ID: 1163171060

View in Genome Browser
Species Human (GRCh38)
Location 19:15531455-15531477
Sequence GCATCTGGGGACCATCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 182}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163171053_1163171060 0 Left 1163171053 19:15531432-15531454 CCCAGCTTTGCCTCTACAAACAC 0: 1
1: 0
2: 1
3: 11
4: 179
Right 1163171060 19:15531455-15531477 GCATCTGGGGACCATCTCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 182
1163171057_1163171060 -10 Left 1163171057 19:15531442-15531464 CCTCTACAAACACGCATCTGGGG 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1163171060 19:15531455-15531477 GCATCTGGGGACCATCTCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 182
1163171052_1163171060 22 Left 1163171052 19:15531410-15531432 CCAGGAATTTTAGGATCTCTGTC 0: 1
1: 0
2: 1
3: 21
4: 212
Right 1163171060 19:15531455-15531477 GCATCTGGGGACCATCTCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 182
1163171054_1163171060 -1 Left 1163171054 19:15531433-15531455 CCAGCTTTGCCTCTACAAACACG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1163171060 19:15531455-15531477 GCATCTGGGGACCATCTCCAGGG 0: 1
1: 0
2: 1
3: 13
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163171060 Original CRISPR GCATCTGGGGACCATCTCCA GGG Intronic
900515983 1:3082458-3082480 GGGTCTGGGGACCATTCCCAAGG + Intronic
900891014 1:5449719-5449741 GCTTCTGGGCTCCTTCTCCATGG + Intergenic
904541829 1:31238825-31238847 GCTCCTGGTGACCCTCTCCAGGG + Intronic
905068607 1:35205760-35205782 GCTTTTGGGCTCCATCTCCATGG + Intergenic
905257868 1:36696651-36696673 CCATCTGGGGCCCATCTGCAGGG + Intergenic
905295948 1:36954488-36954510 GCATGTGGGGAGCCACTCCAGGG + Intronic
905559001 1:38911362-38911384 GCCTTTGTGGACCATTTCCAAGG + Exonic
906103822 1:43279788-43279810 GCCTCTGGGGTCCTCCTCCAGGG + Intergenic
907740325 1:57159409-57159431 GCATGTGGGAACCACCACCAGGG - Intronic
916476627 1:165175446-165175468 GCATCTCAAGACCATCTGCAGGG - Intergenic
917204837 1:172561447-172561469 GCATCAGGGCACCACCTTCATGG - Intronic
920588033 1:207187602-207187624 CCATCTTGGTACCATATCCAAGG - Intergenic
921624875 1:217368966-217368988 ACACCTGGGGATGATCTCCAAGG - Intergenic
922888278 1:229037394-229037416 GTATCCTGGGACCATCTGCAAGG - Intergenic
923435847 1:233966966-233966988 GCATCTGTGGAACTTCTACAGGG + Intronic
923467838 1:234265084-234265106 GCATCTGGGGGTCATCATCAGGG - Intronic
924250590 1:242129107-242129129 GCAACTGGGCACCGTCTCCCTGG + Intronic
924593918 1:245428787-245428809 ACATCTGGGAATCATTTCCACGG + Intronic
1067351927 10:45484324-45484346 GCATCTGGGGAACATCCTCCAGG + Intronic
1073329561 10:102661433-102661455 GCAGCTGGGGAACAGCTGCAAGG + Intergenic
1073892005 10:108112848-108112870 GCATCAGGGAATCATCTTCATGG - Intergenic
1076534336 10:131167270-131167292 CCATCTGGTGACAATCACCAGGG + Intronic
1076947582 10:133661968-133661990 GCTTCTGGGGGCCGTCCCCAAGG + Intergenic
1077195461 11:1277654-1277676 GCATCTGGGGACGGACTACACGG + Intronic
1077266730 11:1654644-1654666 GCTGCTGGGGACCCTCTGCAAGG - Intergenic
1077597680 11:3547971-3547993 GGATCATGGGACCCTCTCCATGG + Intergenic
1077925594 11:6679542-6679564 GCAACTGGAGATCATCACCAGGG + Intergenic
1078264973 11:9748462-9748484 CCATCTGTGCACCCTCTCCATGG - Intronic
1078929401 11:15901575-15901597 GGGTCTGGGGACCATCTCCAAGG - Intergenic
1079508877 11:21186530-21186552 TCATCTCTGGACCCTCTCCAAGG + Intronic
1080116598 11:28628521-28628543 CCATCTGGGGATCAACTCAAAGG - Intergenic
1083606716 11:63983167-63983189 GCAGCATGGGACCATTTCCAGGG + Intronic
1083907856 11:65685745-65685767 GCATCAGGGAATCATCTTCACGG + Intergenic
1084253779 11:67923876-67923898 GGATCATGGGACCCTCTCCATGG + Intergenic
1084358004 11:68652290-68652312 GGGCCTGGGGACCATCTCCCTGG - Intergenic
1084819102 11:71672050-71672072 GGATCATGGGACCCTCTCCATGG - Intergenic
1087183578 11:95162204-95162226 CCATCTGGGGGCCCTCCCCAGGG + Intergenic
1089388443 11:118083400-118083422 GCATCTGGGGACAGTGACCAGGG - Intronic
1089691407 11:120188959-120188981 GCAGCCGGGGCCCATCCCCAGGG - Intergenic
1090386058 11:126358102-126358124 GCATCTAAGGTCCATCTCCGAGG - Intronic
1090899136 11:131010573-131010595 GCATCAGGGGACAAAATCCAAGG - Intergenic
1092024684 12:5230833-5230855 GCTTCTGGGGGACATCTCAAAGG + Intergenic
1092240297 12:6831887-6831909 GCACCTGGGGACCAGCTTCAAGG + Exonic
1094272749 12:28635688-28635710 CAAACTGGGCACCATCTCCAAGG - Intergenic
1096062826 12:48716467-48716489 GCATGGCGGGACCAACTCCAAGG + Intronic
1102098227 12:110257368-110257390 GCTTCTAGGGACTCTCTCCAGGG + Intergenic
1106652353 13:31705148-31705170 GCATCTGAGCAACATCCCCAAGG - Intergenic
1107862968 13:44678360-44678382 GCATTTGGGCACCAGCTGCAGGG + Intergenic
1108436881 13:50409655-50409677 GCATCTGAGGCACATTTCCAGGG - Intronic
1109798403 13:67344839-67344861 TCATCTGGGGACCATTGCAAGGG + Intergenic
1110607560 13:77450555-77450577 GCATCTGGTGACAAGCTCCCTGG + Intergenic
1113793570 13:113043471-113043493 GCAGCTGGGTTCCATCTCCGTGG + Intronic
1113839517 13:113350865-113350887 GCATATGGGCACCATAACCAGGG - Exonic
1114533373 14:23408830-23408852 GGATCTGTTGTCCATCTCCATGG + Intergenic
1115444127 14:33469946-33469968 GCATCAGGGGGCCAGCTCAAGGG + Intronic
1119444033 14:74648734-74648756 GCAGCTGGGACCCATCTCCCTGG + Intergenic
1120178497 14:81319905-81319927 CCATAAGGGGACCATGTCCAGGG + Intronic
1120838852 14:89065136-89065158 GGATCTGGGGACCTCCTCAATGG - Intergenic
1122295297 14:100702115-100702137 TCATCTGGGGTCCTTCTCCTGGG + Intergenic
1132046088 15:98563857-98563879 GCACTGGGGCACCATCTCCATGG - Intergenic
1133294209 16:4742940-4742962 ACATCCTGTGACCATCTCCATGG + Intronic
1133366867 16:5217063-5217085 GGGGCTGGGGATCATCTCCAAGG + Intergenic
1133608821 16:7413960-7413982 ACATCTGAGAACCATCTCCTTGG - Intronic
1134538326 16:15044585-15044607 GCTTCTGGGGACCCTGCCCAGGG + Intronic
1137359887 16:47804592-47804614 ACATTTGAGGAGCATCTCCAGGG + Intergenic
1137364250 16:47847101-47847123 GCATCTGTAGAGAATCTCCATGG + Intergenic
1141412866 16:83847347-83847369 GCATCTTGGGAGGATCTCTAAGG + Intergenic
1144303855 17:13949438-13949460 GTAACTAGGGACCATTTCCACGG - Intergenic
1144862533 17:18314683-18314705 GCCTCGGAGGGCCATCTCCATGG + Exonic
1146946321 17:36876159-36876181 GCATCTGAGGAGGATCTCCAGGG - Intergenic
1147516269 17:41120775-41120797 GCAGCTGGGGACGAACCCCAGGG + Intergenic
1148745055 17:49913436-49913458 GCATCTAGGGACCATATCTTAGG - Intergenic
1149396932 17:56254767-56254789 GGATCTGGGGCCCATGTTCATGG - Intronic
1151011999 17:70510394-70510416 GCATGTGGGGGCCATCTTGAAGG - Intergenic
1152303046 17:79506582-79506604 CCATCTGGGGTCCAGCTCCCCGG - Intronic
1152739842 17:82014076-82014098 GCCTCTGGGGACCGTCTGCCAGG + Intronic
1152742926 17:82026272-82026294 GCATCTGGCCACCATCCCAAAGG - Intronic
1153138126 18:1941291-1941313 GGATCTGGGGACCAGGCCCAAGG + Intergenic
1153710796 18:7796783-7796805 TCATCTGGTGACCATCTCAAGGG + Intronic
1159106153 18:64003340-64003362 TGAAGTGGGGACCATCTCCAGGG + Intronic
1160244827 18:77148942-77148964 GAAGCTGTGGACCATCTCCTCGG - Intergenic
1160518467 18:79490999-79491021 GTACCTGGGGACCGTCTCGATGG + Intronic
1160543981 18:79640771-79640793 GCATCTGGGGGGCATCTACATGG - Intergenic
1161773050 19:6241726-6241748 GCATCTGGGGACCCACTTCAGGG + Intronic
1163171060 19:15531455-15531477 GCATCTGGGGACCATCTCCAGGG + Intronic
1164598918 19:29548210-29548232 CCATCTGGGCATCATCACCAAGG + Intronic
1165248593 19:34512836-34512858 CCATCTGAGGACCCTCCCCAAGG + Intergenic
1165258862 19:34596677-34596699 CCATTTGGGGACCCTCCCCAGGG + Intronic
1165266425 19:34666119-34666141 CAATCTGGGGACCCTCCCCAAGG - Intronic
1167402787 19:49284023-49284045 ACATCTGGGCACCATCTTTAAGG + Intergenic
925306432 2:2850539-2850561 GCATCTGGGGCGCATCTCTGTGG - Intergenic
931074653 2:58696247-58696269 GCATCTGGCTACCATCCCCTGGG - Intergenic
932616189 2:73233146-73233168 GGCGCCGGGGACCATCTCCAGGG + Exonic
933224105 2:79725734-79725756 GGAACTGGGGAGCATCTTCAAGG - Intronic
933261730 2:80138675-80138697 TCATCCTGGGACCATCTGCATGG + Intronic
934853217 2:97714018-97714040 GCACCTGGCCACCGTCTCCATGG + Intronic
935115762 2:100135010-100135032 GCATCTGGGGAAGAGCTCCAAGG + Intronic
935205328 2:100891858-100891880 GCATTTGGGGAACAGTTCCATGG + Intronic
935277190 2:101485130-101485152 GCTTCTGGGGACCATTGACAGGG - Intergenic
937981890 2:127620534-127620556 GAATCTGTGGACCTGCTCCAGGG - Intronic
938243647 2:129761506-129761528 GCATTTGGGCACCATCTTCCTGG - Intergenic
939674845 2:145059942-145059964 GCCTCTGGGGGCCATTTCCAGGG + Intergenic
945197395 2:207250134-207250156 GCCACTGTGGGCCATCTCCATGG + Intergenic
948221381 2:236272429-236272451 GAATATGAGGGCCATCTCCAAGG - Intergenic
948687041 2:239676169-239676191 CCAGATGGGGACCAGCTCCACGG + Intergenic
1169205437 20:3737547-3737569 TCATCTGGGGACCTTTTACAGGG + Intronic
1170982394 20:21226852-21226874 GCCTCTGTGGCCCTTCTCCAAGG - Intronic
1171356285 20:24547888-24547910 ACATCTGGTCACCATCTCTAAGG - Intronic
1172734772 20:37118193-37118215 GCATCTTGGGAGCATATCAATGG + Intronic
1174193687 20:48758010-48758032 GCATCTGGGGAACCACCCCAAGG - Intronic
1176664920 21:9677532-9677554 GAGTCTGGGGACCAACTGCATGG + Intergenic
1179486421 21:41713671-41713693 CCCACTGGGGACCATTTCCAGGG - Intergenic
1179498283 21:41789515-41789537 GCAACTTGGGAGCATCTCCAGGG + Intergenic
1182155714 22:28071067-28071089 ACATCTGGGGGCCAAATCCAAGG + Intronic
1183090308 22:35518006-35518028 GCATTTGTGGACCACATCCAGGG - Intergenic
1183182130 22:36267289-36267311 TCAGCTGGGGACCATGGCCATGG - Exonic
1183960680 22:41410226-41410248 GAAGCTGGGGTCCACCTCCAGGG + Intergenic
1185285001 22:49996181-49996203 GCCTCTGGAGACCCTTTCCAGGG - Exonic
950752765 3:15143915-15143937 GGATCATGGGACCCTCTCCATGG - Intergenic
951537757 3:23755045-23755067 CCACTTGGGGACCATTTCCATGG + Intergenic
953182897 3:40613149-40613171 ACATCTGCGTTCCATCTCCATGG - Intergenic
953224339 3:41002552-41002574 ACCTCTGGGGACCAATTCCATGG + Intergenic
953981304 3:47414491-47414513 GCCCCTGGGGACCAGCTCCCAGG + Intronic
954201421 3:49025578-49025600 GCCTCTGGGGACTAACTGCACGG - Intronic
956467807 3:69536268-69536290 CCATCAGGGGGCCATCTCCCTGG + Intronic
957865226 3:86014319-86014341 GCCTTTGGGGAAAATCTCCAGGG + Intronic
962264271 3:133934454-133934476 GCATCTGGGGGCCTCTTCCAAGG + Exonic
963604220 3:147400416-147400438 GCATCTGGGAAGGAGCTCCATGG - Intronic
963779351 3:149471740-149471762 GAATATGGGCACTATCTCCATGG - Intergenic
965807636 3:172558571-172558593 TCATCTGGGGAGCATTTACAAGG - Intergenic
967847415 3:194055139-194055161 GCAGCAGGGGACCTTCCCCAAGG - Intergenic
968695641 4:2024862-2024884 GCATCAGGGAACCATCTTCATGG - Intronic
969343326 4:6556086-6556108 GCCTCTGGGGAGCATCCGCATGG + Intronic
969741665 4:9032812-9032834 GGATCATGGGACCCTCTCCATGG - Intergenic
969801032 4:9565715-9565737 GGATCATGGGACCCTCTCCACGG - Intergenic
972750497 4:41982913-41982935 GCATCCGGGGAGCAGCACCAGGG + Exonic
980249144 4:130291380-130291402 GCATCTGGGGACAGAGTCCAGGG + Intergenic
980891875 4:138824329-138824351 ATATCTGGGAACCATCCCCATGG - Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
985183537 4:187291388-187291410 GCTTCTGTGAACCATCACCAGGG - Intergenic
985410392 4:189677978-189678000 GAGTCTGGGGACCAACTGCAGGG + Intergenic
985451038 4:190062765-190062787 GCTTCTGGGGGCCGTCCCCAAGG + Intergenic
986201829 5:5586223-5586245 GCAGCTGGGGATCACCTCCCTGG + Intergenic
986772738 5:10988478-10988500 GCAACTGGGGACCACATCCTGGG + Intronic
995179294 5:109215299-109215321 GCCTCTGTGCACCCTCTCCATGG - Intergenic
998172626 5:139881426-139881448 GAGTCTGGGCACCATCACCATGG - Intronic
1001080209 5:168662089-168662111 TCATGTGGGGACCATCTGCCTGG + Intronic
1002331201 5:178442140-178442162 TCATCTGGGGACCTTGGCCAAGG - Intronic
1002861797 6:1085975-1085997 GCACCTTGGGGCCAGCTCCATGG - Intergenic
1005202013 6:23358113-23358135 CTATCTGAAGACCATCTCCATGG + Intergenic
1006438763 6:34040578-34040600 GCAGCTGGGTGCCATCTACAGGG + Exonic
1006778685 6:36616971-36616993 GCCTAGGGGGGCCATCTCCAGGG + Intergenic
1007205372 6:40145708-40145730 GGATCTGTGGACCACCTCTATGG + Intergenic
1011260653 6:85466377-85466399 ACATCTGGGGAAGAACTCCATGG - Intronic
1012625984 6:101403248-101403270 GCTCCTGGGCACCATCTCCAAGG + Intronic
1013362812 6:109410404-109410426 GCATCAGGGAATCATCTTCATGG + Intronic
1013630231 6:111979531-111979553 GAAGCTGGGAACCAACTCCATGG - Intergenic
1018160954 6:161041639-161041661 GCACCTGGGGGCCATGTCCGAGG - Intronic
1019479574 7:1260291-1260313 GCATCTGGGCTCTTTCTCCAGGG - Intergenic
1024005941 7:45224898-45224920 ACATCTGGTGGCCATGTCCAGGG - Intergenic
1024020106 7:45360921-45360943 GCTCCTGGGCCCCATCTCCAGGG - Intergenic
1026015227 7:66666795-66666817 AACTCAGGGGACCATCTCCAGGG - Intronic
1029129613 7:98319927-98319949 GCATCTGGGCATCATCAACACGG + Intronic
1029519804 7:101052796-101052818 TCATTTGAGGACCACCTCCAGGG + Intronic
1029988769 7:104944313-104944335 CCATCTGGGGACCCCCTCAAAGG + Intergenic
1033665782 7:143439106-143439128 GCATCTGGGATCCACCTCCTGGG - Intergenic
1034824523 7:154249704-154249726 GCATCTGGGGACAGGCTCCGTGG - Intronic
1035044705 7:155956049-155956071 GCATCCCAGGACCACCTCCAGGG - Intergenic
1035059025 7:156055491-156055513 GCAGCTGAGGAGCAGCTCCACGG - Intergenic
1036246867 8:7125410-7125432 GGATCATGGGACCCTCTCCACGG - Intergenic
1036887403 8:12568591-12568613 GGATCATGGGACCCTCTCCACGG + Intergenic
1037484704 8:19336399-19336421 GGATGTGGGGAGCATGTCCAGGG - Intronic
1037961250 8:23099946-23099968 GCCTCTGGTGACCACCTCAAGGG + Intronic
1037970429 8:23167911-23167933 GCCTCTGGTGACCACCTCAAGGG - Intergenic
1038668418 8:29561833-29561855 TCTTCTGGGAACCAACTCCAGGG + Intergenic
1039577406 8:38634426-38634448 GTAGCTGAGGACCATCTCCACGG + Intergenic
1041063038 8:54054540-54054562 GCATCTGGGGACTGGTTCCATGG + Intronic
1041971614 8:63749491-63749513 CCATCTGTGTTCCATCTCCATGG - Intergenic
1042760850 8:72270016-72270038 GCATCAGGGAATCATCTTCATGG + Intergenic
1045010920 8:97957732-97957754 GGATCTGGGCACCTTCCCCAGGG + Intronic
1045346724 8:101300284-101300306 GCACCTGGGTCCCATCTCCTTGG - Intergenic
1048932681 8:139327379-139327401 CCTTCTGAGGCCCATCTCCATGG - Intergenic
1049414457 8:142488924-142488946 GCATCTGCCGCCCATCTTCAAGG - Intronic
1049543771 8:143220220-143220242 GGTTCTGGGGAGGATCTCCAGGG - Intergenic
1050994780 9:12202789-12202811 GATTCTGGGTACCATGTCCAGGG - Intergenic
1051609200 9:18945006-18945028 TCATCTGCAGACCATCTCCTAGG + Intronic
1061629919 9:131865868-131865890 GGATCTGGGGACCATCTCATAGG + Intronic
1061821890 9:133233579-133233601 ACATCTGGGCACTTTCTCCATGG - Intergenic
1062360906 9:136187627-136187649 GCATGTGGGGACCCTGTTCACGG - Intergenic
1203661181 Un_KI270753v1:44217-44239 GAGTCTGGGGACCAACTGCATGG - Intergenic
1203672366 Un_KI270755v1:27447-27469 GAGTCTGGGGACCAACTGCAGGG - Intergenic
1185597130 X:1314129-1314151 GCACCTACGGACCCTCTCCAAGG + Intergenic
1187264146 X:17715907-17715929 GAATCTGCAGACCATCTGCAGGG + Intronic
1189514482 X:41698731-41698753 GCATCTTAGGACAAACTCCAAGG + Intronic
1192034525 X:67547344-67547366 GCAACTGGGGACTTGCTCCAGGG + Intronic
1197122356 X:122907022-122907044 GCATCTGGAGACTCTGTCCAGGG - Intergenic
1202150517 Y:21839853-21839875 GCCTCTTTGGGCCATCTCCATGG + Intergenic