ID: 1163189597

View in Genome Browser
Species Human (GRCh38)
Location 19:15666876-15666898
Sequence GCTAGGAGCTACCTCCTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163189597_1163189600 -10 Left 1163189597 19:15666876-15666898 CCTGATAGGAGGTAGCTCCTAGC No data
Right 1163189600 19:15666889-15666911 AGCTCCTAGCTGCTGATGGGAGG No data
1163189597_1163189604 1 Left 1163189597 19:15666876-15666898 CCTGATAGGAGGTAGCTCCTAGC No data
Right 1163189604 19:15666900-15666922 GCTGATGGGAGGTGCTTCTGGGG No data
1163189597_1163189602 -1 Left 1163189597 19:15666876-15666898 CCTGATAGGAGGTAGCTCCTAGC No data
Right 1163189602 19:15666898-15666920 CTGCTGATGGGAGGTGCTTCTGG No data
1163189597_1163189603 0 Left 1163189597 19:15666876-15666898 CCTGATAGGAGGTAGCTCCTAGC No data
Right 1163189603 19:15666899-15666921 TGCTGATGGGAGGTGCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163189597 Original CRISPR GCTAGGAGCTACCTCCTATC AGG (reversed) Intergenic
No off target data available for this crispr