ID: 1163174857

View in Genome Browser
Species Human (GRCh38)
Location 19:15557128-15557150
Sequence ATGGAGAAGAGGGATGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163174857_1163174869 23 Left 1163174857 19:15557128-15557150 CCTTCCCCATCCCTCTTCTCCAT No data
Right 1163174869 19:15557174-15557196 TCACCTCCCAAAGAAACAACAGG No data
1163174857_1163174864 -2 Left 1163174857 19:15557128-15557150 CCTTCCCCATCCCTCTTCTCCAT No data
Right 1163174864 19:15557149-15557171 ATTGCCCTAATTGTGTTTCCAGG No data
1163174857_1163174865 -1 Left 1163174857 19:15557128-15557150 CCTTCCCCATCCCTCTTCTCCAT No data
Right 1163174865 19:15557150-15557172 TTGCCCTAATTGTGTTTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163174857 Original CRISPR ATGGAGAAGAGGGATGGGGA AGG (reversed) Intergenic
No off target data available for this crispr