ID: 1163179915

View in Genome Browser
Species Human (GRCh38)
Location 19:15592027-15592049
Sequence GTTTCCTGGCACCACCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163179915_1163179924 24 Left 1163179915 19:15592027-15592049 CCAGGCTGGTGGTGCCAGGAAAC No data
Right 1163179924 19:15592074-15592096 TGGCTGAAAGAGGAGGGCAGAGG No data
1163179915_1163179923 18 Left 1163179915 19:15592027-15592049 CCAGGCTGGTGGTGCCAGGAAAC No data
Right 1163179923 19:15592068-15592090 GATCTGTGGCTGAAAGAGGAGGG No data
1163179915_1163179921 14 Left 1163179915 19:15592027-15592049 CCAGGCTGGTGGTGCCAGGAAAC No data
Right 1163179921 19:15592064-15592086 CCAAGATCTGTGGCTGAAAGAGG No data
1163179915_1163179922 17 Left 1163179915 19:15592027-15592049 CCAGGCTGGTGGTGCCAGGAAAC No data
Right 1163179922 19:15592067-15592089 AGATCTGTGGCTGAAAGAGGAGG No data
1163179915_1163179918 4 Left 1163179915 19:15592027-15592049 CCAGGCTGGTGGTGCCAGGAAAC No data
Right 1163179918 19:15592054-15592076 GCTCCTGGAACCAAGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163179915 Original CRISPR GTTTCCTGGCACCACCAGCC TGG (reversed) Intergenic
No off target data available for this crispr