895 CAGCAGGCTCTGGGGAAGAGGGG + Intronic
1203137594 16_KI270728v1_random:1738929-1738951 TAGGTCCCTTTGGGGAAGACTGG - Intergenic
1143333769 17:6157740-6157762 GAACTGCCTCTGGGGAAGAGTGG + Intergenic
1144622992 17:16830278-16830300 CAGATGCGTGTGGGGAGGAAAGG + Intergenic
1144883438 17:18442438-18442460 CAGATGCGTGTGGGGAGGAAAGG - Intergenic
1145148792 17:20501948-20501970 CAGATGCGTGTGGGGAGGAAAGG + Intergenic
1146075263 17:29722810-29722832 CATCTGCCTTTGTGCAAGACTGG + Intronic
1146687719 17:34852694-34852716 CACCTGCCTGAGGGTAAGAAAGG + Intergenic
1146821053 17:35983996-35984018 AAGCTGCCTCTGTGGAAGAAAGG - Intronic
1148234744 17:45961307-45961329 CTGGGGCTTTTGGGGAAGAAGGG + Intronic
1148460804 17:47838108-47838130 CAACTGCCTTTGGGGAATGTCGG - Intronic
1149225546 17:54465807-54465829 CAGCTTCCTTTGCCTAAGAAAGG + Intergenic
1149447800 17:56727259-56727281 CAGCTCCTTTTGTGGATGAAAGG + Intergenic
1151940093 17:77286827-77286849 CAGCTGGCTTTAGGGTAGGAGGG + Intronic
1153939172 18:9962417-9962439 ATGCTGCCTTTAGGGAAAAAAGG + Intergenic
1156005690 18:32438425-32438447 CAGCTGCCTCTAGGGCAGAAGGG - Intronic
1156381437 18:36565056-36565078 CAGTTGCCCTTGGGGAAAACTGG + Intronic
1157145366 18:45157236-45157258 CAGCTTCATTTTGAGAAGAAGGG - Intergenic
1157149057 18:45196583-45196605 CAGCTGCCTTTGTAGGAGAGTGG + Intergenic
1157859650 18:51129375-51129397 CAGTTGCCCTTGGGGAAGGGTGG + Intergenic
1159276971 18:66234069-66234091 GAGGTTCCTTTGGGGAAGGATGG - Intergenic
1160138988 18:76302434-76302456 CTGGTGCCTTTTGTGAAGAAGGG - Intergenic
1160288936 18:77572489-77572511 AAGGTCCCTTTGGGGAAGACTGG - Intergenic
1160854883 19:1212371-1212393 CAGCTACCTTGGGGGCAGGAGGG - Intronic
1162330016 19:10021996-10022018 CAGCTGTCTCTGGGAAAGCAAGG + Exonic
1163168607 19:15515089-15515111 CAGCTGCCTTTGGGGAAGAAGGG - Intronic
1164757598 19:30702068-30702090 CAGCTGGCTTTGTGGAAGAGAGG - Intronic
1164990269 19:32677570-32677592 TAGCTGCTCTTGGGGACGAATGG - Exonic
1165725907 19:38112764-38112786 GAGCTGCCTGTGGGGAAAGAGGG - Intronic
1166258409 19:41621388-41621410 CAGCTGCCTGGAGGGAGGAAGGG - Intronic
1167115705 19:47488023-47488045 CAGCTGGTTTTGGGGGTGAAGGG + Exonic
1168562742 19:57397221-57397243 GAGCTGCCTTTGGGTAAAAAGGG - Intronic
1202689010 1_KI270712v1_random:73136-73158 TAGGTCCCTTTGGGGAAGACTGG + Intergenic
926354209 2:12024773-12024795 CAGCTGCATTTGGGGGAGAGGGG - Intergenic
926680510 2:15659997-15660019 CAGTTTCCTCTGGGTAAGAAAGG - Intergenic
927560016 2:24063733-24063755 CAGGTGCCCTTGGGAAAGAGTGG + Intergenic
927649552 2:24903784-24903806 GAGTTGCATTTAGGGAAGAAAGG - Intronic
928206719 2:29289855-29289877 CAGGTGCCTGTTGGGAAGCAAGG + Intronic
929282955 2:40102617-40102639 CAGCTGTCTGTGAGGAAGAAAGG + Intronic
929875194 2:45791068-45791090 CAGCTCACTTTGGTGAAGAAGGG + Intronic
930380522 2:50622122-50622144 CACCTGCCTTTGGAGAGGATTGG - Intronic
930691677 2:54371537-54371559 CAGCTGCCTTTGGTGTGGAGTGG - Intronic
931101202 2:59003005-59003027 CAGCTGCTTTTGGGATACAATGG - Intergenic
932647618 2:73520883-73520905 CATCTTCATTTGGGGAAGAATGG - Intronic
933912091 2:86950326-86950348 CAGCTTTCTTTGGGGAGGAAAGG - Intronic
934010903 2:87819571-87819593 CAGCTTTCTTTGGGGAGGAAAGG + Intronic
935646845 2:105344276-105344298 CAGCTACCTTTGTGGGAGAGAGG + Intronic
935724520 2:106011370-106011392 CAGCTGCCTGTGGAGGATAAAGG + Intergenic
935774470 2:106460280-106460302 CAGCTTTCTTTGGGGAGGAAAGG + Intronic
935905599 2:107835632-107835654 CAGCTTTCTTTGGGGAGGAAAGG - Intronic
935935505 2:108178035-108178057 CAGCAGCATTTGAGGGAGAAAGG + Intergenic
935992079 2:108728154-108728176 CAGCTTTCTTTGGGGAGGAAAGG - Intronic
936127394 2:109800855-109800877 CAGCTTTCTTTGGGGAGGAAAGG - Intronic
936147629 2:109991450-109991472 TAGGTCCCTTTGGGGAAGACTGG + Intergenic
936197063 2:110379991-110380013 TAGGTCCCTTTGGGGAAGACTGG - Intergenic
936217303 2:110570630-110570652 CAGCTTTCTTTGGGGAGGAAAGG + Intronic
936426443 2:112425204-112425226 CAGCTTTCTTTGGGGAGGAAAGG + Intronic
937330722 2:121026589-121026611 CAGTTGCCTGTGGGGACGATGGG - Intergenic
937387702 2:121451696-121451718 CAGCTGGCTTTCTGTAAGAATGG - Intronic
937890264 2:126933305-126933327 CAGATGGCTTTGGGAAAGGACGG + Intergenic
938275359 2:130015758-130015780 CAGCTGCCAATGGGGTAAAAGGG - Intergenic
938308988 2:130273732-130273754 CTCCTGCCATTGGGGGAGAAAGG + Intergenic
939053952 2:137339699-137339721 CAGGTGGCTTTGGTGAGGAAGGG + Intronic
940720778 2:157279725-157279747 CAGCTTCCCTTGGCTAAGAAAGG + Intronic
940992560 2:160112490-160112512 CAGCTGCCTTGGGAATAGAATGG + Intronic
941026763 2:160464502-160464524 GAGGTGCCTCTGAGGAAGAAAGG + Intronic
942151816 2:173083263-173083285 GAGCAGCCTTGGAGGAAGAAAGG + Intronic
942252356 2:174058090-174058112 CTGCAGCCTTTTGGGAATAATGG + Intergenic
943432923 2:187826584-187826606 CAGCTGCATTTGAGGGAGAGGGG - Intergenic
943866536 2:192931068-192931090 CAGCTTCCTTTGGCTAGGAAAGG + Intergenic
944224156 2:197333327-197333349 CAATTGCCTTTGGGAAAGGAGGG + Intergenic
944642284 2:201739920-201739942 CAACTGACTTTGAGGAAGAAGGG + Intronic
945947325 2:216006853-216006875 CAGGTGCCAGTGGGAAAGAAGGG - Intronic
946105488 2:217365743-217365765 CAGCTGCCTTTGCAGGAGTAGGG - Intronic
946282249 2:218674331-218674353 TAGATACCTTTAGGGAAGAAGGG + Intronic
946341790 2:219074133-219074155 CAGCAACCTTTGGGGATGATGGG + Intergenic
946537677 2:220648843-220648865 GAGCTGCCCTTTGGGATGAAAGG - Intergenic
946885441 2:224217858-224217880 CAGCTGCCTTGGGATGAGAAAGG - Intergenic
948374834 2:237514538-237514560 TGGCTGGCCTTGGGGAAGAATGG + Intronic
1170255569 20:14339352-14339374 CAGCTGAATTTTGGGAGGAAAGG + Intronic
1170871128 20:20207566-20207588 AATCTGCCTTTAGGGAAGAAAGG + Intronic
1171207325 20:23291076-23291098 CAGCTGCCTCTGTGGAGGCAGGG - Intergenic
1171465427 20:25324586-25324608 CAGCTGTCTCTGGTGAAGACAGG + Intronic
1172015279 20:31869642-31869664 CAGCTGCCCTGGGGGTGGAAGGG - Intronic
1172135110 20:32681475-32681497 CAGCTGGCTCTGGGGAAGGAAGG - Intergenic
1173242129 20:41306453-41306475 CTGTAGGCTTTGGGGAAGAAAGG - Intronic
1174238569 20:49114618-49114640 CAGCTGCCTGTGGGGAAGAAGGG - Exonic
1174480250 20:50826214-50826236 AATCTGGCCTTGGGGAAGAAAGG + Intronic
1174716274 20:52762154-52762176 CAAATGGCTTTGGGGAAGAAAGG - Intergenic
1175963838 20:62650300-62650322 CAGCTGGGCTTGGGGAAGAAGGG - Intronic
1176879923 21:14179863-14179885 CAGCGGCTTTTAGGGAACAAGGG + Intronic
1176997962 21:15578806-15578828 GAGGACCCTTTGGGGAAGAATGG - Intergenic
1178466115 21:32849634-32849656 CAGCTGCTTTTCGAGAAGCAGGG + Intergenic
1179091257 21:38267845-38267867 CAGTTGACTTTGAGGAGGAAGGG - Intronic
1180552414 22:16551474-16551496 TAGGTCCCTTTGGGGAAGACTGG - Intergenic
1181351616 22:22262556-22262578 TAGGTCCCTTTGGGGAAGACTGG + Intergenic
1182840770 22:33387946-33387968 TGGCTGCCTTTGAGGAAGAGAGG - Intronic
1183041095 22:35178550-35178572 CAGCTCCCTATGAGGAAGACAGG - Intergenic
1183086267 22:35489212-35489234 CAGCAGCCCGTGGGGGAGAAGGG - Intergenic
1183364120 22:37398273-37398295 CAGGGGCCTTTGAGGAATAAAGG - Intronic
1183623172 22:38986612-38986634 CAGGTGCCTTAGAGGCAGAAGGG - Intronic
1183880743 22:40826381-40826403 CAGCTGCATTTGGGGGAGAGGGG + Exonic
1184204124 22:42990251-42990273 CAACTGGCTTTGGGTAAGAAGGG + Intronic
1184344920 22:43907395-43907417 CAGATGCCATTTGGGAAGAGGGG - Intergenic
1184931933 22:47687811-47687833 CTGCTGGCTTTGAGGATGAAGGG - Intergenic
1185193619 22:49454329-49454351 CAGGTGCCTTTGTAGATGAAGGG + Intronic
949898073 3:8785115-8785137 CAGCTGCCTTTAGGCCAGAGAGG - Intronic
950821186 3:15760711-15760733 TAGCTGAGTTTGGGGAAAAAAGG + Intronic
951506223 3:23447954-23447976 CAGCTGCATGTGAGGAAGAAAGG + Intronic
952298503 3:32083367-32083389 CACCTGTCCATGGGGAAGAAGGG + Intergenic
952751892 3:36831438-36831460 CCGTTGCTTTTGGGAAAGAATGG + Exonic
952943075 3:38457990-38458012 GGGCTGCCTTTTGGGAGGAATGG + Intronic
953145595 3:40271605-40271627 CAGCTTCCCTTGGGAAGGAAAGG - Intergenic
953757784 3:45662605-45662627 CAGCTGCCCTAGGGAAGGAAGGG - Intronic
953759816 3:45677732-45677754 CAGCTGCCTTTAGGAGAGTAAGG - Exonic
954197236 3:49004005-49004027 CTGCTGCCTTTGGGGTAGGTAGG + Intronic
954328998 3:49879151-49879173 ATGCTGCCTTTGGTTAAGAATGG + Intergenic
954488365 3:50876543-50876565 CAGCTGCATTTGGGGAAGAGGGG + Intronic
954780127 3:53052598-53052620 AAGCGGTCTTTGGGGATGAATGG - Intronic
958142513 3:89580159-89580181 GTGGTCCCTTTGGGGAAGAATGG - Intergenic
958736402 3:98014470-98014492 GAGCTGCCTTTGGGTAAGAAAGG + Intronic
959170860 3:102842189-102842211 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
959692895 3:109218804-109218826 CAGCTTCCTTTGGCTAGGAAAGG - Intergenic
961388525 3:126538041-126538063 CAGCTCTCTTTGGGGAAGCCGGG - Intronic
962251735 3:133840060-133840082 CAGCAGCCTCTAGGGAAGGAAGG + Intronic
963773885 3:149418955-149418977 TAGTTGCCTGTGGGGAGGAATGG + Intergenic
964761834 3:160141814-160141836 TGCTTGCCTTTGGGGAAGAAGGG - Intergenic
964843043 3:161015208-161015230 CAGCTGGTTTAGGGGAAGGAAGG - Intronic
965586126 3:170319758-170319780 CGGCTGACTTTGGGTAAGTAGGG - Intergenic
966363559 3:179156188-179156210 AAGCTGCCATTGGAAAAGAATGG + Intronic
966744213 3:183260213-183260235 CAACAACCTTTGAGGAAGAAAGG - Intronic
967171545 3:186826536-186826558 GAGCAGCCTTGGGGAAAGAAAGG - Intergenic
968442279 4:629988-630010 CAGGAGCCTCTGGGGAAGTAGGG + Intronic
968991469 4:3916177-3916199 CAGATGCCTTTGAGGAAAGATGG + Intergenic
970156227 4:13144324-13144346 CAGCTACCTTTGGGGGAGGGTGG - Intergenic
970500223 4:16669383-16669405 CAGCTGCCTCTGGAGAAGCCAGG + Intronic
970806025 4:20033047-20033069 CAACTGCCCTGGGGGAAGAAAGG - Intergenic
971168855 4:24212811-24212833 CAGCTTTCCTTGGGTAAGAATGG - Intergenic
971501817 4:27326392-27326414 CATCTGTGTTTGGGGGAGAAAGG + Intergenic
971812244 4:31441198-31441220 CAGATGCCTCTAGGTAAGAATGG + Intergenic
971834771 4:31748632-31748654 CAGCTGCAGTTGGAGAAGCATGG - Intergenic
972095316 4:35341267-35341289 CAGTTCTCTTTGGGGAAGGATGG - Intergenic
972332105 4:38073641-38073663 CAGCTGCTTTTGGTCAAAAATGG - Intronic
973017185 4:45155180-45155202 CAGCTGCCTTTCTGAAAGGAAGG + Intergenic
974054569 4:56972482-56972504 CAGATGGCTTTGGGGAACAATGG + Intronic
974364345 4:60926961-60926983 CAGCTGCTTCTGGGGCAGAAAGG - Intergenic
974458980 4:62163819-62163841 AAGGTCCCTTTGGGGAAGGATGG - Intergenic
974528546 4:63077268-63077290 CAGCTTCCCTTGGCTAAGAAAGG + Intergenic
975186972 4:71414750-71414772 CAGCTGCCATTAGGAAAGAAAGG - Intronic
976322787 4:83734522-83734544 CACCTGCCTTATGGGAAAAAGGG - Intergenic
976322797 4:83734593-83734615 TGGCTGGCTTTGGGGAAGAGGGG - Intergenic
976506495 4:85853383-85853405 CAGCTTCCCTTGGCTAAGAAAGG + Intronic
976564420 4:86537468-86537490 CTGGTTCCTTTGGGGAAGAATGG - Intronic
977739827 4:100465927-100465949 CAGCTGCCCTGGGAAAAGAAAGG + Intronic
978197166 4:105984963-105984985 CAGCTGCCCTTGGCTAGGAAAGG + Intronic
979075023 4:116260306-116260328 CAATTACCTTTGGGGAAGGATGG - Intergenic
980420764 4:132557744-132557766 TAGCTGATTTGGGGGAAGAAGGG + Intergenic
980655088 4:135772163-135772185 CATCTGCCTTTGGTCAGGAAAGG - Intergenic
981043401 4:140243793-140243815 CAGCTGCCTTGGGAGAATTAGGG + Intergenic
981254757 4:142648405-142648427 CAGCTTCCCTTGGGTAGGAAAGG - Intronic
982387885 4:154832510-154832532 CACAAGCCTTTGGAGAAGAAGGG + Intergenic
982443306 4:155461387-155461409 CCGCCGCCATTGGGGGAGAAAGG - Intergenic
983069835 4:163254657-163254679 CAGCTGCAGTTGGGGAGGTATGG - Intergenic
983685718 4:170406220-170406242 CAGCTGGCTTTGGAGATGAGAGG + Intergenic
984087679 4:175332552-175332574 CAGGTTCTTTTGGGGAAGTATGG - Intergenic
984241558 4:177225956-177225978 TGGCTGCCTTTGGGGAAAAAGGG - Intergenic
985286277 4:188339325-188339347 CAGCTCCCTATGGGAAACAATGG + Intergenic
985606105 5:858827-858849 CATCTGCCTTTTGGGAACATGGG + Intronic
985772218 5:1819577-1819599 CAGCTGCCTTTGAGGGAAATGGG + Intergenic
986234910 5:5899697-5899719 CAGGTGCATTTGGGGAAAATTGG - Intergenic
986614565 5:9602984-9603006 CAGTTGACTTTAGGGGAGAATGG - Intergenic
986877150 5:12125866-12125888 CAGCTGCCCTTGGCTAGGAAAGG - Intergenic
987152351 5:15055969-15055991 GACCTGACTCTGGGGAAGAAGGG + Intergenic
987304654 5:16625819-16625841 CAGCTTCTTTTGGGGAGGATGGG + Intergenic
987741323 5:21912812-21912834 TGGCTGGCTTTGGGGAAAAAGGG + Intronic
987744049 5:21947800-21947822 CAGCGGCCTCTGAGGAAAAAAGG + Intronic
988233470 5:28508497-28508519 GAGATGCTTTTGGGGAAGGATGG + Intergenic
990347686 5:54885554-54885576 CAGCTGGCCTTGTGGATGAATGG - Intergenic
991260139 5:64658243-64658265 CGGCTGTCTTTGGCGAAGAGAGG - Intergenic
991357444 5:65783510-65783532 CAGCTGGCTTTGAGGAAGGCTGG + Intronic
992402714 5:76426420-76426442 CAGCAACCTTTGGAGCAGAAGGG + Intronic
992811893 5:80397018-80397040 CAGCTTCCTTTGGCTATGAAAGG + Intergenic
993055752 5:82977288-82977310 CAGCTGCATTTAGGGGAGAGGGG - Intergenic
994672330 5:102777604-102777626 CAGATTCCTTCTGGGAAGAAAGG - Intronic
995459131 5:112384670-112384692 AAGCTTCTTTTGAGGAAGAAAGG + Intronic
996100409 5:119439383-119439405 CAGCTTCCCTTGGCTAAGAAAGG - Intergenic
996760973 5:126985333-126985355 AAGATGCATTTTGGGAAGAATGG + Intronic
997703695 5:135926683-135926705 CGGCTGGCTTTGGGGGAAAAGGG + Intronic
998354275 5:141521629-141521651 CAGCTGCCTCTCTGGAAAAAAGG + Intronic
999093145 5:148955136-148955158 TAGCTGCATTTGGGGGACAACGG + Intronic
999802186 5:155048526-155048548 CAGCTGAGTCTGTGGAAGAAGGG + Intergenic
999868340 5:155726450-155726472 CAACCGCCCTTGGTGAAGAATGG - Intergenic
1001196325 5:169676460-169676482 CAGTTTCCTTTGGGGAAGTGAGG + Intronic
1001493172 5:172169660-172169682 CAAGTGCCTTTTGGAAAGAAGGG - Intronic
1001494964 5:172181343-172181365 CAGAGGCCTTATGGGAAGAATGG - Intronic
1001998121 5:176178384-176178406 CAGCTGCCATGGAGGATGAAAGG + Intergenic
1002040134 5:176507382-176507404 CTCCTGCCTCTGGGGAAGAGAGG + Exonic
1002338418 5:178496368-178496390 CAGCTGCCCATGAGAAAGAAGGG + Intronic
1003381844 6:5631633-5631655 AAGCTGCCTGTGGGGCAGAGTGG - Intronic
1004717150 6:18228614-18228636 CAGCTTCCTTTGGCTAGGAAAGG - Intronic
1005475433 6:26203385-26203407 TAGCTAGCTTCGGGGAAGAATGG + Intergenic
1006673170 6:35742737-35742759 CAGCTGCCCATGGGGAAGGCAGG - Intronic
1006881340 6:37342608-37342630 CAGCTACTGTTGTGGAAGAAGGG - Intergenic
1007219328 6:40265962-40265984 CAGCTGCCTCTGGTGAAGGTGGG + Intergenic
1007241731 6:40431601-40431623 CAGACACCTTTGGGGAAGAGGGG + Intronic
1008767974 6:54942701-54942723 CAGCAGCCTATGGGTAAGAGGGG - Intergenic
1008907571 6:56696498-56696520 CAGCTGCCTTTGGAGGAGAGAGG - Intronic
1011446225 6:87444238-87444260 CAGCTGCATTTGGGGTAGAGGGG + Intronic
1012052631 6:94362615-94362637 CTGCTGCCTCTGGGGATGCAGGG + Intergenic
1012498767 6:99865074-99865096 TTGCTTCCTTTGTGGAAGAAGGG - Intergenic
1013603396 6:111726012-111726034 CAGCTGCCTTTAAAGATGAAGGG + Intronic
1013624061 6:111919827-111919849 CAGCTGGTTTGGGGGAAGAAAGG - Intergenic
1014428203 6:121334610-121334632 CACCTTACTTTGGGGAAGCAGGG + Intronic
1014902132 6:126979635-126979657 TGGCTGGCTTTGGGGAAGAGGGG - Intergenic
1016001011 6:139041206-139041228 AAGATGTCTTTGGGCAAGAATGG - Intronic
1016645530 6:146403414-146403436 CTGATGCCTTTAGGGAGGAAAGG - Intronic
1016833620 6:148455943-148455965 CAGCTGCCCTGGGGGCAGCAGGG - Intronic
1018301779 6:162410450-162410472 CTGCCTCCCTTGGGGAAGAAGGG + Intronic
1019230870 6:170561675-170561697 CAGATGCCTTCGGAGAATAATGG - Intronic
1019504955 7:1386092-1386114 CAGCTGCCCTTGGCAGAGAAAGG + Intergenic
1019650454 7:2154904-2154926 CAGCAGCCTGTGGAGAAGGACGG + Intronic
1019911402 7:4102507-4102529 CAGCTGCGTGTGGGGAAGGGAGG - Intronic
1020901192 7:14005477-14005499 CGGCTTACTTTGGGGAAGAAGGG - Intergenic
1022156983 7:27670572-27670594 CAGATGCCTTTGGAGAAGTCAGG + Intergenic
1022186219 7:27972110-27972132 CAGATTCCTTAGGGGAAGACAGG + Intronic
1022282420 7:28924557-28924579 CAGAGGCCTGTGAGGAAGAAGGG - Intergenic
1022388933 7:29927022-29927044 AAGCAGCCTTTGGGAAAGGAAGG + Intronic
1022836463 7:34121131-34121153 TATTTGCCTTTGGGGAAGAAGGG + Intronic
1023066079 7:36379006-36379028 CAGCTGCCCTTGGCTAGGAAAGG + Intronic
1024627815 7:51223349-51223371 GGGCTGCTTTTGGGGAAAAAAGG + Intronic
1024672992 7:51613537-51613559 CAGCTGCCATTTGAGAGGAAAGG - Intergenic
1024782977 7:52873918-52873940 CAGGCCCCTTTGGGGAAGAGTGG + Intergenic
1026229809 7:68472899-68472921 CCTCTGCATTTGGGGAAGTATGG - Intergenic
1027343299 7:77232754-77232776 CAGCTGCCCATGGGGAAGAAGGG + Intronic
1027747741 7:82099042-82099064 CAAATGCGTTTTGGGAAGAATGG - Intronic
1028116233 7:87001139-87001161 CAGCTGATTGTGAGGAAGAAAGG + Intronic
1030192081 7:106820276-106820298 TAGGTCCCTTTGGGGAAGGATGG - Intergenic
1030396744 7:108995501-108995523 TGGCTTTCTTTGGGGAAGAAGGG + Intergenic
1031379163 7:121063459-121063481 CAGCTGCAGTTGGAGAAGAGAGG - Intronic
1032073817 7:128826694-128826716 CAGCTGCTTTTGGGGCAGGGTGG + Intergenic
1032588331 7:133169252-133169274 CAGCTGCATTTGGGTTAGAGGGG + Intergenic
1032709965 7:134452800-134452822 CAACAGGCTTTGGGGAAGAAAGG + Intronic
1032788337 7:135219875-135219897 CAGCTGCATCTTGGTAAGAATGG + Intergenic
1034001935 7:147423996-147424018 CATCTCCCTGGGGGGAAGAATGG + Intronic
1034535451 7:151723211-151723233 TAAGTCCCTTTGGGGAAGAACGG + Intronic
1034816222 7:154174097-154174119 CAGTTTCCTTTGGGTGAGAACGG + Intronic
1035170370 7:157014090-157014112 CAGCTGGCTTTGGGGCAGTCTGG + Intergenic
1036993352 8:13626070-13626092 CAGCTGACATGGGGGAAGAAAGG - Intergenic
1037050169 8:14362602-14362624 CAGCTTCCCTTGGGTAGGAAAGG + Intronic
1038113464 8:24525808-24525830 CATCTGCCATTATGGAAGAATGG - Intronic
1038231499 8:25704806-25704828 CATCTGGCTTTTGTGAAGAAAGG + Intergenic
1038563427 8:28599908-28599930 CAGCTGCATTTGGGGTAGAAGGG + Intergenic
1038747036 8:30263551-30263573 CATCTGCCTTTGGGGTAACAGGG - Intergenic
1039466548 8:37788969-37788991 TGGCTGCCTCTGGGGAAAAAAGG + Intronic
1039726069 8:40218030-40218052 TAGCTTCCTTTGAGAAAGAAAGG - Intergenic
1040055588 8:43054795-43054817 CGGCTGGCTTTGGGGGAAAAGGG + Intronic
1040834317 8:51716741-51716763 CACCTGCCTTTGGGGATGCCTGG - Intronic
1041909431 8:63072652-63072674 CAGTTGACTGTGTGGAAGAATGG + Intronic
1042278447 8:67029228-67029250 CAGCTGTTTGGGGGGAAGAAAGG - Intronic
1042915154 8:73868188-73868210 CATCAATCTTTGGGGAAGAAGGG + Intronic
1042931274 8:74016098-74016120 CAGCTTCCTTTGGCTAGGAAAGG - Intronic
1043792388 8:84488535-84488557 AAGCAGCCTATTGGGAAGAAAGG - Intronic
1045049450 8:98309527-98309549 CTGCTGTCTTTGGAGGAGAATGG - Intergenic
1045952414 8:107866360-107866382 CAGGGGCCCTTGGGGAAGGAAGG - Intergenic
1046155405 8:110283362-110283384 CATATGCCTTTATGGAAGAATGG + Intergenic
1046602881 8:116338619-116338641 CAGCAGCCTTTGGAAATGAAAGG + Intergenic
1046630253 8:116616653-116616675 CAGCTGCATTTGTGAAGGAATGG + Intergenic
1047437780 8:124849032-124849054 CATCGCCCTCTGGGGAAGAAAGG - Intergenic
1047508021 8:125495212-125495234 CCGCTGCCCTTGGGGTGGAATGG - Intergenic
1047816082 8:128464549-128464571 CAGCTGCATTTGGAGAGGCAAGG - Intergenic
1048159330 8:131999274-131999296 CAGTTGCATTTGGGGAAAAAAGG - Intronic
1048322266 8:133409242-133409264 CAGCTGTATTTGGGGGAGAGGGG - Intergenic
1048857383 8:138696318-138696340 CATCTGCCTTGGGTGTAGAAGGG + Intronic
1049338822 8:142100972-142100994 CAGGTGCTTTTGGGGCAGACAGG + Intergenic
1049942632 9:562393-562415 CAACTGCTTCTGGGGAAGATGGG + Intronic
1050847433 9:10239893-10239915 CAGCTGGCTTTGGGGAAAAAGGG - Intronic
1051909659 9:22138804-22138826 TAGCTGACTCTGTGGAAGAAAGG - Intergenic
1053151693 9:35747925-35747947 CAGCTGCTTGTGGGAAATAAGGG + Intronic
1053404045 9:37855583-37855605 CATCTACCTTTGGGAAAGAGGGG + Intronic
1054792586 9:69269702-69269724 CAGGTGCCTTGGGGGAAGGCTGG + Intergenic
1055726640 9:79237425-79237447 CAGCTGGCTCTGAGGAAGCAGGG - Intergenic
1055832397 9:80396533-80396555 CAGCTCCCTTTGGGCAGGACAGG - Intergenic
1055957863 9:81791363-81791385 CAGCTGGCTTTGAAGATGAAGGG + Intergenic
1056007135 9:82284885-82284907 CAGCTGCCTCGGGGGAAGGTGGG - Intergenic
1056049160 9:82749929-82749951 CCACTGCCTTTGAGGCAGAATGG - Intergenic
1056594353 9:87993949-87993971 TAGCTGGCTTTGGGGAAAAGGGG - Intergenic
1057442202 9:95090806-95090828 CAGCTTCCTTTGAGGATTAAAGG + Intergenic
1057445416 9:95111197-95111219 CAAATGACCTTGGGGAAGAAGGG + Intronic
1057928190 9:99171063-99171085 CAGTTGCCCTGGGGAAAGAAGGG - Intergenic
1057943027 9:99301459-99301481 CACATGCCCTTAGGGAAGAAGGG + Intergenic
1058040430 9:100296013-100296035 AATCAGCCTTTGGGGAAGGAGGG + Intronic
1058259443 9:102811096-102811118 CAGTTACCTCTGGGGAAGGATGG + Intergenic
1058443693 9:105034320-105034342 CAGTTTCTTTTGGGGAATAATGG + Intergenic
1059306740 9:113359593-113359615 CAGGTGCCTTTGGGAAGGATTGG + Intronic
1059381600 9:113931364-113931386 CAGGAGCCTTTGAGGCAGAAGGG + Intronic
1060254152 9:122012329-122012351 TAACTTCCTTTGGGGAAGCAAGG + Intronic
1061119439 9:128634221-128634243 CAGCTGCCTCTGGGAAAGGTAGG - Exonic
1061251244 9:129427748-129427770 AGCCTGCCTTTGGGGCAGAACGG + Intergenic
1061475140 9:130860263-130860285 GCGGTGCCTTTGGGGGAGAATGG + Intronic
1061517021 9:131096127-131096149 CTGCTGCCTTTGGGGCAGTGCGG - Intergenic
1061575483 9:131503366-131503388 GTGCGGCCTGTGGGGAAGAAGGG + Intronic
1061608654 9:131730938-131730960 CAGCTGCCTCTGTGGCAGAGGGG + Intronic
1061746530 9:132744220-132744242 CAGCTGTGATTGGGGACGAAGGG - Intronic
1062609184 9:137366316-137366338 CAGCTGCCTCTGGAGAGGAGCGG - Intronic
1185503345 X:615385-615407 CTGGTGTCTTTGGGGAAAAAGGG - Intergenic
1186266134 X:7835902-7835924 AAACTGCCTTCTGGGAAGAATGG - Intergenic
1186473071 X:9836226-9836248 CAGCTGCCCTTGGGTAAAAGTGG + Intronic
1187981879 X:24765845-24765867 CAGTTGCCTCTGGAGAGGAAAGG - Intronic
1189035897 X:37493062-37493084 CGGTTGCCTCTGGAGAAGAAGGG + Intronic
1189099901 X:38178009-38178031 CAGCTGCCTTTGCAGAAGTGAGG + Intronic
1190734693 X:53248562-53248584 CAGACCCCTTTGGGGCAGAAGGG + Intronic
1191181143 X:57565142-57565164 CAGCTTCCTTTGGCTAGGAAAGG - Intergenic
1191831242 X:65418883-65418905 TAGGTCCCTTTGGGGAAGGATGG - Intronic
1192064346 X:67864982-67865004 CAGCTGCCTTTGGCTAGGAGAGG + Intergenic
1192222555 X:69207314-69207336 CGGCTGCCTTTGGGGTAAGAGGG - Intergenic
1192677532 X:73214316-73214338 CCGCTGGGCTTGGGGAAGAAGGG - Exonic
1193409297 X:81143581-81143603 CAGCTCCCTTTGGCTAGGAAAGG - Intronic
1194388493 X:93287576-93287598 CAGCTGCATTTGGGGGAGAGGGG + Intergenic
1194805963 X:98328387-98328409 CGGCTGGCTTTGGGGAAAAGGGG + Intergenic
1195306195 X:103586001-103586023 GAGTTGCCTCTGAGGAAGAAGGG + Exonic
1196498528 X:116350786-116350808 CAGAGGCCTATGGGGAAAAATGG + Intergenic
1196939308 X:120760022-120760044 CAGCAGACTTGGGGGAAGTAGGG - Intergenic
1198058580 X:133020721-133020743 ATGCTGGCTTTGGGGAAAAAGGG + Intergenic
1198123739 X:133621392-133621414 CAGCTTCCTTTGGCTAGGAAAGG - Intronic
1198134231 X:133731492-133731514 TGGCTGCCTTTTGTGAAGAAAGG - Intronic
1198434645 X:136604683-136604705 CAACAGCCTTGGGGGAGGAAAGG + Intergenic
1200228418 X:154432084-154432106 ACGCTGGCTTTGGGGTAGAAAGG + Intronic
1201333504 Y:12853442-12853464 CAGCTTCCCTTGGCTAAGAAAGG + Intronic